Restriction Map of JHD1/YER051W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

JHD1/YER051W on chromosome V from coordinates 254656 to 256134.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30792

BssKI EcoRII | ScrFI | BseBI BinI* | | Hin6I | CviRI* Cac8I | | |GlaI | | MboI | BsrDI | | |TaqII | | XhoII | | MwoI | | ||HhaI | | | DpnI | | | BsrI | | ||| MseI | | | |BstKTI | | | Hin4II* | | ||| VspI | | | || SspI | | | | BsiYI* | | ||| |TspEI \ \ \ \\ \ \ \ \ \ \ \ \ \\\ \\ ATGCAAGATCCCAATATTTGCCAGCATTGCCAGTTGAAGGATAATCCAGGCGCATTAATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTCTAGGGTTATAAACGGTCGTAACGGTCAACTTCCTATTAGGTCCGCGTAATTAA // // / / // // / ///// / / || || | SspI |MwoI || BsiYI* ||||| | TspEI || || XhoII Cac8I |Hin4II* ||||| VspI || || MboI BsrDI BsrI ||||| MseI || |DpnI ||||Hin6I || BstKTI |||GlaI |CviRI* ||EcoRII BinI* ||BssKI ||HhaI |TaqII BseBI ScrFI M Q D P N I C Q H C Q L K D N P G A L I C K I P I F A S I A S * R I I Q A H * F A R S Q Y L P A L P V E G * S R R I N L ----:----|----:----|----:----|----:----|----:----|----:----| X C S G L I Q W C Q W N F S L G P A N I X A L D W Y K G A N G T S P Y D L R M L H L I G I N A L M A L Q L I I W A C * N AciI Cac8I | BsiYI* | | FauI | | |AsuI* | | |AvaII | | ||BtsI | | ||NlaIV | | ||TspRI | | ||BmgT120I | | ||| Hpy166II | | ||| | MaeII | | ||| | |PmaCI | | ||| | |BsaAI | | ||| | || SetI HphI | | ||| | || TaiI Cac8I BsmI \ \ \ \\\ \ \\ \ \ \ TGGGTGAAGTGTGATAGTTGCCCGCAGTGGGTCCACGTGAAATGCGTGCCTTTGAAACGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCACTTCACACTATCAACGGGCGTCACCCAGGTGCACTTTACGCACGGAAACTTTGCG / / / / //// // / / HphI | | | |||| |MaeII Cac8I BsmI | | | |||| BsaAI | | | |||| PmaCI | | | |||TaiI | | | |||SetI | | | ||Hpy166II | | | ||AvaII | | | ||AsuI* | | | |BmgT120I | | | NlaIV | | | FauI | | BtsI | BsiYI* | AciI Cac8I TspRI W V K C D S C P Q W V H V K C V P L K R G * S V I V A R S G S T * N A C L * N A G E V * * L P A V G P R E M R A F E T H ----:----|----:----|----:----|----:----|----:----|----:----| Q T F H S L Q G C H T W T F H T G K F R K P S T H Y N G A T P G R S I R A K S V P H L T I T A R L P D V H F A H R Q F A ApoI TspEI | Eco57I Hpy188I | Eco57MI \ \ \ ATTCACTATTCAAATCTTACAAGTTCTGAAGTTCTGTCTTATCCAAATTCTGCGAAGCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTGATAAGTTTAGAATGTTCAAGACTTCAAGACAGAATAGGTTTAAGACGCTTCGTT / / / Hpy188I | TspEI | ApoI Eco57MI Eco57I I H Y S N L T S S E V L S Y P N S A K Q F T I Q I L Q V L K F C L I Q I L R S K S L F K S Y K F * S S V L S K F C E A N ----:----|----:----|----:----|----:----|----:----|----:----| M * * E F R V L E S T R D * G F E A F C C E S N L D * L N Q L E T K D L N Q S A N V I * I K C T R F N Q R I W I R R L L Hpy178III* | AluI | CviJI | | SetI | | | Tsp4CI* Hin4II* AciI \ \ \ \ \ \ ATCAAGAGCTACCGTTGTCCTAATCATAAGGAAGGAGAATATCTTACCGCATACGCTCTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCTCGATGGCAACAGGATTAGTATTCCTTCCTCTTATAGAATGGCGTATGCGAGAG // / / / / || | Tsp4CI* Hin4II* AciI || CviJI || AluI |SetI Hpy178III* I K S Y R C P N H K E G E Y L T A Y A L S R A T V V L I I R K E N I L P H T L S Q E L P L S * S * G R R I S Y R I R S H ----:----|----:----|----:----|----:----|----:----|----:----| I L L * R Q G L * L S P S Y R V A Y A R F * S S G N D * D Y P L L I D * R M R E D L A V T T R I M L F S F I K G C V S E AciI |BisI ||BlsI BdaI |||TauI BdaI MboII \\\\ \ \ ATCACACAAAAAGGAAAGCGGCAAAGGAATAAAGAAAACCCTGAAGATAGTCATATAAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGTGTTTTTCCTTTCGCCGTTTCCTTATTTCTTTTGGGACTTCTATCAGTATATTTA /// / / / ||BisI BdaI MboII Eco57MI ||AciI BdaI Eco57I |BlsI TauI I T Q K G K R Q R N K E N P E D S H I N S H K K E S G K G I K K T L K I V I * I H T K R K A A K E * R K P * R * S Y K * ----:----|----:----|----:----|----:----|----:----|----:----| M V C F P F R C L F L S F G S S L * I F * * V F L F A A F S Y L F G Q L Y D Y L D C L F S L P L P I F F V R F I T M Y I Eco57I Eco57MI |AciI || BdaI || BdaI Hin4I TfiI || | TspEI Hpy188I TspEI MboII | MnlI HinfI \\ \ \ \ \ \ \ \ \ AAGCGGTATAATTTCAGAAAGAAGAAATTACTTGACTATATCGCTTTGAATGAGGGTGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCCATATTAAAGTCTTTCTTCTTTAATGAACTGATATAGCGAAACTTACTCCCACTT / / / / / / / / | AciI | Hpy188I | MboII Hin4I MnlI BdaI TspEI TspEI BdaI K R Y N F R K K K L L D Y I A L N E G E S G I I S E R R N Y L T I S L * M R V N A V * F Q K E E I T * L Y R F E * G * I ----:----|----:----|----:----|----:----|----:----|----:----| L R Y L K L F F F N S S * I A K F S P S Y A T Y N * F S S I V Q S Y R K S H P H L P I I E S L L F * K V I D S Q I L T F FatI HphI TspDTI BspHI | Hin4I BsiYI* |CviAII | | TfiI |TspDTI |Hpy178III* TaqI HphI | | HinfI || MnlI || NlaIII TspDTI \ \ \ \ \ \\ \ \\ \ \ TCGAAAAGGGATAAAATGAATCACCCTCATAAGGAGAGTTTCATGAAATCTTTTGAAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTTTCCCTATTTTACTTAGTGGGAGTATTCCTCTCAAAGTACTTTAGAAAACTTTTT / / / / / / /// / / // / | | | | HphI HinfI ||| MnlI | |BspHI TspDTI | | | Hin4I TfiI ||TspDTI | |FatI | | HphI |TspDTI | Hpy178III* | TaqI BsiYI* | CviAII HinfI NlaIII TfiI S K R D K M N H P H K E S F M K S F E K R K G I K * I T L I R R V S * N L L K N E K G * N E S P S * G E F H E I F * K M ----:----|----:----|----:----|----:----|----:----|----:----| D F L S L I F * G * L S L K M F D K S F I S F P Y F S D G E Y P S N * S I K Q F R F P I F H I V R M L L T E H F R K F F AciI BisI |BlsI ||TauI SspI ||NspBII* CviJI | PsiI ||| MwoI BceAI \ \ \ \\\ \ \ TGGAAAAATGGCTCAAATATTATAAACGCCGCTGACTTTGCTGAAAAGTTTGATAATATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTTTTACCGAGTTTATAATATTTGCGGCGACTGAAACGACTTTTCAAACTATTATAT / / / //// / / CviJI | PsiI |||| MwoI BceAI SspI |||NspBII* |||AciI ||BisI |BlsI TauI W K N G S N I I N A A D F A E K F D N I G K M A Q I L * T P L T L L K S L I I * E K W L K Y Y K R R * L C * K V * * Y R ----:----|----:----|----:----|----:----|----:----|----:----| H F F P E F I I F A A S K A S F N S L I I S F H S L Y * L R R Q S Q Q F T Q Y Y P F I A * I N Y V G S V K S F L K I I Y Hin4I Hin4I | Csp6I | |RsaI | || MboI | || | DpnI | || | BinI* | || | |BstKTI | || | || TaqI | || | || ClaI | || | || |MboI | || | || || DpnI | || | || || |BstKTI | || | || || || BsaXI | || | || || || | TspRI | || | || || || | | AciI | || | || || || | | | Hin4I Csp6I BsiYI* | || | || || || | | | Hin4I |RsaI | BsaXI \ \\ \ \\ \\ \\ \ \ \ \ \\ \ \ GATGTGCCGTACAAGATCATCGATCCACTGAATAGCGGAGTATATGTACCGAATGTGGGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACGGCATGTTCTAGTAGCTAGGTGACTTATCGCCTCATATACATGGCTTACACCCG / // //// // // / / // / // Hin4I || |||| || |BsaXI | AciI || | |BseSI Hin4I || |||| || MboI Hin4I || | |SduI || |||| |TspRI Hin4I || | BsaXI || |||| |DpnI || BsiYI* || |||| BstKTI |Csp6I || |||| ClaI RsaI || |||| TaqI || |||MboI || ||BinI* || |DpnI || BstKTI |Csp6I RsaI D V P Y K I I D P L N S G V Y V P N V G M C R T R S S I H * I A E Y M Y R M W A C A V Q D H R S T E * R S I C T E C G H ----:----|----:----|----:----|----:----|----:----|----:----| S T G Y L I M S G S F L P T Y T G F T P L H A T C S * R D V S Y R L I H V S H P I H R V L D D I W Q I A S Y I Y R I H A BseGI | Tsp4CI* | | MseI | | FokI SduI | | |HphI FatI SfaNI | | |TspEI |CviAII BseSI | | ||MnlI MslI MnlI ||PsrI \ \ \ \\\ \ \ \\\ ACAGACAATGGATGCCTCACAGTTAATTATATCACCGAAATGATAGGCGAGGATTATCAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTGTTACCTACGGAGTGTCAATTAATATAGTGGCTTTACTATCCGCTCCTAATAGTA / / / /// // / / / / // SfaNI BseGI | ||| |TspEI | MnlI | | |CviAII | ||| FokI MslI | | Hin4I | ||MseI | | Hin4I | |MnlI | NlaIII | HphI PsrI Tsp4CI* T D N G C L T V N Y I T E M I G E D Y H Q T M D A S Q L I I S P K * * A R I I M R Q W M P H S * L Y H R N D R R G L S C ----:----|----:----|----:----|----:----|----:----|----:----| V S L P H R V T L * I V S I I P S S * * C L C H I G * L * N Y * R F S L R P N D C V I S A E C N I I D G F H Y A L I I M TspDTI | TspDTI | | MboI NlaIII | | XhoII |MslI MaeII TspEI | | | DpnI || Hin4I | SetI Hin4I | | | |BstKTI || Hin4I | TaiI PsrI Hin4I | | | || BinI* \\ \ \ \ \ \ \ \ \ \\ \ GTTGATGTAATGGACGTTCAATCACAAATGAATGAAAATTGGAACTTGGGATCTTGGAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTACATTACCTGCAAGTTAGTGTTTACTTACTTTTAACCTTGAACCCTAGAACCTTA // / / / / // / // / / |MslI | MaeII PsrI Hin4I || | || | BinI* FatI TaiI Hin4I || | || XhoII SetI || | || MboI || | |DpnI || | BstKTI || TspDTI |TspDTI TspEI V D V M D V Q S Q M N E N W N L G S W N L M * W T F N H K * M K I G T W D L G M * C N G R S I T N E * K L E L G I L E * ----:----|----:----|----:----|----:----|----:----|----:----| T S T I S T * D C I F S F Q F K P D Q F H Q H L P R E I V F S H F N S S P I K S N I Y H V N L * L H I F I P V Q S R P I MboI | DpnI | |TaqI | |BstKTI SspI TspDTI MnlI | || BinI* \ \ \ \ \\ \ GAATATTTTACAAATACTGAACCAGACAGGAGGGATCGAATAAGGAATGTTATATCATTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATAAAATGTTTATGACTTGGTCTGTCCTCCCTAGCTTATTCCTTACAATATAGTAAT / / / // // / SspI TspDTI MnlI || || BinI* || |TaqI || MboI |DpnI BstKTI E Y F T N T E P D R R D R I R N V I S L N I L Q I L N Q T G G I E * G M L Y H * I F Y K Y * T R Q E G S N K E C Y I I R ----:----|----:----|----:----|----:----|----:----|----:----| S Y K V F V S G S L L S R I L F T I D N H I N * L Y Q V L C S P D F L S H * I M F I K C I S F W V P P I S Y P I N Y * * AsuI* |CviJI |HaeIII |BmgT120I || BtsI || | SfeI* MnlI || | | CviRI* MboI BsmAI MnlI || | | | PstI | DpnI | SspI | MaeI || | | | TspRI | |BstKTI \ \ \ \ \\ \ \ \ \ \ \\ GAAGTCTCTAATATTGAGGGATTAGAACTAGAGAGGCCCACTGCAGTTAGGCAGAATGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAGAGATTATAACTCCCTAATCTTGATCTCTCCGGGTGACGTCAATCCGTCTTACTA / // / / /// / / / // | |BsmAI MnlI MaeI ||| | | SfeI* |DpnI | SspI ||| | CviRI* BstKTI MnlI ||| PstI ||AsuI* |BmgT120I HaeIII CviJI TspRI BtsI E V S N I E G L E L E R P T A V R Q N D K S L I L R D * N * R G P L Q L G R M I S L * Y * G I R T R E A H C S * A E * S ----:----|----:----|----:----|----:----|----:----|----:----| S T E L I S P N S S S L G V A T L C F S L L R * Y Q P I L V L S A W Q L * A S H F D R I N L S * F * L P G S C N P L I I Hin4II* ApoI | MnlI TspEI | | AciI \ \ \ \ CTTGTTGATAAAATTTGGAGTTTCAATGGACATTTAGAAAAAGTCAATGGGGAGAAGGCG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAACAACTATTTTAAACCTCAAAGTTACCTGTAAATCTTTTTCAGTTACCCCTCTTCCGC / / / / / MboI TspEI | MnlI AciI ApoI Hin4II* L V D K I W S F N G H L E K V N G E K A L L I K F G V S M D I * K K S M G R R R C * * N L E F Q W T F R K S Q W G E G G ----:----|----:----|----:----|----:----|----:----|----:----| R T S L I Q L K L P C K S F T L P S F A D Q Q Y F K S N * H V N L F L * H P S P K N I F N P T E I S M * F F D I P L L R EciI | BseRI MaeIII | | CviJI Tsp45I SfaNI BseGI \ \ \ \ \ \ GAGGAGAATGACCCCAAGCCAAAAGTGACCAAATATATTTTGATGTCTGTAAAGGATGCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTACTGGGGTTCGGTTTTCACTGGTTTATATAAAACTACAGACATTTCCTACGA / / / / / // | | CviJI Tsp45I SfaNI |TspDTI | BseRI MaeIII BseGI EciI E E N D P K P K V T K Y I L M S V K D A R R M T P S Q K * P N I F * C L * R M L G E * P Q A K S D Q I Y F D V C K G C L ----:----|----:----|----:----|----:----|----:----|----:----| S S F S G L G F T V L Y I K I D T F S A P P S H G W A L L S W I Y K S T Q L P H L L I V G L W F H G F I N Q H R Y L I S TspGWI | Cfr10I MnlI | |HpaII | PsiI | || Acc65I | | AclI | || HgiCI* | | MaeII | || |Csp6I | | | SetI | || ||RsaI | | | TaiI | || ||NlaIV | | | | BaeI TspDTI | || ||| KpnI | | | | |DdeI | FokI |BaeI || ||| | SetI | | | | || Hpy178III* \ \ \\ \\ \\\ \ \ \ \ \ \ \\ \ TATACGGATTTTCATTTGGATTTTGCCGGTACCTCTGTTTATTATAACGTTATCTCAGGA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGCCTAAAAGTAAACCTAAAACGGCCATGGAGACAAATAATATTGCAATAGAGTCCT / / / ///// / / / // // | | TspGWI ||||HgiCI* | | | |MaeII |Hpy178III* | BaeI ||||Acc65I | | | |AclI DdeI FokI |||Csp6I | | | BaeI ||NlaIV | | TaiI ||RsaI | | SetI ||SetI | PsiI |Cfr10I MnlI HpaII KpnI Y T D F H L D F A G T S V Y Y N V I S G I R I F I W I L P V P L F I I T L S Q D Y G F S F G F C R Y L C L L * R Y L R T ----:----|----:----|----:----|----:----|----:----|----:----| * V S K * K S K A P V E T * * L T I E P K Y P N E N P N Q R Y R Q K N Y R * R L I R I K M Q I K G T G R N I I V N D * S BspCNI |BseMII MboII SetI \\ \ \ CAGAAGAAGTTTTTATTATTTCCACCTACCCAATCAAACATAGATAAGTATATTGAGTGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTCTTCAAAAATAATAAAGGTGGATGGGTTAGTTTGTATCTATTCATATAACTCACC // / / |BseMII MboII SetI BspCNI Q K K F L L F P P T Q S N I D K Y I E W R R S F Y Y F H L P N Q T * I S I L S G E E V F I I S T Y P I K H R * V Y * V V ----:----|----:----|----:----|----:----|----:----|----:----| C F F N K N N G G V W D F M S L Y I S H V S S T K I I E V * G I L C L Y T Y Q T L L L K * * K W R G L * V Y I L I N L P MnlI |MnlI || BccI || SmlI MseI BbvII* || Hpy178III* BccI |AhaIII* | MboII SecI* || | HphI BseGI SfaNI \\ \ \ \ \\ \ \ \ \ TCTTTAAAAGAAGACCAAAATAGTGTTTTCCTCGGTGATATTCTTGAGGATGGTATTGCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATTTTCTTCTGGTTTTATCACAAAAGGAGCCACTATAAGAACTCCTACCATAACGC // / / // // / / / |MseI BbvII* | |MnlI || SmlI | BccI AhaIII* MboII | MnlI || BseGI SecI* |Hpy178III* |HphI BccI S L K E D Q N S V F L G D I L E D G I A L * K K T K I V F S S V I F L R M V L R F K R R P K * C F P R * Y S * G W Y C D ----:----|----:----|----:----|----:----|----:----|----:----| D K F S S W F L T K R P S I R S S P I A T K L L L G F Y H K G R H Y E Q P H Y Q R * F F V L I T N E E T I N K L I T N R AluI CviJI PvuII FatI FokI HphI TspDTI |CviAII | TspEI | TfiI NspBII* || CviRI* | Bce83I* BtgZI | HinfI | SetI || NlaIII \ \ \ \ \ \ \ \\ \ ATGGAATTAGATGCTGGTGATTTGTTTATGATTCCAGCTGGATATATTCATGCAGTTTAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAATCTACGACCACTAAACAAATACTAAGGTCGACCTATATAAGTACGTCAAATA / // / / / / / / / // | || TspEI BtgZI HphI | | NspBII* | |CviRI* | |FokI | | PvuII | |FatI | SfaNI | | CviJI | CviAII Bce83I* | | AluI NlaIII | TspDTI | SetI HinfI TfiI M E L D A G D L F M I P A G Y I H A V Y W N * M L V I C L * F Q L D I F M Q F I G I R C W * F V Y D S S W I Y S C S L Y ----:----|----:----|----:----|----:----|----:----|----:----| I S N S A P S K N I I G A P Y I * A T * S P I L H Q H N T * S E L Q I Y E H L K H F * I S T I Q K H N W S S I N M C N I MlyI PleI XcmI BsrI |BccI | AccI TspGWI |BsmAI | |Hpy166II | MseI || BsiYI* | ||HinfI MnlI FokI | | BseGI || | TsoI \ \\\ \ \ \ \ \ \\ \ \ ACACCAGTAGACTCTTTGGTATTTGGAGGCAACTTTTTAACCATCCGTGATTTGGAGACA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTCATCTGAGAAACCATAAACCTCCGTTGAAAAATTGGTAGGCACTAAACCTCTGT / // // / / / / // / // | || || | MnlI TspGWI BseGI || | |BsmAI | || || HinfI FokI MseI || | TsoI | || |AccI || BccI | || Hpy166II |BsiYI* | |PleI XcmI | MlyI BsrI T P V D S L V F G G N F L T I R D L E T H Q * T L W Y L E A T F * P S V I W R H T S R L F G I W R Q L F N H P * F G D T ----:----|----:----|----:----|----:----|----:----|----:----| V G T S E K T N P P L K K V M R S K S V Y V L L S K P I Q L C S K L W G H N P S C W Y V R Q Y K S A V K * G D T I Q L C MseI MseI |HpaI SetI SetI SetI |HindII NlaIV |MboII | TspEI TspEI |Hpy166II | MaeI ||Hpy178III* \ \ \ \\ \ \ \\\ CACCTTAAAATTGTGGAAATTGAAAAGTTAACAAAGGTTCCTAGAAGATTTACCTTCCCG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGAATTTTAACACCTTTAACTTTTCAATTGTTTCCAAGGATCTTCTAAATGGAAGGGC / / / / // / / / / / / SetI MseI TspEI TspEI || | | MaeI | | Hpy178III* || | NlaIV | MboII || SetI SetI |MseI Hpy166II HindII HpaI H L K I V E I E K L T K V P R R F T F P T L K L W K L K S * Q R F L E D L P S R P * N C G N * K V N K G S * K I Y L P E ----:----|----:----|----:----|----:----|----:----|----:----| C R L I T S I S F N V F T G L L N V K G V G * F Q P F Q F T L L P E * F I * R G V K F N H F N F L * C L N R S S K G E R Hin4II* | MboI | BclI | | DpnI Hin6I | | |BccI BcgI |GlaI | | |BstKTI | TspEI ||HhaI BcgI \ \ \\ \ \ \\\ \ AAGTTTGATCAAGTGATGGGTAAATTATGCGAGTATCTTGCGCTTGATAAAAATAAAATC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAACTAGTTCACTACCCATTTAATACGCTCATAGAACGCGAACTATTTTTATTTTAG / // / / / /// / | || BclI BcgI TspEI ||Hin6I BcgI | || MboI |GlaI | || BccI HhaI | |DpnI | BstKTI Hin4II* K F D Q V M G K L C E Y L A L D K N K I S L I K * W V N Y A S I L R L I K I K S V * S S D G * I M R V S C A * * K * N H ----:----|----:----|----:----|----:----|----:----|----:----| F N S * T I P L N H S Y R A S S L F L I S T Q D L S P Y I I R T D Q A Q Y F Y F L K I L H H T F * A L I K R K I F I F D PfoI BssKI EcoRII | ScrFI | BseBI | | AsuI* | | AvaII | | |BmgT120I | | || TspEI | | || | Hin6I | | || | |GlaI | | || | |MstI* | | || | ||HhaI SpeI | | || | |||TspEI |MaeI BccI TspRI | | || | |||| TspDTI \\ \ \ \ \ \\ \ \\\\ \ ACTAGTGATGTCAGTGATGGGGATTTGCTTTCCAGGACCACTAATTGCGCAATTCAATCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCACTACAGTCACTACCCCTAAACGAAAGGTCCTGGTGATTAACGCGTTAAGTTAGT // / / / /// ///// / || | BccI | ||AvaII ||||| TspEI || TspRI | ||AsuI* ||||TspDTI |SpeI | |BmgT120I |||Hin6I MaeI | EcoRII ||MstI* | BssKI ||GlaI | PfoI |HhaI BseBI TspEI ScrFI T S D V S D G D L L S R T T N C A I Q S L V M S V M G I C F P G P L I A Q F N H * * C Q * W G F A F Q D H * L R N S I T ----:----|----:----|----:----|----:----|----:----|----:----| V L S T L S P S K S E L V V L Q A I * D * * H H * H H P N A K W S W * N R L E I S T I D T I P I Q K G P G S I A C N L * FatI |CviAII || CviRI* || NlaIII SetI CviJI || | EcoT22I BceAI | MseI || | | MaeII | MseI | |Eco57I || | | | SetI | | TatI | |Eco57MI || | | | TaiI | | |Csp6I | ||ApoI || | | | | PsiI | | ||RsaI | ||TspEI \\ \ \ \ \ \ \ \ \\\ \ \\\ CTTCATGCATACGTTATAAAACCTGAAGTTAAGTACAAGCCGTTAAATTTCACTTCAAAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTACGTATGCAATATTTTGGACTTCAATTCATGTTCGGCAATTTAAAGTGAAGTTTC / /// / / / / / / /// / / / / | ||| | | | SetI | | ||| | | | TspEI | ||| | | PsiI | | ||| | | | ApoI | ||| | MaeII | | ||| | | MseI | ||| TaiI | | ||| | Eco57MI | ||| SetI | | ||| | Eco57I | ||CviRI* | | ||| CviJI | ||FatI | | ||TatI | |CviAII | | |Csp6I | EcoT22I | | RsaI NlaIII | MseI BceAI L H A Y V I K P E V K Y K P L N F T S K F M H T L * N L K L S T S R * I S L Q R S C I R Y K T * S * V Q A V K F H F K E ----:----|----:----|----:----|----:----|----:----|----:----| S * A Y T I F G S T L Y L G N F K V E F V E H M R * L V Q L * T C A T L N * K L K M C V N Y F R F N L V L R * I E S * L HindIII | AluI | CviJI | | SetI | | | CviJI | | | | MboI | | | | | DpnI | | | | | |BstKTI \ \ \ \ \ \\ AAGCATTTAGCGAAAGCTTTAGCCGATCTTATTTCGTAA 1450 1460 1470 ----:----|----:----|----:----|----:---- TTCGTAAATCGCTTTCGAAATCGGCTAGAATAAAGCATT / / / / // / | | | | || MboI | | | | |DpnI | | | | BstKTI | | | CviJI | | HindIII | CviJI | AluI SetI K H L A K A L A D L I S * S I * R K L * P I L F R X A F S E S F S R S Y F V X ----:----|----:----|----:----|----:---- F C K A F A K A S R I E Y S A N L S L K L R D * K T L M * R F S * G I K N R L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AluI 3 AluBI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 2 BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 8 BtgZI 1 BtsI 2 Cac8I 3 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 8 CviKI-1 CviRI* 4 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 8 MalI EciI 1 Eco57I 3 AcuI Eco57MI 3 EcoRII 2 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 4 FauI 1 SmuI FokI 4 GlaI 3 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 4 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 4 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 2 KpnI 1 MaeI 3 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 1 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 1 SchI MnlI 12 MseI 8 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PfoI 1 PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PsiI 3 AanI PsrI 1 PstI 1 PvuII 1 RsaI 4 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 13 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 4 TaiI 4 TaqI 3 TaqII 1 TatI 1 TauI 2 TfiI 3 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 4 TscAI VspI 1 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BalI BamHI BarI BbvCI BbvI BciVI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsePI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI CauII* Cfr9I CfrI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FaqI FnuDII* FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* Hpy99I KasI Ksp632I* MauBI McrI* MfeI MluI MmeI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PflMI PmeI PpiI PpuMI PshAI PspOMI PspXI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TseI TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769