Restriction Map of YER067C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YER067C-A on chromosome V from coordinates 292563 to 292240.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.7816

EMBOSS_001 Hin6I SetI |GlaI |MseI ||HhaI FokI MboII ||TspEI ||| SfeI* BseGI | TaqI TspDTI \\\ \\\ \ \ \ \ \ ATGACACAACCTTTAATTTGCGCCTACAGGATGTGTTTTGTAATCGACAAATACCATAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTGTTGGAAATTAAACGCGGATGTCCTACACAAAACATTAGCTGTTTATGGTATCG / / / /// / / / // SetI | | ||Hin6I | BseGI FokI |MboII | | |GlaI SfeI* TaqI TspDTI | | HhaI | TspEI MseI M T Q P L I C A Y R M C F V I D K Y H S * H N L * F A P T G C V L * S T N T I A D T T F N L R L Q D V F C N R Q I P * H ----:----|----:----|----:----|----:----|----:----|----:----| X V C G K I Q A * L I H K T I S L Y W L X S V V K L K R R C S T N Q L R C I G Y H C L R * N A G V P H T K Y D V F V M A Hpy178III* | AccI | SetI | |Hpy166II | || FatI | || NcoI MslI | || StyI |FatI | || SecI* ||CviAII | || DsaI* ||| SfaNI MaeII | || |CviAII ||| |NlaIII | SetI | || || NlaIII ||| || CviRI* | TaiI | || || | HphI \\\ \\ \ \ \ \ \\ \\ \ \ ATCTTCATGTGTGCAAACTACTTGAACGTCTATCTTGAAAGGTCTACCATGGTATTCAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAGTACACACGTTTGATGAACTTGCAGATAGAACTTTCCAGATGGTACCATAAGTCA // // // / / / / // / // / || || |CviRI* | MaeII | SetI || | || HphI || || SfaNI TaiI | || | |DsaI* || |FatI SetI | || | |SecI* || CviAII | || | |StyI |NlaIII | || | |NcoI MslI | || | |FatI | || | CviAII | || NlaIII | |AccI | Hpy166II Hpy178III* I F M C A N Y L N V Y L E R S T M V F S S S C V Q T T * T S I L K G L P W Y S V L H V C K L L E R L S * K V Y H G I Q F ----:----|----:----|----:----|----:----|----:----|----:----| M K M H A F * K F T * R S L D V M T N L C R * T H L S S S R R D Q F T * W P I * D E H T C V V Q V D I K F P R G H Y E T Tsp4CI* |MslI || MnlI || | BssKI || | EcoRII Hin4II* || | | ScrFI BsmAI | Hpy178III* || | | BseBI MboII | Ksp632I* | | ApoI || | | | SetI |HphI | | TaqI | | TspEI \\ \ \ \ \ \\ \ \ \ \ \ \ TTCCTCACCGTAATGCCAGGTGATTTTATCAAATGTCTCTTCCTTCGATTTTTCGTGAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGAGTGGCATTACGGTCCACTAAAATAGTTTACAGAGAAGGAAGCTAAAAAGCACTTT / / / // / // / // / / | | MnlI || EcoRII |HphI | || | Hpy178III* | MslI || BssKI MboII | || Hin4II* Tsp4CI* |BseBI | |TaqI |ScrFI | Ksp632I* SetI BsmAI F L T V M P G D F I K C L F L R F F V K S S P * C Q V I L S N V S S F D F S * N P H R N A R * F Y Q M S L P S I F R E I ----:----|----:----|----:----|----:----|----:----|----:----| K R V T I G P S K I L H R K R R N K T F N G * R L A L H N * * I D R G E I K R S E E G Y H W T I K D F T E E K S K E H F MseI | AluI BspCNI | CviJI |BseMII | |DdeI || CviJI | |Bpu10I || | Cac8I SfaNI AarI | ||SetI SetI || | | MseI |BceAI BspMI \ \\\ \ \\ \ \ \ \\ \ TTTAAGCTCAGGTTTCCTAACGGCTTGCTTAATATCTTTCAAAAGATGCTTTTCAATATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTCGAGTCCAAAGGATTGCCGAACGAATTATAGAAAGTTTTCTACGAAAAGTTATAC / / / // // / / / // | | | |Bpu10I || | Cac8I MseI |SfaNI | | | |DdeI || CviJI BceAI | | | SetI |BseMII | | CviJI BspCNI | | AluI | MseI | SetI TspEI ApoI F K L R F P N G L L N I F Q K M L F N M L S S G F L T A C L I S F K R C F S I C * A Q V S * R L A * Y L S K D A F Q Y A ----:----|----:----|----:----|----:----|----:----|----:----| N L S L N G L P K S L I K * F I S K L I I * A * T E * R S A * Y R E F S A K * Y K L E P K R V A Q K I D K L L H K E I H CviRI* | MaeIII HgaI TseI | Tsp45I HphI CviRI* TspEI | | SetI | DdeI ApoI |BisI | BbvI | | |MwoI | BsgI TspEI ||BlsI | SfaNI \ \ \\ \ \ \ \\\ \ \ CTGGTGCAGGTGACGCACGAACTTCTTAGAATGAGAATTTGCAGCATCACTAATTTTTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GACCACGTCCACTGCGTGCTTGAAGAATCTTACTCTTAAACGTCGTAGTGATTAAAAAAG / // / / / / / / / //// / / | || MwoI | | | | DdeI | |||TseI | SfaNI | |SetI | | | HgaI | ||BisI | BbvI | CviRI* | | BsgI | |BlsI TspEI BspMI | HphI | CviRI* AarI Tsp45I TspEI MaeIII ApoI L V Q V T H E L L R M R I C S I T N F F W C R * R T N F L E * E F A A S L I F S G A G D A R T S * N E N L Q H H * F F Q ----:----|----:----|----:----|----:----|----:----|----:----| S T C T V C S S R L I L I Q L M V L K K A P A P S A R V E * F S F K C C * * N K Q H L H R V F K K S H S N A A D S I K E AsuI* AvaII DraII PpuMI |NlaIV |BmgT120I || BsiI* HinfI || |MlyI | MnlI || |PleI | BsiI* \\ \\ \ \ AGGGTCCTCGTGCGACTCGTGTAG 310 320 ----:----|----:----|---- TCCCAGGAGCACGCTGAGCACATC /// // / / / / ||| || | | | BsiI* ||| || | | HinfI ||| || | MnlI ||| || BsiI* ||| |PleI ||| MlyI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I NlaIV R V L V R L V * G S S C D S C X G P R A T R V X ----:----|----:----|---- L T R T R S T Y * P G R A V R T P D E H S E H L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AluI 1 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BceAI 1 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 Bpu10I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BssKI 1 BstSCI,StyD4I Cac8I 1 BstC8I CviAII 2 CviJI 2 CviKI-1 CviRI* 3 HpyCH4V DdeI 2 BstDEI,HpyF3I DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FokI 1 GlaI 1 HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 1 HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 1 HpyCH4IV MaeIII 1 MboII 2 MlyI 1 SchI MnlI 2 MseI 3 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 7 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 2 TseI 1 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstKTI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DpnI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* Hin4I HindII HindIII HpaI HpaII Hpy188I Hpy99I KasI KpnI MaeI MauBI MboI McrI* MfeI MluI MmeI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TatI TauI TfiI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769