Restriction Map of ILV1/YER086W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ILV1/YER086W on chromosome V from coordinates 328477 to 330207.


AluI Csp6I SetI CviJI |RsaI |Hpy166II | SetI || Tsp4CI* || Tsp4CI* \ \ \\ \ \\ \ ATGTCAGCTACTCTACTAAAGCAACCATTATGTACGGTTGTTCGGCAAGGTAAACAGTCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTCGATGAGATGATTTCGTTGGTAATACATGCCAACAAGCCGTTCCATTTGTCAGG / / /// / / / | CviJI ||Tsp4CI* SetI | Tsp4CI* | AluI |Csp6I Hpy166II SetI RsaI M S A T L L K Q P L C T V V R Q G K Q S C Q L L Y * S N H Y V R L F G K V N S P V S Y S T K A T I M Y G C S A R * T V Q ----:----|----:----|----:----|----:----|----:----|----:----| X D A V R S F C G N H V T T R C P L C D X T L * E V L A V M I Y P Q E A L Y V T H * S S * * L L W * T R N N P L T F L G Hpy178III* SetI | BsmAI MaeIII | | SetI CviJI CviRI* HphI Tsp45I \ \ \ \ \ \ \ AAAGTGTCTGGATTGAACCTTTTGAGACTAAAGGCTCATTTGCACAGACAACACCTGTCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCACAGACCTAACTTGGAAAACTCTGATTTCCGAGTAAACGTGTCTGTTGTGGACAGT / / / / / / / / | SetI BsmAI CviJI CviRI* | SetI SetI Hpy178III* HphI K V S G L N L L R L K A H L H R Q H L S K C L D * T F * D * R L I C T D N T C H S V W I E P F E T K G S F A Q T T P V T ----:----|----:----|----:----|----:----|----:----|----:----| L T D P N F R K L S F A * K C L C C R D W L T Q I S G K S V L P E N A C V V G T F H R S Q V K Q S * L S M Q V S L V Q * TseI AluI CviJI BseGI |BisI Hpy188I ||BlsI |TspEI ||SetI || BbvI |||CviRI* SetI Hin4II* || | TspEI |||| FokI \ \ \\ \ \ \\\\ \ CCTTCCTTGATAAAACTACACTCTGAATTGAAATTGGATGAGCTGCAAACTGATAACACC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGGAACTATTTTGATGTGAGACTTAACTTTAACCTACTCGACGTTTGACTATTGTGG / / / / / / / //// / / Tsp45I Hin4II* | | | | | |||CviRI* FokI TspGWI MaeIII | | | | | |||TseI | | | | | ||BisI | | | | | |BlsI | | | | | CviJI | | | | | AluI | | | | BseGI | | | | SetI | | | TspEI | | BbvI | TspEI Hpy188I P S L I K L H S E L K L D E L Q T D N T L P * * N Y T L N * N W M S C K L I T P F L D K T T L * I E I G * A A N * * H P ----:----|----:----|----:----|----:----|----:----|----:----| G E K I F S C E S N F N S S S C V S L V V K R S L V V S Q I S I P H A A F Q Y C R G Q Y F * V R F Q F Q I L Q L S I V G MseI | AsuI* | AvaII | DraII | PpuMI | |BmgT120I MseI | || AccI VspI MaeII | || |BssNAI | Bce83I* | SetI | || |Hpy166II | | TfiI TspGWI | TaiI | ||SetI || MnlI | | HinfI \ \ \ \ \\\ \\ \ \ \ \ CCTGATTACGTCCGTTTAGTTTTAAGGTCCTCTGTATACGATGTTATTAATGAATCTCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTAATGCAGGCAAATCAAAATTCCAGGAGACATATGCTACAATAATTACTTAGAGGT / / / // /// // / | MaeII | |PpuMI ||MnlI |VspI HinfI TaiI | |DraII |AccI |MseI TfiI SetI | |AvaII Hpy166II Bce83I* | |AsuI* BssNAI | BmgT120I MseI SetI P D Y V R L V L R S S V Y D V I N E S P L I T S V * F * G P L Y T M L L M N L Q * L R P F S F K V L C I R C Y * * I S N ----:----|----:----|----:----|----:----|----:----|----:----| G S * T R K T K L D E T Y S T I L S D G G Q N R G N L K L T R Q I R H * * H I E R I V D T * N * P G R Y V I N N I F R W SetI | MboII MboI SmlI | BbvII* BglII TspDTI | | SetI Hpy178III* XhoII \ \ \ \ \ \ ATCTCTCAAGGTGTAGGTTTGTCTTCCCGTCTAAACACGAATGTCATCTTGAAAAGAGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGAGTTCCACATCCAAACAGAAGGGCAGATTTGTGCTTACAGTAGAACTTTTCTCTT / // // / / | || || BbvII* Hpy178III* | || |SetI | || MboII | |SmlI | SetI TspDTI I S Q G V G L S S R L N T N V I L K R E S L K V * V C L P V * T R M S S * K E K L S R C R F V F P S K H E C H L E K R R ----:----|----:----|----:----|----:----|----:----|----:----| I E * P T P K D E R R F V F T M K F L S L R E L H L N T K G D L C S H * R S F L D R L T Y T Q R G T * V R I D D Q F S F HindIII FatI | AluI HgiCI* |CviAII DpnI MboII | CviJI | NlaIV || CspCI |BstKTI | CspCI | | SetI | | MmeI || |NlaIII \\ \ \ \ \ \ \ \ \ \\ \\ GATCTATTGCCTGTTTTCTCTTTCAAGCTTCGTGGTGCCTATAACATGATTGCCAAGTTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGATAACGGACAAAAGAGAAAGTTCGAAGCACCACGGATATTGTACTAACGGTTCAAC // / // / / / / / // // || | |CspCI | | | | | || |FatI || | MboII | | | | | || CviAII || XhoII | | | | | |CspCI || BglII | | | | | NlaIII || MboI | | | | HgiCI* |DpnI | | | NlaIV BstKTI | | | MmeI | | HindIII | CviJI | AluI SetI D L L P V F S F K L R G A Y N M I A K L I Y C L F S L S S F V V P I T * L P S W S I A C F L F Q A S W C L * H D C Q V G ----:----|----:----|----:----|----:----|----:----|----:----| S R N G T K E K L S R P A * L M I A L N L D I A Q K R K * A E H H R Y C S Q W T I * Q R N E R E L K T T G I V H N G L Q MwoI | AluI | BseYI | CviJI | PvuII | NspBII* | | SetI | | | GsaI | | | |TfiI | | | |HinfI | | | || FatI | | | || |CviAII | | | || || NlaIII | | | || || | StyI BssKI | | | || || | SecI* EcoRII | | | || || | | BbvI |SecI* | | | || || | | | SetI TfiI ||ScrFI | | | || || | | | PflMI HinfI ||BseBI | | | || || | | | BsiYI* \ \\\ \ \ \ \\ \\ \ \ \ \ GACGATTCTCAAAGAAACCAGGGTGTTATTGCCTGTTCAGCTGGGAATCATGCCCAAGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTAAGAGTTTCTTTGGTCCCACAATAACGGACAAGTCGACCCTTAGTACGGGTTCCA / / / / / / / / // /// HinfI | EcoRII | | | | | || ||SecI* TfiI | BssKI | | | | | || ||StyI | SecI* | | | | | || |BsiYI* BseBI | | | | | || |PflMI ScrFI | | | | | || SetI | | | | | |FatI | | | | | CviAII | | | | NlaIII | | | | HinfI | | | | TfiI | | | BseYI | | NspBII* | | PvuII | | CviJI | | AluI | | GsaI | SetI MwoI D D S Q R N Q G V I A C S A G N H A Q G T I L K E T R V L L P V Q L G I M P K V R F S K K P G C Y C L F S W E S C P R C ----:----|----:----|----:----|----:----|----:----|----:----| S S E * L F W P T I A Q E A P F * A W P P R N E F F G P H * Q R N L Q S D H G L V I R L S V L T N N G T * S P I M G L T CviJI HaeIII TatI | TseI Bsp1407I | MwoI |Csp6I | |BisI ||RsaI | ||BlsI SetI BspMI |||Hpy166II \ \\\ \ \ \\\\ GTGGCCTTTGCTGCTAAACACTTGAAAATACCTGCTACTATCGTTATGCCTGTTTGTACA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGGAAACGACGATTTGTGAACTTTTATGGACGATGATAGCAATACGGACAAACATGT / / / /// / / /// | | | ||TseI SetI BspMI ||Bsp1407I | | | |BisI ||TatI | | | BlsI |Hpy166II | | MwoI |Csp6I | HaeIII RsaI | CviJI BbvI V A F A A K H L K I P A T I V M P V C T W P L L L N T * K Y L L L S L C L F V H G L C C * T L E N T C Y Y R Y A C L Y T ----:----|----:----|----:----|----:----|----:----|----:----| T A K A A L C K F I G A V I T I G T Q V H P R Q Q * V S S F V Q * * R * A Q K Y H G K S S F V Q F Y R S S D N H R N T C Bce83I* |AvaI |XhoI |SmlI |Hpy178III* ||TaqI ||BmeT110I SmlI MseI |||Hpy178III* | BsmAI |BccI ||||BsmAI | Eco31I MaeIII \\ \\\\\ \ \ \ CCATCTATTAAGTATCAAAATGTCTCGAGATTAGGGTCTCAAGTCGTCCTATATGGTAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGATAATTCATAGTTTTACAGAGCTCTAATCCCAGAGTTCAGCAGGATATACCATTG / / /// / / / / BccI | ||| BsmAI | Eco31I MaeIII MseI | ||Hpy178III* | BsmAI | ||SmlI SmlI | ||XhoI | ||AvaI | |BmeT110I | |TaqI | Hpy178III* Bce83I* P S I K Y Q N V S R L G S Q V V L Y G N H L L S I K M S R D * G L K S S Y M V T I Y * V S K C L E I R V S S R P I W * R ----:----|----:----|----:----|----:----|----:----|----:----| G D I L Y * F T E L N P D * T T R Y P L V M * * T D F H R S I L T E L R G I H Y W R N L I L I D R S * P R L D D * I T V TspEI | BglI CviJI | MwoI |DdeI | |SapI |Bpu10I | |Ksp632I* CviJI Eco57I MnlI || CviJI MwoI | || CviJI | MboII Eco57MI \ \\ \ \ \ \\ \ \ \ \ GATTTTGACGAGGCTAAGGCTGAATGTGCCAAATTGGCTGAAGAGCGTGGCTTGACGAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAACTGCTCCGATTCCGACTTACACGGTTTAACCGACTTCTCGCACCGAACTGCTTG / / / / / / / // // / MnlI | | | MwoI | | |Ksp632I* |MboII Eco57MI | | CviJI | | |SapI CviJI Eco57I | Bpu10I | | CviJI | DdeI | TspEI CviJI MwoI BglI D F D E A K A E C A K L A E E R G L T N I L T R L R L N V P N W L K S V A * R T F * R G * G * M C Q I G * R A W L D E H ----:----|----:----|----:----|----:----|----:----|----:----| S K S S A L A S H A L N A S S R P K V F R N Q R P * P Q I H W I P Q L A H S S S I K V L S L S F T G F Q S F L T A Q R V Csp6I TaqI |RsaI |MboI |SetI || DpnI || SfeI* || MnlI || |Tsp4CI* || |BseGI BsrDI || || AluI || |BstKTI | Cfr10I || || CviJI FokI || || MslI | |HpaII || || | SetI \ \\ \\ \ \ \\ \\ \\ \ \ ATTCCTCCTTTCGATCATCCTTATGTCATTGCCGGTCAAGGTACTGTAGCTATGGAAATC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGAGGAAAGCTAGTAGGAATACAGTAACGGCCAGTTCCATGACATCGATACCTTTAG / // / / / // / /// /// FokI || | | BsrDI || | ||| ||CviJI || | MslI || | ||| ||AluI || MboI || | ||| |SfeI* |DpnI || | ||| SetI BstKTI || | ||Tsp4CI* BseGI || | |Csp6I MnlI || | RsaI TaqI || SetI |Cfr10I HpaII I P P F D H P Y V I A G Q G T V A M E I F L L S I I L M S L P V K V L * L W K S S S F R S S L C H C R S R Y C S Y G N P ----:----|----:----|----:----|----:----|----:----|----:----| M G G K S * G * T M A P * P V T A I S I C E E K R D D K H * Q R D L Y Q L * P F N R R E I M R I D N G T L T S Y S H F D Csp6I |RsaI ||MaeII |||BsaAI |||SnaBI ||||Csp6I |||||RsaI |||||SetI MboI Hpy99I |||||TaiI | DpnI BsiYI* DdeI |||||| AciI | |BstKTI |AciI \ \\\\\\ \ \ \\ \\ CTAAGACAAGTACGTACCGCTAATAAGATCGGTGCTGTCTTTGTTCCCGTCGGCGGTGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCTGTTCATGCATGGCGATTATTCTAGCCACGACAGAAACAAGGGCAGCCGCCACCA / ////// / // / / / / DdeI |||||| AciI || MboI | | AciI |||||Csp6I |DpnI | BsiYI* ||||RsaI BstKTI Hpy99I |||MaeII ||SnaBI ||BsaAI |Csp6I RsaI TaiI SetI L R Q V R T A N K I G A V F V P V G G G * D K Y V P L I R S V L S L F P S A V V K T S T Y R * * D R C C L C S R R R W W ----:----|----:----|----:----|----:----|----:----|----:----| R L C T R V A L L I P A T K T G T P P P G L V L V Y R * Y S R H Q R Q E R R R H * S L Y T G S I L D T S D K N G D A T T MseI |TspEI BseRI MnlI \\ \ \ GGTTTAATTGCTGGTATTGGTGCTTATTTGAAAAGGGTTGCTCCTCATATCAAAATCATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAATTAACGACCATAACCACGAATAAACTTTTCCCAACGAGGAGTATAGTTTTAGTAA / / / / | TspEI BseRI MnlI MseI G L I A G I G A Y L K R V A P H I K I I V * L L V L V L I * K G L L L I S K S L F N C W Y W C L F E K G C S S Y Q N H W ----:----|----:----|----:----|----:----|----:----|----:----| P K I A P I P A * K F L T A G * I L I M H N L Q Q Y Q H K N S F P Q E E Y * F * T * N S T N T S I Q F P N S R M D F D N AciI |CfrI |BisI ||BlsI |||TauI |||CviJI SfaNI |||HaeIII TspEI CviRI* \ \\\\ \ \ GGTGTTGAAACTTACGATGCGGCCACTTTACATAATTCCTTGCAACGCAACCAGAGAACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAACTTTGAATGCTACGCCGGTGAAATGTATTAAGGAACGTTGCGTTGGTCTCTTGA / //// / / / SfaNI |||| CfrI | CviRI* |||HaeIII TspEI |||CviJI ||BisI ||AciI |BlsI TauI G V E T Y D A A T L H N S L Q R N Q R T V L K L T M R P L Y I I P C N A T R E L C * N L R C G H F T * F L A T Q P E N S ----:----|----:----|----:----|----:----|----:----|----:----| P T S V * S A A V K C L E K C R L W L V Q H Q F K R H P W K V Y N R A V C G S F T N F S V I R G S * M I G Q L A V L S S SetI | BsiYI* | | Csp6I | | |RsaI Csp6I | | ||Hin4I |RsaI | | ||Hin4I ||MaeII Hin4I | | ||| BccI ||| SetI Hin4I | | ||| |BaeI ||| TaiI | BaeI \ \ \\\ \\ \\\ \ \ \ CCTTTACCTGTGGTGGGTACTTTTGCCGATGGTACGTCTGTGCGTATGATTGGTGAAGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAATGGACACCACCCATGAAAACGGCTACCATGCAGACACGCATACTAACCACTTCTT / / / // / // / / / SetI | | || BccI || MaeII | BaeI | | |Csp6I |Csp6I Hin4I | | RsaI RsaI Hin4I | | BaeI TaiI | Hin4I SetI | Hin4I BsiYI* P L P V V G T F A D G T S V R M I G E E L Y L W W V L L P M V R L C V * L V K K F T C G G Y F C R W Y V C A Y D W * R N ----:----|----:----|----:----|----:----|----:----|----:----| G K G T T P V K A S P V D T R I I P S S E K V Q P P Y K Q R H Y T Q A Y S Q H L R * R H H T S K G I T R R H T H N T F F BcgI |MseI |TspDTI ||HpaI PleI ||HindII |MlyI ||Hpy166II || PflMI ||| BbvI HphI || BsiYI* ||| | TspRI | MboII || | FalI ||| | |FalI | |HinfI || | FalI XmnI ||| | |FalI \ \\ \\ \ \ \ \\\ \ \\ ACATTTAGAGTCGCCCAACAAGTGGTTGATGAAGTTGTTCTTGTTAACACTGACGAAATC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAATCTCAGCGGGTTGTTCACCAACTACTTCAACAAGAACAATTGTGACTGCTTTAG / / / // / // // / / | | HinfI |BsiYI* XmnI || || FalI BbvI | MboII |PflMI || || FalI HphI |FalI || |MseI |FalI || Hpy166II PleI || HindII MlyI || TspRI || HpaI |TspDTI BcgI T F R V A Q Q V V D E V V L V N T D E I H L E S P N K W L M K L F L L T L T K S I * S R P T S G * * S C S C * H * R N L ----:----|----:----|----:----|----:----|----:----|----:----| V N L T A W C T T S S T T R T L V S S I F M * L R G V L P Q H L Q E Q * C Q R F C K S D G L L H N I F N N K N V S V F D TseI |BisI HgiCI* |SfeI* | BccI ||BlsI | NlaIV |||CviRI* | | SduI |||| PstI BcgI MaeI MboII | | BseSI \\\\ \ \ \ \ \ \ \ TGTGCTGCAGTAAAGGATATTTTTGAAGATACTAGAAGTATTGTAGAACCATCTGGTGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGACGTCATTTCCTATAAAAACTTCTATGATCTTCATAACATCTTGGTAGACCACGG /// / / / / //// ||| SfeI* BcgI | MboII |||HgiCI* ||CviRI* MaeI ||BccI ||TseI |NlaIV |BisI BseSI BlsI SduI PstI C A A V K D I F E D T R S I V E P S G A V L Q * R I F L K I L E V L * N H L V P C C S K G Y F * R Y * K Y C R T I W C P ----:----|----:----|----:----|----:----|----:----|----:----| Q A A T F S I K S S V L L I T S G D P A R H Q L L P Y K Q L Y * F Y Q L V M Q H T S C Y L I N K F I S S T N Y F W R T G FokI | MboII | |TspDTI | || Tsp4CI* | || |Csp6I | || ||RsaI CviJI | || |||BseGI Cfr10I | || |||| Hpy178III* |HpaII | || |||| | TspEI TstI \\ \ \\ \\\\ \ \ \ CTTTCAGTAGCCGGTATGAAGAAATACATCTCTACCGTACATCCAGAAATTGACCACACT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGTCATCGGCCATACTTCTTTATGTAGAGATGGCATGTAGGTCTTTAACTGGTGTGA / // // / /// / // | |Cfr10I |FokI | ||Csp6I | |TstI | HpaII | | |RsaI | TspEI CviJI | | BseGI Hpy178III* | Tsp4CI* TspDTI MboII L S V A G M K K Y I S T V H P E I D H T F Q * P V * R N T S L P Y I Q K L T T L F S S R Y E E I H L Y R T S R N * P H * ----:----|----:----|----:----|----:----|----:----|----:----| R E T A P I F F Y M E V T C G S I S W V G K L L R Y S S I C R * R V D L F Q G C K * Y G T H L F V D R G Y M W F N V V S FatI BccI |CviAII MseI FokI SetI BseGI | TstI || NlaIII TspDTI \ \ \ \ \ \\ \ \ AAAAACACCTATGTTCCCATCCTTTCTGGTGCTAACATGAACTTTGATAGATTAAGATTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTGGATACAAGGGTAGGAAAGACCACGATTGTACTTGAAACTATCTAATTCTAAA / / / / / / // / / | FokI BseGI | BccI | |FatI | MseI SetI TstI | CviAII TspDTI NlaIII K N T Y V P I L S G A N M N F D R L R F K T P M F P S F L V L T * T L I D * D L K H L C S H P F W C * H E L * * I K I C ----:----|----:----|----:----|----:----|----:----|----:----| L F V * T G M R E P A L M F K S L N L N * F C R H E W G K Q H * C S S Q Y I L I F V G I N G D K R T S V H V K I S * S K FatI |CviAII || NlaIII Hpy188I MboII || | MaeIII | MaeII Hin4II* TspDTI || | |BslFI | | SetI | FalI BbvII* || | || FalI | | TaiI | FalI | HphI || | || FalI \ \ \ \ \ \ \ \\ \ \\ \ GTTTCCGAACGTGCTGTTCTTGGTGAAGGAAAGGAAGTCTTCATGTTAGTTACTTTACCC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGGCTTGCACGACAAGAACCACTTCCTTTCCTTCAGAAGTACAATCAATGAAATGGG / / / // // // / // / / / | | MaeII |Hin4II* || |BbvII* | || | | Hpy99I | TaiI FalI || HphI | || | MaeIII | SetI FalI |MboII | || | BslFI Hpy188I TspDTI | || FalI | || FalI | |FatI | CviAII NlaIII V S E R A V L G E G K E V F M L V T L P F P N V L F L V K E R K S S C * L L Y P F R T C C S W * R K G S L H V S Y F T R ----:----|----:----|----:----|----:----|----:----|----:----| T E S R A T R P S P F S T K M N T V K G Q K R V H Q E Q H L F P L R * T L * K V N G F T S N K T F S L F D E H * N S * G AcyI MboI MaeII BglII |ZraI XhoII ||Hpy99I | DpnI |||SetI | |BstKTI |||TaiI | || MaeIII |||AatII Hpy178III* | || Tsp45I ||||BssKI | CviRI* | || | TaqII ||||SecI* | | MboI | || | | ApoI ||||EcoRII | | | DpnI | || | | TspEI ||||| ScrFI | | | |BseGI | || | | EcoRI ||||| BseBI | FokI | | |BstKTI | || | | | TspRI \\\\\ \ \ \ \ \ \\ \ \\ \ \ \ \ GACGTCCCTGGTGCGTTCAAGAAAATGCAAAAGATCATCCACCCAAGATCTGTCACTGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAGGGACCACGCAAGTTCTTTTACGTTTTCTAGTAGGTGGGTTCTAGACAGTGACTT / // /// / // // / // // / / | || ||EcoRII | || || MboI || || | Tsp45I | || ||BssKI | || |DpnI || || | MaeIII | || |SecI* | || BstKTI || || TaqII | || BseBI | || BseGI || |TspRI | || ScrFI | |CviRI* || XhoII | |MaeII | FokI || BglII | |AcyI Hpy178III* || MboI | ZraI |DpnI AatII BstKTI TaiI SetI D V P G A F K K M Q K I I H P R S V T E T S L V R S R K C K R S S T Q D L S L N R P W C V Q E N A K D H P P K I C H * I ----:----|----:----|----:----|----:----|----:----|----:----| S T G P A N L F I C F I M W G L D T V S R R G Q H T * S F A F S * G G L I Q * Q V D R T R E L F H L L D D V W S R D S F MslI |FatI |BspHI ||CviAII ||Hpy178III* ||| HinfI ||| NlaIII ||| |TspDTI ||| || MaeI ||| || |PleI StyI BdaI ||| || ||MlyI SduI BdaI ||| || |||BdaI SecI* | MaeIII ||| || |||BdaI BseSI | Tsp4CI* ||| || |||| MnlI | CviJI \ \ \\\ \\ \\\\ \ \ \ TTCTCTTACCGTTACAATGAACATCGTCATGAGTCCTCTAGTGAAGTGCCCAAGGCTTAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAGAATGGCAATGTTACTTGTAGCAGTACTCAGGAGATCACTTCACGGGTTCCGAATG / / / / // // / // / / // | | | MaeIII || || | || | BseSI |CviJI | | Tsp4CI* || || | || | SduI SecI* | BdaI || || | || MnlI StyI | BdaI || || | |PleI EcoRI || || | |MlyI TspEI || || | |MaeI ApoI || || | BdaI || || | BdaI || || HinfI || |BspHI || |FatI || Hpy178III* || TspDTI || CviAII |NlaIII MslI F S Y R Y N E H R H E S S S E V P K A Y S L T V T M N I V M S P L V K C P R L T L L P L Q * T S S * V L * * S A Q G L H ----:----|----:----|----:----|----:----|----:----|----:----| N E * R * L S C R * S D E L S T G L A * I R K G N C H V D D H T R * H L A W P K E R V T V I F M T M L G R T F H G L S V MwoI Hpy99I BstAPI | HindII | CviRI* HgaI | Hpy166II | | Tsp4CI* \ \ \ \ \ \ ATTTACACTTCTTTCAGCGTCGTTGACAGAGAAAAGGAAATCAAGCAAGTTATGCAACAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGTGAAGAAAGTCGCAGCAACTGTCTCTTTTCCTTTAGTTCGTTCAATACGTTGTC / / / / / / HgaI Hpy99I Hpy166II | | Tsp4CI* HindII | CviRI* BstAPI MwoI I Y T S F S V V D R E K E I K Q V M Q Q F T L L S A S L T E K R K S S K L C N S L H F F Q R R * Q R K G N Q A S Y A T V ----:----|----:----|----:----|----:----|----:----|----:----| M * V E K L T T S L S F S I L C T I C C C K C K K * R R Q C L F P F * A L * A V N V S R E A D N V S F L F D L L N H L L AluI CviJI Hpy188I FatI BsmI SetI | SetI EcoRV |TsoI TspEI CviJI |CviAII \ \ \ \ \ \\ \ \ \\ TTGAATGCTTTAGGTTTTGAAGCTGTGGATATCTCCGATAACGAATTGGCTAAATCTCAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACGAAATCCAAAACTTCGACACCTATAGAGGCTATTGCTTAACCGATTTAGAGTA / / / / / / / / / / | SetI | CviJI | Hpy188I | CviJI | CviAII BsmI | AluI | TsoI TspEI NlaIII SetI EcoRV L N A L G F E A V D I S D N E L A K S H * M L * V L K L W I S P I T N W L N L M E C F R F * S C G Y L R * R I G * I S W ----:----|----:----|----:----|----:----|----:----|----:----| N F A K P K S A T S I E S L S N A L D * T S H K L N Q L Q P Y R R Y R I P * I E Q I S * T K F S H I D G I V F Q S F R M TspDTI TspDTI | ApoI SetI | TspEI | TspEI NlaIII DdeI NlaIV | | XmnI | EcoRI \ \ \ \ \ \ \ \ GGTAGATACTTGGTTGGTGGTGCTTCTAAGGTTCCTAATGAAAGAATTATTTCATTTGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCTATGAACCAACCACCACGAAGATTCCAAGGATTACTTTCTTAATAAAGTAAACTT / // / / / / FatI || NlaIV TspDTI | TspDTI |DdeI TspEI SetI XmnI G R Y L V G G A S K V P N E R I I S F E V D T W L V V L L R F L M K E L F H L N * I L G W W C F * G S * * K N Y F I * I ----:----|----:----|----:----|----:----|----:----|----:----| P L Y K T P P A E L T G L S L I I E N S H Y I S P Q H H K * P E * H F F * K M Q T S V Q N T T S R L N R I F S N N * K F EcoNI | MaeI BssKI | BsiYI* SexAI | | MnlI StuI EcoRII | | SetI CviJI | ScrFI | | NlaIV HaeIII | BseBI | | | StyI | DdeI | | HgiCI* | | | SecI* | Bpu10I | | | SetI | | | | FalI | | TfiI TfiI | | | NlaIV | | | | FalI | | HinfI HinfI \ \ \ \ \ \ \ \ \ \ \ \ \ TTCCCTGAAAGACCAGGTGCCTTGACTAGGTTCCTTGGAGGCCTAAGCGATTCTTGGAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGACTTTCTGGTCCACGGAACTGATCCAAGGAACCTCCGGATTCGCTAAGAACCTTA / // // / / / // // / / / / / EcoRI || || | | | || |NlaIV | | | HinfI HinfI TspEI || || | | | || |FalI | | | TfiI TfiI ApoI || || | | | || |FalI | | Bpu10I || || | | | || MnlI | | DdeI || || | | | |MaeI | HaeIII || || | | | SetI | CviJI || || | | EcoNI | StuI || || | BsiYI* SecI* || || HgiCI* StyI || |NlaIV || EcoRII || SexAI || BssKI |BseBI |ScrFI SetI F P E R P G A L T R F L G G L S D S W N S L K D Q V P * L G S L E A * A I L G I P * K T R C L D * V P W R P K R F L E S ----:----|----:----|----:----|----:----|----:----|----:----| N G S L G P A K V L N R P P R L S E Q F I G Q F V L H R S * T G Q L G L R N K S E R F S W T G Q S P E K S A * A I R P I FatI NcoI StyI SecI* DsaI* SetI |CviAII | TspGWI || HgiCI* | |AluI FalI || NlaIII | |CviJI FalI || | NlaIV EcoRV | || SetI \ \\ \ \ \ \ \\ \ CTTACTTTATTCCATTATAGAAACCATGGTGCCGATATCGGTAAGGTTTTAGCTGGTATT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GAATGAAATAAGGTAATATCTTTGGTACCACGGCTATAGCCATTCCAAAATCGACCATAA / / // / / / / // / FalI | || | | EcoRV SetI || CviJI FalI | || | HgiCI* || AluI | || NlaIV |SetI | |DsaI* TspGWI | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII L T L F H Y R N H G A D I G K V L A G I L L Y S I I E T M V P I S V R F * L V F Y F I P L * K P W C R Y R * G F S W Y F ----:----|----:----|----:----|----:----|----:----|----:----| R V K N W * L F W P A S I P L T K A P I D * K I G N Y F G H H R Y R Y P K L Q Y K S * E M I S V M T G I D T L N * S T N ApoI StyI TspEI CviJI SecI* MnlI MseI SetI | Hin4II* | MboII \ \ \ \ \ \ \ \ TCCGTTCCTCCAAGGGAAAACTTAACCTTCCAAAAATTCTTGGAAGATTTAGGCTACACT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAAGGAGGTTCCCTTTTGAATTGGAAGGTTTTTAAGAACCTTCTAAATCCGATGTGA / / / / / // | MnlI MseI | TspEI |MboII SecI* SetI | ApoI CviJI StyI Hin4II* S V P P R E N L T F Q K F L E D L G Y T P F L Q G K T * P S K N S W K I * A T L R S S K G K L N L P K I L G R F R L H L ----:----|----:----|----:----|----:----|----:----|----:----| E T G G L S F K V K W F N K S S K P * V K R E E L P F S L R G F I R P L N L S C G N R W P F V * G E L F E Q F I * A V S FatI ApoI BspHI TspEI |CviAII TspDTI | Hpy178III* |Hpy178III* |Tsp4CI* | | SspI || NlaIII || TspRI | | | MseI \\ \ \\ \ \ \ \ \ TATCATGATGAAACTGATAACACTGTTTATCAAAAATTCTTGAAATATTAA 1690 1700 1710 1720 1730 ----:----|----:----|----:----|----:----|----:----|- ATAGTACTACTTTGACTATTGTGACAAATAGTTTTTAAGAACTTTATAATT / // / / / / / / / | |BspHI | | Tsp4CI* | | | MseI | |FatI | TspDTI | | SspI | Hpy178III* TspRI | Hpy178III* | CviAII TspEI NlaIII ApoI Y H D E T D N T V Y Q K F L K Y * I M M K L I T L F I K N S * N I X S * * N * * H C L S K I L E I L X ----:----|----:----|----:----|----:----|----:----|- * * S S V S L V T * * F N K F Y * K D H H F Q Y C Q K D F I R S I N I M I F S I V S N I L F E Q F I L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 7 AluBI ApoI 4 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 2 BpuEI BcgI 1 BdaI 2 BglI 1 BglII 2 BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 1 Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseRI 1 BseSI 2 BaeGI,BstSLI BseYI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 5 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 8 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 19 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoNI 1 BstENI,XagI EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FalI 6 FatI 8 FokI 5 GsaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 4 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 3 HpyAV HindII 2 HincII HindIII 1 HinfI 7 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 3 Hpy99I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 5 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MlyI 2 SchI MmeI 1 MnlI 7 MseI 8 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 2 BasI,AccB7I,Van91I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PstI 1 PvuII 1 RsaI 8 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 7 BseDI,BssECI,BsaJI SetI 30 SexAI 1 MabI SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SnaBI 1 Eco105I,BstSNI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 2 TaqII 1 TatI 1 TauI 1 TfiI 5 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI TstI 1 VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BalI BamHI BarI BbvCI BceAI BciVI BclI BetI* BfiI BinI* BmtI BplI BsaBI BsaXI BseMII BsePI BsgI BsiI* Bsp120I BspCNI BspLU11I* BspMII* BspOI BsrBI BsrI BstEII BstXI BtgZI BtrI BtsI Cac8I CauII* Cfr9I ClaI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GlaI GsuI HaeII HgiAI* HgiJII* HhaI Hin6I HinP1I HspAI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769