Restriction Map of VTC1/YER072W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

VTC1/YER072W on chromosome V from coordinates 302806 to 303195.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21856

BssKI EcoRII |SecI* MboI ||ScrFI |CspCI ||BseBI ||DpnI |||SetI |||BstKTI BsiI* \\\\ \\\\ \ ATGTCTTCAGCACCATTATTACAAAGAACACCTGGGAAAAAGATCGCTTTGCCCACACGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAAGTCGTGGTAATAATGTTTCTTGTGGACCCTTTTTCTAGCGAAACGGGTGTGCT / / / / // / / | | | | || MboI BsiI* | | | | |DpnI | | | | BstKTI | | | CspCI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI SetI M S S A P L L Q R T P G K K I A L P T R C L Q H H Y Y K E H L G K R S L C P H E V F S T I I T K N T W E K D R F A H T S ----:----|----:----|----:----|----:----|----:----|----:----| X D E A G N N C L V G P F F I A K G V R X T K L V M I V F F V Q S F S R K A W V H R * C W * * L S C R P F L D S Q G C S Csp6I |RsaI CviJI CspCI || SetI Tsp4CI* \ \ \\ \ \ GTTGAGCCAAAAGTGTTCTTTGCCAATGAGCGTACCTTTTTGTCGTGGTTGAACTTTACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTCGGTTTTCACAAGAAACGGTTACTCGCATGGAAAAACAGCACCAACTTGAAATGT / / // / CviJI CspCI |Csp6I Tsp4CI* RsaI SetI V E P K V F F A N E R T F L S W L N F T L S Q K C S L P M S V P F C R G * T L Q * A K S V L C Q * A Y L F V V V E L Y S ----:----|----:----|----:----|----:----|----:----|----:----| T S G F T N K A L S R V K K D H N F K V L Q A L L T R Q W H A Y R K T T T S S * N L W F H E K G I L T G K Q R P Q V K C MnlI | BseYI | | GsaI | | | StuI | | | CviJI SetI | | | HaeIII |Hpy166II | | | |StyI || ApoI MaeIII HphI | | | |SecI* || TspEI Tsp45I | SetI \ \ \ \\ \\ \ \ \ \ GTTATGCTGGGAGGCCTTGGTGTAGGTTTACTGAATTTTGGTGACAAGATAGGTAGGGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACGACCCTCCGGAACCACATCCAAATGACTTAAAACCACTGTTCTATCCATCCCAG / / / / / / / / / // / | | | | | SetI Hpy166II TspEI | |HphI TspRI | | | | SecI* ApoI | SetI | | | | StyI Tsp45I | | | HaeIII MaeIII | | | CviJI | | | StuI | | BseYI | GsaI MnlI V M L G G L G V G L L N F G D K I G R V L C W E A L V * V Y * I L V T R * V G S Y A G R P W C R F T E F W * Q D R * G Q ----:----|----:----|----:----|----:----|----:----|----:----| T I S P P R P T P K S F K P S L I P L T L * A P L G Q H L N V S N Q H C S L Y P N H Q S A K T Y T * Q I K T V L Y T P D BsgI | FatI | NcoI EcoP15I | StyI | Hin6I | SecI* | FnuDII* | DsaI* | |GlaI | |CviAII | ||HhaI | || NlaIII | ||| MaeIII CviRI* | || | Csp6I | ||| | BbvI | TspRI | || | |RsaI | ||| | | BbvI \ \ \ \\ \ \\ \ \\\ \ \ \ AGTGCAGGACTATTTACTTTTGTTGCCATGGGTACAATGATATACGCGCTTGTAACATAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGTCCTGATAAATGAAAACAACGGTACCCATGTTACTATATGCGCGAACATTGTATG / / / // // //// / / CviRI* BsgI | || |Csp6I |||Hin6I | TspRI | || RsaI ||GlaI MaeIII | |DsaI* |FnuDII* | |SecI* |HhaI | |StyI EcoP15I | |NcoI | |FatI | CviAII NlaIII S A G L F T F V A M G T M I Y A L V T Y V Q D Y L L L L P W V Q * Y T R L * H T C R T I Y F C C H G Y N D I R A C N I P ----:----|----:----|----:----|----:----|----:----|----:----| L A P S N V K T A M P V I I Y A S T V Y * H L V I * K Q Q W P Y L S I R A Q L M T C S * K S K N G H T C H Y V R K Y C V MnlI | GsuI | MaeII | Eco57MI | | SetI BsrI | | TaiI TspRI | | | MboI AsuI* | TseI | | | | DpnI DraII | AluI | | | | |BstKTI Bsp120I | CviJI | | | | || AsuI* |AsuI* | |BisI | | | | || AvaII |NlaIV | ||BlsI | | | | || DraII |BmgT120I | ||SetI | | | | || PpuMI ||CviJI | |||TseI | | | | || |BmgT120I ||NlaIV | ||||BisI | | | | || ||SetI ||HaeIII | |||||BlsI | | | | || ||BinI* ||BmgT120I \ \\\\\\ \ \ \ \ \\ \\\ \\\ CACTGGAGAGCTGCTGCGATTAGACGTAGAGGATCAGGTCCTTATGATGACAGATTGGGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTGACCTCTCGACGACGCTAATCTGCATCTCCTAGTCCAGGAATACTACTGTCTAACCCC / // / /////// /// / // / // /// | || | ||||||TseI ||| MaeII || | |BinI* ||BmgT120I | || | |||||BisI ||TaiI || | |PpuMI ||HaeIII | || | ||||BlsI ||SetI || | |DraII ||NlaIV | || | |||TseI |Eco57MI || | |AvaII ||CviJI | || | ||BisI |GsuI || | |AsuI* |NlaIV | || | |BlsI MnlI || | BmgT120I HgiJII* | || | CviJI || MboI BseSI | || | AluI || SetI SduI | || SetI |DpnI ApaI | |BsrI BstKTI | BbvI BbvI H W R A A A I R R R G S G P Y D D R L G T G E L L R L D V E D Q V L M M T D W G L E S C C D * T * R I R S L * * Q I G A ----:----|----:----|----:----|----:----|----:----|----:----| W Q L A A A I L R L P D P G * S S L N P G S S L Q Q S * V Y L I L D K H H C I P V P S S S R N S T S S * T R I I V S Q P ApaI SduI BseSI HgiJII* MseI \ \ CCCACTTTGTTGTGCTTTTTCTTATTGGTTGCTGTCATTATCAACTTTATATTAAGATTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGAAACAACACGAAAAAGAATAACCAACGACAGTAATAGTTGAAATATAATTCTAAC // / |Bsp120I MseI |AsuI* BmgT120I DraII AsuI* P T L L C F F L L V A V I I N F I L R L P L C C A F S Y W L L S L S T L Y * D * H F V V L F L I G C C H Y Q L Y I K I E ----:----|----:----|----:----|----:----|----:----|----:----| G V K N H K K K N T A T M I L K I N L N A W K T T S K R I P Q Q * * * S * I L I G S Q Q A K E * Q N S D N D V K Y * S Q TatI |Csp6I HgaI ||RsaI |DdeI \\\ \\ AAGTACAATGACGCTAACACTAAGTTATGA 370 380 390 ----:----|----:----|----:----| TTCATGTTACTGCGATTGTGATTCAATACT /// // ||TatI |HgaI |Csp6I DdeI RsaI K Y N D A N T K L * S T M T L T L S Y X V Q * R * H * V M X ----:----|----:----|----:----| F Y L S A L V L N H S T C H R * C * T I L V I V S V S L * S # Enzymes that cut Frequency Isoschizomers AluI 1 AluBI ApaI 1 ApoI 1 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI Bsp120I 1 PspOMI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 1 CviJI 4 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DraII 2 EcoO109I DsaI* 1 BtgI,BstDSI Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 1 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 1 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HphI 1 AsuHPI Hpy166II 1 Hpy8I MaeII 1 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MnlI 2 MseI 1 Tru1I,Tru9I NcoI 1 Bsp19I NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 7 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TatI 1 TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 1 TasI,Tsp509I,Sse9I TspRI 2 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BseMII BsePI BseRI BsiYI* BslFI BsmAI BsmFI BsmI Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI HaeII HgiAI* HgiCI* Hin4I Hin4II* HindII HindIII HinfI HpaI HpaII Hpy178III*Hpy188I Hpy99I KasI KpnI Ksp632I* MaeI MauBI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MwoI NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI SwaI TaqI TaqII TauI TfiI TsoI TspDTI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769