Restriction Map of ALD5/YER073W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ALD5/YER073W on chromosome V from coordinates 304030 to 305592.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21921

TseI AluI CviJI |BisI |SfeI* ||BlsI ||SetI |||TseI |||CviRI* ||||BisI |||||BlsI |||||PstI ||||||AluI ||||||CviJI ||||||| SetI MaeI ||||||| | Hpy188I | HindIII ||||||| | |ApoI | | AluI ||||||| | |TspEI | | CviJI ||||||| | |EcoRI | | | SetI ||||||| | || BbvI | | | |MaeIII ||||||| | || |Hpy178III* | | | |Bce83I* BbvI ||||||| | || || SspI | | | || MaeII \ \\\\\\\ \ \\ \\ \ \ \ \ \\ \ ATGCTTTCTCGCACAAGAGCTGCAGCTCCGAATTCCAGAATATTCACTAGAAGCTTGTTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAAGAGCGTGTTCTCGACGTCGAGGCTTAAGGTCTTATAAGTGATCTTCGAACAAT / / /////// / / // / / / /// / BbvI | ||||||| | | || SspI | | ||| TaiI | ||||||| | | |BbvI | | ||| SetI | ||||||| | | Hpy178III* | | ||HindIII | ||||||| | EcoRI | | |Bce83I* | ||||||| | TspEI | | CviJI | ||||||| | ApoI | | AluI | ||||||| Hpy188I | SetI | ||||||CviJI MaeI | ||||||TseI | ||||||AluI | |||||SfeI* | |||||BisI | ||||BlsI | ||||SetI | |||CviRI* | |||TseI | ||BisI | |BlsI | |PstI | CviJI | AluI SetI M L S R T R A A A P N S R I F T R S L L C F L A Q E L Q L R I P E Y S L E A C Y A F S H K S C S S E F Q N I H * K L V T ----:----|----:----|----:----|----:----|----:----|----:----| X S E R V L A A A G F E L I N V L L K N X A K E C L L Q L E S N W F I * * F S T H K R A C S S C S R I G S Y E S S A Q * MluI AflIII | FnuDII* SetI | | MboII Ksp632I* TaiI SmlI | | |TspEI |HphI SetI \ \ \ \ \\ \\ \ CGTCTTTATTCTCAAGCACCATTACGCGTTCCAATTACTCTTCCAAATGGTTTCACCTAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGAAATAAGAGTTCGTGGTAATGCGCAAGGTTAATGAGAAGGTTTACCAAAGTGGATG // / / / / / / / / |MaeII SmlI | | MboII TspEI | | SetI MaeIII | AflIII | Ksp632I* | MluI HphI FnuDII* R L Y S Q A P L R V P I T L P N G F T Y V F I L K H H Y A F Q L L F Q M V S P T S L F S S T I T R S N Y S S K W F H L R ----:----|----:----|----:----|----:----|----:----|----:----| R R * E * A G N R T G I V R G F P K V * V D K N E L V M V R E L * E E L H N * R T K I R L C W * A N W N S K W I T E G V CviJI ApoI HphI AclI | TspDTI TspEI | TaqI MnlI MaeII \ \ \ \ \ \ \ GAACAGCCAACAGGGTTATTCATCAATGGTGAATTTGTTGCCTCGAAGCAAAAGAAAACG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCGGTTGTCCCAATAAGTAGTTACCACTTAAACAACGGAGCTTCGTTTTCTTTTGC // / / / / / / |TspDTI | HphI TaqI MnlI | MaeII CviJI TspEI | AclI ApoI TaiI SetI E Q P T G L F I N G E F V A S K Q K K T N S Q Q G Y S S M V N L L P R S K R K R T A N R V I H Q W * I C C L E A K E N V ----:----|----:----|----:----|----:----|----:----|----:----| S C G V P N N M L P S N T A E F C F F V R V A L L T I * * H H I Q Q R S A F S F F L W C P * E D I T F K N G R L L L F R SetI TaiI | MaeII | |BtrI | || MboI MboII | || BclI | Tsp4CI* | || SetI | | AccI | || TaiI | | |BssNAI | || | DpnI | | |Hpy166II | || | |BstKTI BccI | | || CviJI \ \\ \ \\ \ \ \ \\ \ TTTGACGTGATCAATCCATCTAACGAAGAAAAGATAACAACTGTATACAAGGCTATGGAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTGCACTAGTTAGGTAGATTGCTTCTTTTCTATTGTTGACATATGTTCCGATACCTT / // // / / / / // / | || || BclI BccI | | |AccI CviJI | || || MboI | | Hpy166II | || |DpnI | | BssNAI | || BstKTI | Tsp4CI* | |MaeII MboII | BtrI TaiI SetI F D V I N P S N E E K I T T V Y K A M E L T * S I H L T K K R * Q L Y T R L W K * R D Q S I * R R K D N N C I Q G Y G R ----:----|----:----|----:----|----:----|----:----|----:----| N S T I L G D L S S F I V V T Y L A I S T Q R S * D M * R L F S L L Q I C P * P K V H D I W R V F F L Y C S Y V L S H F TseI MwoI CviRI* |BisI ||BlsI |||AciI |||NspBII* MwoI ||||BisI BbvI ||||TspDTI |HindIII |||||BlsI || AluI ||||||TauI || CviJI BceAI MboII CviJI ||||||CviJI || | SetI \ \ \ \\\\\\\ \\ \ \ GATGATGTTGATGAAGCCGTTGCAGCGGCTAAAAAAGCTTTTGAAACGAAGTGGTCTATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACAACTACTTCGGCAACGTCGCCGATTTTTTCGAAAACTTTGCTTCACCAGATAA / / / / /////// / / /// BceAI MboII | | ||||||| | | ||HindIII | | ||||||| | | |BbvI | | ||||||| | | CviJI | | ||||||| | | AluI | | ||||||| | SetI | | ||||||| MwoI | | ||||||CviJI | | |||||BisI | | |||||AciI | | ||||BlsI | | |||NspBII* | | |||TseI | | |||TauI | | ||TspDTI | | ||BisI | | |BlsI | | CviRI* | MwoI CviJI D D V D E A V A A A K K A F E T K W S I M M L M K P L Q R L K K L L K R S G L L * C * * S R C S G * K S F * N E V V Y C ----:----|----:----|----:----|----:----|----:----|----:----| S S T S S A T A A A L F A K S V F H D I L H H Q H L R Q L P * F L K Q F S T T * I I N I F G N C R S F F S K F R L P R N SetI | Hin6I | FnuDII* | |GlaI | ||HhaI | ||| HindIII MnlI | ||| | AluI | CviJI | ||| | CviJI | |HpaII | ||| | | SetI BbvI \ \\ \ \\\ \ \ \ \ GTAGAGCCGGAGGTTCGCGCTAAAGCTTTATTCAATCTCGCTGACTTGGTTGAGAAACAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTCGGCCTCCAAGCGCGATTTCGAAATAAGTTAGAGCGACTGAACCAACTCTTTGTG / / // /// / / / | | |SetI ||| | | HindIII | | HpaII ||| | CviJI | CviJI ||| | AluI MnlI ||| SetI ||Hin6I |GlaI FnuDII* HhaI V E P E V R A K A L F N L A D L V E K H * S R R F A L K L Y S I S L T W L R N T R A G G S R * S F I Q S R * L G * E T P ----:----|----:----|----:----|----:----|----:----|----:----| T S G S T R A L A K N L R A S K T S F C Q L A P P E R * L K I * D R Q S P Q S V Y L R L N A S F S * E I E S V Q N L F V BsePI Hin6I |GlaI ||HhaI ||Hin6I TseI ||Cac8I CviJI ||FnuDII* |BisI |||GlaI |BsrI ||||AciI |TspRI HinfI PleI ||||HhaI ||BlsI | XcmI |MlyI ||||FnuDII* \\\ \ \ \\ \\\\\ CAAGAAACACTGGCTGCCATTGAGTCAATGGATAATGGTAAGTCATTGTTTTGTGCGCGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTGTGACCGACGGTAACTCAGTTACCTATTACCATTCAGTAACAAAACACGCGCG // ///// / / / ///// |TspRI ||||TseI | HinfI PleI ||||FnuDII* BbvI |||BisI XcmI MlyI ||||BsePI ||BlsI ||||Hin6I |CviJI |||GlaI BsrI ||FnuDII* ||Hin6I ||Cac8I ||HhaI |GlaI HhaI Q E T L A A I E S M D N G K S L F C A R K K H W L P L S Q W I M V S H C F V R A R N T G C H * V N G * W * V I V L C A R ----:----|----:----|----:----|----:----|----:----|----:----| W S V S A A M S D I S L P L D N N Q A R G L F V P Q W Q T L P Y H Y T M T K H A L F C Q S G N L * H I I T L * Q K T R A MaeIII Tsp45I | AcyI | MaeII | |ZraI | || SetI | || TaiI | || AatII | || | Hpy99I | || | | HphI AciI \ \\ \ \ \ \ GGTGACGTCGCTTTAGTATCTAAATACTTGCGTTCTTGCGGTGGTTGGGCAGATAAAATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGCAGCGAAATCATAGATTTATGAACGCAAGAACGCCACCAACCCGTCTATTTTAG / //// / / | |||| HphI AciI | |||MaeII | |||AcyI | ||Tsp45I | ||MaeIII | ||ZraI | |Hpy99I | AatII | TaiI | SetI AciI G D V A L V S K Y L R S C G G W A D K I V T S L * Y L N T C V L A V V G Q I K S * R R F S I * I L A F L R W L G R * N L ----:----|----:----|----:----|----:----|----:----|----:----| P S T A K T D L Y K R E Q P P Q A S L I R H R R K L I * I S A N K R H N P L Y F T V D S * Y R F V Q T R A T T P C I F D MaeIII Tsp4CI* | AclI | MaeII SetI | | SetI | TspEI | | TaiI SetI | | MseI NlaIV \ \ \ \ \ \ \ \ TACGGTAACGTTATTGACACAGGTAAAAACCATTTTACCTACTCAATTAAGGAACCATTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCATTGCAATAACTGTGTCCATTTTTGGTAAAATGGATGAGTTAATTCCTTGGTAAT / / // / / // / | | |MaeII SetI SetI || NlaIV | | |AclI |MseI | | MaeIII TspEI | TaiI | SetI Tsp4CI* Y G N V I D T G K N H F T Y S I K E P L T V T L L T Q V K T I L P T Q L R N H * R * R Y * H R * K P F Y L L N * G T I R ----:----|----:----|----:----|----:----|----:----|----:----| * P L T I S V P L F W K V * E I L S G N R R Y R * Q C L Y F G N * R S L * P V M V T V N N V C T F V M K G V * N L F W * AciI MwoI |CfrI |BisI ||BlsI FatI |||TauI |CviAII |||CviJI StyI || NlaIII |||HaeIII SecI* || | TspEI \\\\ \ \\ \ \ GGCGTTTGCGGCCAAATAATCCCTTGGAACTTCCCTTTATTGATGTGGTCATGGAAAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCAAACGCCGGTTTATTAGGGAACCTTGAAGGGAAATAACTACACCAGTACCTTTTAA / //// / / / // // | |||| CfrI SecI* | |FatI |TspEI | |||HaeIII StyI | CviAII TsoI | |||CviJI NlaIII | ||BisI | ||AciI | |BlsI | TauI MwoI G V C G Q I I P W N F P L L M W S W K I A F A A K * S L G T S L Y * C G H G K L R L R P N N P L E L P F I D V V M E N W ----:----|----:----|----:----|----:----|----:----|----:----| P T Q P W I I G Q F K G K N I H D H F I L R K R G F L G K S S G K I S T T M S F A N A A L Y D R P V E R * Q H P * P F N TsoI AsuI* |BmgT120I CviJI ||CviJI |SfeI* AciI ||HaeIII || MaeIII Tsp4CI* | NspBII* ||| Cac8I || | SetI | Hpy99I | | FauI SetI \\\ \ \\ \ \ \ \ \ \ \ \ GGGCCTGCTCTGGCTACAGGTAACACCGTCGTATTGAAACCCGCTGAAACAACACCTTTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGGACGAGACCGATGTCCATTGTGGCAGCATAACTTTGGGCGACTTTGTTGTGGAAAT /// / // / / / / / ||Cac8I | |SfeI* | Tsp4CI* | | SetI |AsuI* | SetI | Hpy99I | FauI BmgT120I CviJI MaeIII NspBII* HaeIII AciI CviJI G P A L A T G N T V V L K P A E T T P L G L L W L Q V T P S Y * N P L K Q H L Y A C S G Y R * H R R I E T R * N N T F I ----:----|----:----|----:----|----:----|----:----|----:----| P G A R A V P L V T T N F G A S V V G K Q A Q E P * L Y C R R I S V R Q F L V K P R S Q S C T V G D Y Q F G S F C C R * AciI | NspBII* MwoI Hpy178III* | | FauI | BfiI BsrI BarI | Cac8I | | | BarI \ \ \ \ \ \ \ \ \ \ TCTGCCCTTTTCGCTTCCCAGTTGTGTCAGGAAGCAGGCATACCCGCTGGTGTAGTCAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGGGAAAAGCGAAGGGTCAACACAGTCCTTCGTCCGTATGGGCGACCACATCAGTTA / / / / / / / / / | BfiI | BarI | Cac8I | | FauI MwoI BsrI Hpy178III* | BarI NspBII* AciI S A L F A S Q L C Q E A G I P A G V V N L P F S L P S C V R K Q A Y P L V * S I C P F R F P V V S G S R H T R W C S Q Y ----:----|----:----|----:----|----:----|----:----|----:----| D A R K A E W N H * S A P M G A P T T L I Q G K R K G T T D P L L C V R Q H L * R G K E S G L Q T L F C A Y G S T Y D I MmeI BssKI |HpaII ||ScrFI ||CauII* ApaLI ||| NlaIV | CviRI* ||| |BetI* | Hpy166II MaeII ||| |BsiYI* | | SduI |BtrI ||| |Hin4II* | | BseSI || SetI ||| ||HpaII | | HgiAI* || TaiI \\\ \\\ \ \ \ \\ \ ATCCTTCCGGGTTCCGGTAGAGTTGTTGGAGAAAGATTGAGTGCACACCCAGACGTGAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAAGGCCCAAGGCCATCTCAACAACCTCTTTCTAACTCACGTGTGGGTCTGCACTTC / //// // / / / / // / MmeI |||| |BetI* | | ApaLI | || TaqII |||| HpaII | Hpy166II | |MaeII |||Hin4II* | CviRI* | BtrI |||NlaIV HgiAI* TaiI ||BssKI BseSI SetI |BsiYI* SduI CauII* HpaII ScrFI I L P G S G R V V G E R L S A H P D V K S F R V P V E L L E K D * V H T Q T * R P S G F R * S C W R K I E C T P R R E E ----:----|----:----|----:----|----:----|----:----|----:----| I R G P E P L T T P S L N L A C G S T F Y G E P N R Y L Q Q L F I S H V G L R S D K R T G T S N N S F S Q T C V W V H L Cfr10I |HpaII ||CfrI ||XmaIII* ||| CviJI ||| HaeIII ||| |AciI ||| |BisI ||| |McrI* SetI ||| ||BlsI | TseI MboII ||| |||TauI | |BisI | MboII ||| |||| BbvI | ||BlsI TaqII | | CviJI ||| |||| Hin4II* | ||| TspDTI \ \ \ \ \\\ \\\\ \ \ \\\ \ AAGATTGCTTTTACAGGCTCTACTGCCACCGGCCGCCATATTATGAAGGTCGCTGCCGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAACGAAAATGTCCGAGATGACGGTGGCCGGCGGTATAATACTTCCAGCGACGGCTA / / / ///// / / / //// | MboII CviJI ||||| | | SetI |||TspDTI MboII ||||| | BbvI |||AjuI ||||| Hin4II* ||TseI ||||AciI |BisI |||XmaIII* BlsI |||CfrI |||BisI ||BlsI |Cfr10I |HaeIII |CviJI |TauI HpaII McrI* K I A F T G S T A T G R H I M K V A A D R L L L Q A L L P P A A I L * R S L P I D C F Y R L Y C H R P P Y Y E G R C R Y ----:----|----:----|----:----|----:----|----:----|----:----| F I A K V P E V A V P R W I I F T A A S S S Q K * L S * Q W R G G Y * S P R Q R L N S K C A R S G G A A M N H L D S G I MnlI | AluI | BseYI | CviJI AjuI | | SetI | Tsp4CI* | | | GsaI | | Hpy178III* | | | |HphI | | | MaeIII | | | || SetI | | | Tsp45I | | | || AjuI SspI \ \ \ \ \ \ \ \\ \ \ ACTGTCAAGAAAGTCACTTTGGAGCTGGGAGGTAAATCACCAAATATTGTGTTTGCTGAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAGTTCTTTCAGTGAAACCTCGACCCTCCATTTAGTGGTTTATAACACAAACGACTG / / / // / // / | | | || | |SetI SspI | | | || | BseYI | | | || | AjuI | | | || | HphI | | | || CviJI | | | || AluI | | | || GsaI | | | |SetI | | | MnlI | | Tsp45I | | MaeIII | Hpy178III* Tsp4CI* T V K K V T L E L G G K S P N I V F A D L S R K S L W S W E V N H Q I L C L L T C Q E S H F G A G R * I T K Y C V C * R ----:----|----:----|----:----|----:----|----:----|----:----| V T L F T V K S S P P L D G F I T N A S Y Q * S L * K P A P L Y I V L Y Q T Q Q S D L F D S Q L Q S T F * W I N H K S V BceAI | MboI | | DpnI | | |XbaI | | |BstKTI | | ||MaeI | | ||HgaI | | ||Hpy178III* | | ||| CviJI | | ||| | Hpy178III* | | ||| | | BsrDI Hin4II* BbvI \ \ \\\ \ \ \ \ \ GCTGATCTAGATAAAGCCGTCAAGAACATTGCCTTCGGTATTTTTTACAACTCTGGTGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTAGATCTATTTCGGCAGTTCTTGTAACGGAAGCCATAAAAAATGTTGAGACCACTT /// / // / / // / / ||| | || | CviJI |BsrDI Hin4II* BbvI ||| | || HgaI Hpy178III* ||| | |XbaI ||| | Hpy178III* ||| | MaeI ||| MboI ||DpnI |BstKTI BceAI A D L D K A V K N I A F G I F Y N S G E L I * I K P S R T L P S V F F T T L V K * S R * S R Q E H C L R Y F L Q L W * S ----:----|----:----|----:----|----:----|----:----|----:----| A S R S L A T L F M A K P I K * L E P S R Q D L Y L R * S C Q R R Y K K C S Q H S I * I F G D L V N G E T N K V V R T F TseI Hpy178III* |BisI | MnlI ||BlsI | Tsp4CI* ||HphI | | AccI |||Hin6I | | |MnlI ||||GlaI NlaIV | | |BssNAI SetI |||||HhaI | Hpy178III* | | |Hpy166II | CviRI* \\\\\\ \ \ \ \ \\ \ \ GTTTGCTGCGCTGGTTCCAGAATATACATTCAAGATACAGTATACGAGGAGGTGTTGCAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACGACGCGACCAAGGTCTTATATGTAAGTTCTATGTCATATGCTCCTCCACAACGTT ///// / / / / /// / / / ||||| | Hpy178III* | | ||AccI SetI | BseRI ||||| NlaIV | | |Hpy166II CviRI* ||||Hin6I | | |BssNAI |||GlaI | | MnlI ||TseI | Tsp4CI* ||HhaI | MnlI |BisI Hpy178III* HphI BlsI V C C A G S R I Y I Q D T V Y E E V L Q F A A L V P E Y T F K I Q Y T R R C C K L L R W F Q N I H S R Y S I R G G V A K ----:----|----:----|----:----|----:----|----:----|----:----| T Q Q A P E L I Y M * S V T Y S S T N C L K S R Q N W F I C E L Y L I R P P T A N A A S T G S Y V N L I C Y V L L H Q L PleI |MlyI || SetI HinfI || | MaeIII |MaeIII || | Tsp45I MnlI StyI BseRI |Tsp45I || | BstEII | HphI SecI* \ \\ \\ \ \ \ \ \ AAACTAAAGGATTACACCGAGTCACTAAAGGTCGGTGACCCATTTGATGAGGAAGTTTTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATTTCCTAATGTGGCTCAGTGATTTCCAGCCACTGGGTAAACTACTCCTTCAAAAG / / / / / / | | PleI | | HphI | | MlyI | MnlI | | SetI BstEII | Tsp45I Tsp45I | MaeIII MaeIII HinfI K L K D Y T E S L K V G D P F D E E V F N * R I T P S H * R S V T H L M R K F S T K G L H R V T K G R * P I * * G S F P ----:----|----:----|----:----|----:----|----:----|----:----| F S F S * V S D S F T P S G N S S S T K F V L P N C R T V L P R H G M Q H P L K F * L I V G L * * L D T V W K I L F N E TseI AluI CviJI PvuII NspBII* |BisI SetI ||BlsI | SduI ||SetI | HgiAI* |||CviRI* | | BbvI |||| ApoI Tth111I | | | Hpy188I |||| TspEI | TaqI MnlI \ \ \ \ \\\\ \ \ \ \ CAAGGTGCTCAAACATCTGACAAACAGCTGCATAAAATTTTAGACTATGTCGATGTAGCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCACGAGTTTGTAGACTGTTTGTCGACGTATTTTAAAATCTGATACAGCTACATCGT / // // / //// / / / / | |HgiAI* |BbvI | |||CviRI* TspEI | TaqI MnlI | |SduI Hpy188I | |||TseI ApoI Tth111I | SecI* | ||BisI | StyI | |BlsI SetI | NspBII* | PvuII | CviJI | AluI SetI Q G A Q T S D K Q L H K I L D Y V D V A K V L K H L T N S C I K F * T M S M * Q R C S N I * Q T A A * N F R L C R C S K ----:----|----:----|----:----|----:----|----:----|----:----| W P A * V D S L C S C L I K S * T S T A G L H E F M Q C V A A Y F K L S H R H L L T S L C R V F L Q M F N * V I D I Y C BsrI | AsuI* | |NlaIV | |BmgT120I | ||CviJI Hpy188I | ||HaeIII | CviJI | ||| FatI | | SduI | ||| |CviAII | | HgiJII* | ||| || NlaIII | | | MaeIII | ||| || | GsuI | | | Tsp45I | ||| || | Eco57MI | | | |MnlI | ||| || | | SetI \ \ \ \\ \ \\\ \\ \ \ \ AAATCAGAGGGGGCTCGTCTTGTGACTGGAGGGGCCAGACATGGCAGTAAAGGTTATTTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTCTCCCCCGAGCAGAACACTGACCTCCCCGGTCTGTACCGTCATTTCCAATAAAA / / / / / / /// / // / / | | CviJI MnlI | BsrI ||| | || | SetI | HgiJII* Tsp45I ||| | || Eco57MI | SduI MaeIII ||| | || GsuI Hpy188I ||| | |FatI ||| | CviAII ||| NlaIII ||AsuI* |BmgT120I |HaeIII |CviJI NlaIV K S E G A R L V T G G A R H G S K G Y F N Q R G L V L * L E G P D M A V K V I L I R G G S S C D W R G Q T W Q * R L F C ----:----|----:----|----:----|----:----|----:----|----:----| F D S P A R R T V P P A L C P L L P * K L I L P P E D Q S Q L P W V H C Y L N N F * L P S T K H S S P G S M A T F T I K TspEI | BsaXI | MboII | | MnlI Tsp4CI* | | | MseI CviJI | TspRI | | | | BslFI \ \ \ \ \ \ \ \ GTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAGGAGGAAGTG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCGGTTGTCACAAACGACTACAGTTTCTTCTATACTCTTAACAATTCCTCCTTCAC / / / / / // / / | | Tsp4CI* | | || MseI BslFI | TspRI | | |TspEI CviJI | | MnlI | MboII BsaXI V K P T V F A D V K E D M R I V K E E V S S Q Q C L L M S K K I * E L L R R K C Q A N S V C * C Q R R Y E N C * G G S V ----:----|----:----|----:----|----:----|----:----|----:----| T L G V T N A S T L S S I L I T L S S T Q * A L L T Q Q H * L L Y S F Q * P P L D L W C H K S I D F F I H S N N L L F H AsuI* AvaII |BmgT120I || MaeIII || |BsaXI ||NlaIV || Tsp4CI* BciVI Tsp4CI* TspDTI \\\ \\ \ \ \ \ TTTGGTCCCATTGTAACTGTATCCAAGTTTTCTACTGTTGATGAAGTGATTGCTATGGCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAGGGTAACATTGACATAGGTTCAAAAGATGACAACTACTTCACTAACGATACCGT // / / / / / || BsaXI Tsp4CI* BciVI Tsp4CI* TspDTI |AvaII MaeIII |AsuI* BmgT120I NlaIV F G P I V T V S K F S T V D E V I A M A L V P L * L Y P S F L L L M K * L L W Q W S H C N C I Q V F Y C * * S D C Y G K ----:----|----:----|----:----|----:----|----:----|----:----| N P G M T V T D L N E V T S S T I A I A T Q D W Q L Q I W T K * Q Q H L S Q * P K T G N Y S Y G L K R S N I F H N S H C CviJI |AciI |BisI TfiI ||BlsI HinfI BspMI |||TauI SetI MseI CviJI \ \ \\\\ \ \ \ AATGATTCTCAATATGGGTTAGCCGCAGGTATTCACACTAACGATATTAACAAGGCTGTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTAAGAGTTATACCCAATCGGCGTCCATAAGTGTGATTGCTATAATTGTTCCGACAA / / ///// / / HinfI | ||||SetI MseI CviJI TfiI | |||AciI | ||BisI | |BlsI | CviJI | TauI BspMI N D S Q Y G L A A G I H T N D I N K A V M I L N M G * P Q V F T L T I L T R L L * F S I W V S R R Y S H * R Y * Q G C * ----:----|----:----|----:----|----:----|----:----|----:----| F S E * Y P N A A P I * V L S I L L A T L H N E I H T L R L Y E C * R Y * C P Q I I R L I P * G C T N V S V I N V L S N AluI CviJI | SetI | | Csp6I | | |RsaI | | || Tsp4CI* SetI \ \ \\ \ \ GATGTGTCCAAAAGAGTGAAAGCTGGTACTGTTTGGATAAATACCTATAACAACTTCCAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACAGGTTTTCTCACTTTCGACCATGACAAACCTATTTATGGATATTGTTGAAGGTG / / /// / | | ||Tsp4CI* SetI | | |Csp6I | | RsaI | CviJI | AluI SetI D V S K R V K A G T V W I N T Y N N F H M C P K E * K L V L F G * I P I T T S T C V Q K S E S W Y C L D K Y L * Q L P P ----:----|----:----|----:----|----:----|----:----|----:----| S T D L L T F A P V T Q I F V * L L K W Q H T W F L S L Q Y Q K S L Y R Y C S G I H G F S H F S T S N P Y I G I V V E V XcmI | SetI BsiYI* | | CfrI | CviJI | | |TaqII | | CfrI | | ||CviJI | | | BceAI | | ||HaeIII TseI | | | CviJI | | ||| BbvI CviJI | | | HaeIII | | ||| | MnlI |BisI MslI | | | |BsrI | | ||| | BsiYI* ||BlsI \ \ \ \ \\ \ \ \\\ \ \ \\\ CAAAATGTTCCTTTCGGTGGCTTCGGCCAGTCAGGTATTGGCCGTGAAATGGGTGAGGCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTACAAGGAAAGCCACCGAAGCCGGTCAGTCCATAACCGGCACTTTACCCACTCCGA / / / // / // / / / / / / /// MslI BsiYI* | || | |XcmI | | | | | BbvI ||BisI | || | SetI | | | | MnlI |BlsI | || BceAI | | | BsiYI* CviJI | || CfrI | | CfrI | |HaeIII | HaeIII | |CviJI | CviJI | BsrI TaqII CviJI Q N V P F G G F G Q S G I G R E M G E A K M F L S V A S A S Q V L A V K W V R L K C S F R W L R P V R Y W P * N G * G C ----:----|----:----|----:----|----:----|----:----|----:----| W F T G K P P K P W D P I P R S I P S A G F H E K R H S R G T L Y Q G H F P H P L I N R E T A E A L * T N A T F H T L S MseI HphI Hpy188I CviJI | MaeIII |TspEI | TspEI \ \ \\ \ \ GCTTTAAGTAACTACACTCAAACAAAATCTGTCAGAATTGCCATTGACAAGCCAATTCGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAATTCATTGATGTGAGTTTGTTTTAGACAGTCTTAACGGTAACTGTTCGGTTAAGCA / / / / / / / / | | MseI MaeIII | TspEI CviJI TspEI | HphI Hpy188I TseI A L S N Y T Q T K S V R I A I D K P I R L * V T T L K Q N L S E L P L T S Q F V F K * L H S N K I C Q N C H * Q A N S L ----:----|----:----|----:----|----:----|----:----|----:----| A K L L * V * V F D T L I A M S L G I R Q K L Y S C E F L I Q * F Q W Q C A L E S * T V V S L C F R D S N G N V L W N T TGA --- ACT * X X --- Q N S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 2 FblI,XmiI AciI 8 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AjuI 1 AluI 8 AluBI ApaLI 1 Alw44I,VneI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 8 BseXI,BstV1I,Lsp1109I BccI 1 Bce83I* 1 BpuEI BceAI 3 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BisI 12 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 12 BmgT120I 3 BsaXI 1 BsePI 1 BssHII,PauI BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BtrI 2 BmgBI,AjiI Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 30 CviKI-1 CviRI* 5 HpyCH4V DpnI 2 MalI Eco57MI 1 EcoRI 1 FatI 2 FauI 2 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 4 GsaI 1 GsuI 1 BpmI HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 4 HinP1I,HspAI HindIII 3 HinfI 3 HpaII 4 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 4 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 10 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MluI 1 MlyI 2 SchI MmeI 1 MnlI 10 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 4 MspA1I PleI 2 PpsI PstI 1 PvuII 1 RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 29 SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 2 TaqII 2 TauI 4 TfiI 1 PfeI TseI 8 ApeKI TsoI 1 Tsp45I 5 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 9 TasI,Tsp509I,Sse9I TspRI 2 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 1 XcmI 2 XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AgeI AhaIII* AlfI AloI AlwNI ApaI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvII* BcgI BdaI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseBI BseGI BseMII BsgI BsiI* BsmAI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI Bst2UI BstAPI BstF5I BstNI BstOI BstXI BtgZI BtsCI BtsI Cfr9I ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FokI FseI FspAI HaeII HgiCI* Hin4I HindII HpaI KasI KpnI MauBI MfeI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TspGWI TspMI TstI VspI XhoI XhoII XmaCI XmaI XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769