Restriction Map of RPS24A/YER074W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPS24A/YER074W on chromosome V from coordinates 306323 to 307196.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4011

BspCNI |BseMII ||AcyI ||MaeII DdeI |||ZraI |SduI |||| SetI FatI |HgiAI* |||| TaiI |CviAII ||BslFI |||| AatII || NlaIII MseI |||Hpy188I |||| | TspDTI || |MseI FatI \ \\\\ \\\\ \ \ \\ \\ \ ATGGTATGTTAAAAAGTGCTCAGATGAAAGATGACGTCCCATATTCCATGTTAAAGTTGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATACAATTTTTCACGAGTCTACTTTCTACTGCAGGGTATAAGGTACAATTTCAACG / / // / // / /// / // / / MseI | || | || | ||TspDTI | || MseI NlaIII | || | || | |MaeII | |FatI | || | || | |AcyI | CviAII | || | || | ZraI NlaIII | || | || AatII | || | || TaiI | || | || SetI | || | |BseMII | || | BspCNI | || BslFI | |DdeI | Hpy188I HgiAI* SduI M V C * K V L R * K M T S H I P C * S C W Y V K K C S D E R * R P I F H V K V A G M L K S A Q M K D D V P Y S M L K L P ----:----|----:----|----:----|----:----|----:----|----:----| X T H * F T S L H F I V D W I G H * L Q X P I N F L A * I F S S T G Y E M N F N H Y T L F H E S S L H R G M N W T L T A Acc65I HgiCI* |Csp6I ||RsaI ||SetI CviAII ||NlaIV | NlaIII ||| KpnI \ \ \\\ \ CATGAGTTAGTATAAAAGGCAATAAAGGTACCATAACGAGAAAAGAAAGTAAAAGAAGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTCAATCATATTTTCCGTTATTTCCATGGTATTGCTCTTTTCTTTCATTTTCTTCTT // / / /// |FatI | | ||HgiCI* CviAII | | ||Acc65I | | |Csp6I | | NlaIV | | RsaI | KpnI SetI H E L V * K A I K V P * R E K K V K E E M S * Y K R Q * R Y H N E K R K * K K K * V S I K G N K G T I T R K E S K R R N ----:----|----:----|----:----|----:----|----:----|----:----| W S N T Y F A I F T G Y R S F F T F S S G H T L I F P L L P V M V L F S L L L L M L * Y L L C Y L Y W L S F L F Y F F F MboII |CviRI* || ApoI SetI || TspEI | MaeIII MseI || | MseI | | TsoI CviJI VspI \\ \ \ \ \ \ \ \ ATGTTTTGCAAATTTAAGGTGGCGTAACAGCAACTATTGGCTAATATATTAATGGCAATC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAACGTTTAAATTCCACCGCATTGTCGTTGATAACCGATTATATAATTACCGTTAG / / / / / / / / | | | MseI | MaeIII CviJI VspI | | | SetI TsoI MseI | | TspEI | | ApoI | CviRI* MboII M F C K F K V A * Q Q L L A N I L M A I C F A N L R W R N S N Y W L I Y * W Q S V L Q I * G G V T A T I G * Y I N G N H ----:----|----:----|----:----|----:----|----:----|----:----| I N Q L N L T A Y C C S N A L I N I A I F T K C I * P P T V A V I P * Y I L P L H K A F K L H R L L L * Q S I Y * H C D ApoI MseI TspEI | ApoI | MseI TspGWI TsoI TspEI | TspEI PsiI | |AhaIII* \ \ \ \ \ \ \ \\ ATTGTGAAAAGAAATGTGAAATCCGTATCGTAATTGGTTAAATTTATAACTCAAATTTAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACTTTTCTTTACACTTTAGGCATAGCATTAACCAATTTAAATATTGAGTTTAAATT / / / / / / /// TspGWI TsoI | | | PsiI ||MseI | | TspEI |AhaIII* | | ApoI TspEI | MseI ApoI TspEI I V K R N V K S V S * L V K F I T Q I * L * K E M * N P Y R N W L N L * L K F K C E K K C E I R I V I G * I Y N S N L N ----:----|----:----|----:----|----:----|----:----|----:----| M T F L F T F D T D Y N T L N I V * I * * Q S F F H S I R I T I P * I * L E F K N H F S I H F G Y R L Q N F K Y S L N L AluI CviJI MseI TaqI | SetI SspI AciI | FauI \ \ \ \ \ \ \ ACACTCGAATAGCTGACCCGTAATATTTTATCCCGCTTTAAGAGTTCAACGCTAAAAAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGAGCTTATCGACTGGGCATTATAAAATAGGGCGAAATTCTCAAGTTGCGATTTTTTA / / / / / / / | | CviJI SspI AciI | FauI | | AluI MseI | SetI TaqI T L E * L T R N I L S R F K S S T L K N H S N S * P V I F Y P A L R V Q R * K M T R I A D P * Y F I P L * E F N A K K * ----:----|----:----|----:----|----:----|----:----|----:----| V S S Y S V R L I K D R K L L E V S F F F V R I A S G Y Y K I G S * S N L A L F C E F L Q G T I N * G A K L T * R * F I FatI EcoRV BspHI | MaeI SfeI* |CviAII | | AluI | TsoI |Hpy178III* | | CviJI | | NlaIV || NlaIII | | | SetI | | | SetI || | Hin4II* \ \ \ \ \ \ \ \ \\ \ \ GATATCTAGCTAACCATTATGCTACAGGAACCTTTTTTGGACTATTATCCCTATCATGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGATCGATTGGTAATACGATGTCCTTGGAAAAAACCTGATAATAGGGATAGTACTT / /// // / / /// | ||CviJI || NlaIV | ||Hin4II* | ||AluI || SetI | |BspHI | |MaeI |SfeI* | |FatI | SetI TsoI | Hpy178III* EcoRV | CviAII NlaIII D I * L T I M L Q E P F L D Y Y P Y H E I S S * P L C Y R N L F W T I I P I M K Y L A N H Y A T G T F F G L L S L S * K ----:----|----:----|----:----|----:----|----:----|----:----| S I * S V M I S C S G K K S * * G * * S H Y R A L W * A V P V K K P S N D R D H I D L * G N H * L F R K Q V I I G I M F BsrI | MboI | XhoII PsrI | | DpnI | BsiYI* | | TspDTI | | BsrI | | |BstKTI | | NlaIV | | || BinI* | | TspRI | | || | AcyI HgaI | | | SetI \ \ \\ \ \ \ \ \ \ \ AACTGGAAGGATCTTTCAAGGACGCCATTTCCAAAGATTTCCCCCACACTGGAACCTATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACCTTCCTAGAAAGTTCCTGCGGTAAAGGTTTCTAAAGGGGGTGTGACCTTGGATAA / /// / / / / / // / / | ||| | BinI* AcyI | PsrI || | NlaIV | ||| XhoII HgaI || | SetI | ||| MboI || BsrI | ||DpnI |BsiYI* | |BstKTI TspRI | TspDTI BsrI N W K D L S R T P F P K I S P T L E P I T G R I F Q G R H F Q R F P P H W N L F L E G S F K D A I S K D F P H T G T Y F ----:----|----:----|----:----|----:----|----:----|----:----| F Q F S R E L V G N G F I E G V S S G I F S S P D K L S A M E L S K G W V P V * V P L I K * P R W K W L N G G C Q F R N Hpy188I | TspGWI MseI | | MaeIII |AhaIII* SetI | | BspCNI TspEI ||PsrI |TspEI DdeI | | |BseMII \ \\\ \\ \ \ \ \\ TTACTAACAATTTTTAAAATGGTTTTTTACCTAAATTGTTTTTTCTCAGTCTGACGCTGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATGATTGTTAAAAATTTTACCAAAAAATGGATTTAACAAAAAAGAGTCAGACTGCGACA // // / / / / / // || |MseI SetI TspEI | | | |BseMII || AhaIII* | | | BspCNI |TspEI | | TspGWI PsrI | Hpy188I DdeI L L T I F K M V F Y L N C F F S V * R C Y * Q F L K W F F T * I V F S Q S D A V T N N F * N G F L P K L F F L S L T L L ----:----|----:----|----:----|----:----|----:----|----:----| K S V I K L I T K * R F Q K K E T Q R Q K V L L K * F P K K G L N N K R L R V S * * C N K F H N K V * I T K E * D S A T XcmI | BsiYI* SalI | | CfrI SgrDI Csp6I | | | BalI Hpy99I |RsaI | | | CviJI TspEI |TaqI HgaI || MaeI SetI | | | HaeIII |MmeI |AccI \ \\ \ \ \ \ \ \ \\ \\ TACTATCCGTACTAGAAAGGTTATCTCCAACCCATTGTTGGCCAGAAAGCAATTCGTCGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATAGGCATGATCTTTCCAATAGAGGTTGGGTAACAACCGGTCTTTCGTTAAGCAGCA / / // / / // / / / / / / | | || | SetI |BsiYI* | CfrI MmeI | | Hpy99I | | || MaeI XcmI HaeIII | Hpy99I | | |Csp6I CviJI Hpy99I | | RsaI BalI TspEI | HgaI MaeIII Y Y P Y * K G Y L Q P I V G Q K A I R R T I R T R K V I S N P L L A R K Q F V V L S V L E R L S P T H C W P E S N S S S ----:----|----:----|----:----|----:----|----:----|----:----| * * G Y * F P * R W G M T P W F A I R R N S D T S S L N D G V W Q Q G S L L E D V I R V L F T I E L G N N A L F C N T T HindII Hpy166II |Hpy99I ||AcyI ||MaeII |||ZraI ||||Hpy99I |||||SetI FokI |||||TaiI AluI | TspEI |||||AatII CviJI StyI TspEI | |TspDTI |||||| CviRI* | SetI SecI* | BseGI | || AluI |||||| | Hin4I | | TaqII |BsmAI | |Hin4I | || CviJI \\\\\\ \ \ \ \ \ \\ \ \\ \ \\ \ CGACGTCTTGCACCCAAACAGAGCTAATGTCTCCAAGGATGAATTGCGTGAAAAATTAGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GCTGCAGAACGTGGGTTTGTCTCGATTACAGAGGTTCCTACTTAACGCACTTTTTAATCG ///// / / / / / /// / / / / / / ||||| | CviRI* | | TaqII ||| | TspEI | | | CviJI ||||| Hin4I | CviJI ||| BseGI | | | AluI ||||MaeII | AluI ||Hin4I | | TspEI ||||AcyI SetI |BsmAI | | SetI |||ZraI SecI* | FokI ||SgrDI StyI TspDTI ||SalI |AatII |AccI |TaqI |TaiI |SetI Hpy166II HindII R R L A P K Q S * C L Q G * I A * K I S D V L H P N R A N V S K D E L R E K L A T S C T Q T E L M S P R M N C V K N * L ----:----|----:----|----:----|----:----|----:----|----:----| R R R A G L C L * H R W P H I A H F I L D V D Q V W V S S I D G L I F Q T F F * S T K C G F L A L T E L S S N R S F N A Eco57I AccI Eco57MI |Hpy166II |TspGWI BsaXI || BsaXI || Tth111I | Hin4I || Hin4I || | HgaI | |Hpy188I XcmI SetI || CviJI || | | BsmAI | || TspEI BstXI \ \\ \ \\ \ \ \ \ \\ \ \ TGAAGTCTACAAGGCTGAAAAGGACGCTGTCTCCGTTTTCGGTTTCAGAACCCAATTTGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTCAGATGTTCCGACTTTTCCTGCGACAGAGGCAAAAGCCAAAGTCTTGGGTTAAACC /// / / // / // / / / // ||| | | |TspGWI Tth111I || | Hpy188I | |XcmI ||| | | Eco57MI || Hin4I | TspEI ||| | | Eco57I || BsaXI BstXI ||| | CviJI |BsmAI ||| BsaXI HgaI ||Hin4I |AccI Hpy166II * S L Q G * K G R C L R F R F Q N P I W E V Y K A E K D A V S V F G F R T Q F G K S T R L K R T L S P F S V S E P N L V ----:----|----:----|----:----|----:----|----:----|----:----| Q L R C P Q F P R Q R R K R N * F G I Q S F D V L S F L V S D G N E T E S G L K S T * L A S F S A T E T K P K L V W N P AluI CviJI AccI |DdeI TaqI |Hpy166II ||SetI AsuII \\ \\\ \ TGGTGGTAAGTCTGTTGGTTTCGGTTTGGTCTACAACTCTGTTGCCGAAGCTAAGAAGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ACCACCATTCAGACAACCAAAGCCAAACCAGATGTTGAGACAACGGCTTCGATTCTTCAA // / / / |AccI | | DdeI Hpy166II | CviJI | AluI SetI W W * V C W F R F G L Q L C C R S * E V G G K S V G F G L V Y N S V A E A K K F V V S L L V S V W S T T L L P K L R S S ----:----|----:----|----:----|----:----|----:----|----:----| H H Y T Q Q N R N P R C S Q Q R L * S T T T T L R N T E T Q D V V R N G F S L L P P L D T P K P K T * L E T A S A L F N Hpy188I | Tsp4CI* CviJI | | CviJI SetI | Hpy178III* \ \ \ \ \ \ CGAACCAACTTACAGATTAGTCAGATACGGTTTGGCTGAAAAGGTTGAAAAGGCTTCCAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTGGTTGAATGTCTAATCAGTCTATGCCAAACCGACTTTTCCAACTTTTCCGAAGGTC / / / / / / / AsuII | | CviJI SetI CviJI Hpy178III* TaqI | Tsp4CI* Hpy188I R T N L Q I S Q I R F G * K G * K G F Q E P T Y R L V R Y G L A E K V E K A S R N Q L T D * S D T V W L K R L K R L P D ----:----|----:----|----:----|----:----|----:----|----:----| R V L K C I L * I R N P Q F P Q F P K W E F W S V S * D S V T Q S F L N F L S G S G V * L N T L Y P K A S F T S F A E L MboII | MboI | BglII | XhoII | | DpnI | | XmnI | | |BstKTI | | || Csp6I | | || |RsaI | | || |MboII | | || || TsoI BsmAI | | || || | BsrI | FalI | | || || | | FalI | FalI | | || || | | FalI \ \ \ \ \\ \\ \ \ \ ACAACAAAGAAAGCAAAAGAAGAACAGAGACAAGAAGATCTTCGGTACTGGTAAGAGATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTTTCTTTCGTTTTCTTCTTGTCTCTGTTCTTCTAGAAGCCATGACCATTCTCTAA / / / // / //// / / FalI | MboII || | |||| FalI Hin4II* FalI BsmAI || | |||| FalI || | |||| BsrI || | |||TsoI || | ||Csp6I || | |RsaI || | MboII || XhoII || BglII || MboI |XmnI |DpnI BstKTI T T K K A K E E Q R Q E D L R Y W * E I Q Q R K Q K K N R D K K I F G T G K R L N K E S K R R T E T R R S S V L V R D W ----:----|----:----|----:----|----:----|----:----|----:----| V V F F A F S S C L C S S R R Y Q Y S I S L L S L L L L V S V L L D E T S T L S C C L F C F F F L S L F I K P V P L L N Hin4II* |CviJI MaeIII ||DdeI SetI |Hpy99I MseI \\\ \ \\ \ GGCTAAGAAGGTTGCTCGTCGTAACGCCGATTAA 850 860 870 ----:----|----:----|----:----|---- CCGATTCTTCCAACGAGCAGCATTGCGGCTAATT / / / / / / | | SetI Hpy99I MaeIII MseI | DdeI CviJI G * E G C S S * R R L X A K K V A R R N A D * L R R L L V V T P I X ----:----|----:----|----:----|---- P * S P Q E D Y R R N Q S L L N S T T V G I L A L F T A R R L A S * # Enzymes that cut Frequency Isoschizomers AatII 2 Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 1 BspACI,SsiI AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AluI 5 AluBI ApoI 3 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BglII 1 BinI* 1 AlwI,BspPI,AclWI BsaXI 1 BseGI 1 BstF5I,BtsCI BseMII 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrI 3 BseNI,Bse1I,BsrSI BstKTI 2 BstXI 1 CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 11 CviKI-1 CviRI* 2 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 2 MalI Eco57I 1 AcuI Eco57MI 1 EcoRV 1 Eco32I FalI 2 FatI 3 FauI 1 SmuI FokI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 2 HpyAV HindII 1 HincII Hpy166II 3 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 4 Hpy99I 4 KpnI 1 MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MmeI 1 MseI 9 Tru1I,Tru9I NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PsiI 1 AanI PsrI 1 RsaI 3 AfaI SalI 1 SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 15 SfeI* 1 BstSFI,SfcI,BfmI SgrDI 1 SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 3 TaqII 1 TsoI 4 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuI* AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BseBI BsePI BseRI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoT22I EgeI EheI Esp3I EspI* Fnu4HI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiJII* HhaI Hin6I HindIII HinfI HinP1I HpaI HpaII HphI HspAI KasI Ksp632I* MauBI McrI* MfeI MluI MlyI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SchI ScrFI SexAI SfaNI SfiI SfoI SgfI SgrAI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TatI TauI TfiI TseI Tsp45I TspMI TstI XbaI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769