Restriction Map of YER046W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YER046W-A on chromosome V from coordinates 243700 to 244029.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.20547

BinI* | TaqI | ClaI | |MboI | || DpnI | || |BstKTI | || ||AciI | || ||| TstI | || ||| | ApaLI AluI | || ||| | | CviRI* CviJI | || ||| | | Hpy166II |MaeI | || ||| | | | SduI ||SetI | || ||| | | | BseSI ||| CviJI | || ||| | | | HgiAI* ||| |MaeI CviRI* | || ||| | | | | Tsp4CI* ||| || TstI \ \ \\ \\\ \ \ \ \ \ \\\ \\ \ ATGCAGAACATATTTTATCGATCCGCTTATGTGCACACAGTTTGTCCAGCTAGGCTAGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTCTTGTATAAAATAGCTAGGCGAATACACGTGTGTCAAACAGGTCGATCCGATCTT / / //// / / / / / / / / / / CviRI* | |||| AciI | | | Tsp4CI* | | | | MaeI | |||MboI | | ApaLI | | | CviJI | ||TstI | Hpy166II | | | TstI | |DpnI | CviRI* | | MaeI | BstKTI HgiAI* | CviJI | ClaI BseSI | AluI | TaqI SduI SetI BinI* M Q N I F Y R S A Y V H T V C P A R L E C R T Y F I D P L M C T Q F V Q L G * N A E H I L S I R L C A H S L S S * A R I ----:----|----:----|----:----|----:----|----:----|----:----| X C F M N * R D A * T C V T Q G A L S S X A S C I K D I R K H A C L K D L * A L H L V Y K I S G S I H V C N T W S P * F MslI |FatI |BspHI ||CviAII ||Hpy178III* ||| NlaIII ||| | BinI* SspI ||| | | SetI \ \\\ \ \ \ TATTATTTATTATTACCATTATTATTATATTATTATTATTATTATCATCATCATGAACCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATAAATAATAATGGTAATAATAATATAATAATAATAATAATAGTAGTAGTACTTGGA / // /// / SspI || ||| BinI* || ||SetI || |BspHI || |FatI || Hpy178III* || CviAII |NlaIII MslI Y Y L L L P L L L Y Y Y Y Y Y H H H E P I I Y Y Y H Y Y Y I I I I I I I I M N L L F I I T I I I I L L L L L S S S * T * ----:----|----:----|----:----|----:----|----:----|----:----| Y * K N N G N N N Y * * * * * * * * S G I N N I I V M I I I N N N N N D D D H V I I * * * W * * * I I I I I I M M M F R BciVI MboI |BssKI | DpnI |EcoRII | |BstKTI ||SecI* | || TspDTI Csp6I |||ScrFI | || Hpy188I |RsaI |||BseBI | || |TspEI CviJI ||TspGWI |||| MnlI \ \\ \\ \ \\\ \\\\ \ GATGATCCGAATTGTGAAGCCCACTTTTCGTACTTCACTAATCCGTCCTGGGATACAGAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAGGCTTAACACTTCGGGTGAAAAGCATGAAGTGATTAGGCAGGACCCTATGTCTC //// / / /// / /// |||| TspEI CviJI ||Csp6I | ||EcoRII |||Hpy188I |RsaI | ||BssKI |||MboI TspGWI | ||SecI* ||TspDTI | |MnlI |DpnI | BseBI BstKTI | ScrFI BciVI D D P N C E A H F S Y F T N P S W D T E M I R I V K P T F R T S L I R P G I Q R * S E L * S P L F V L H * S V L G Y R G ----:----|----:----|----:----|----:----|----:----|----:----| S S G F Q S A W K E Y K V L G D Q S V S Q H D S N H L G S K T S * * D T R P Y L I I R I T F G V K R V E S I R G P I C L StuI XcmI Tsp4CI* CviJI CviJI | MseI HaeIII \ \ \ \ GGCTTGATATACACTAAACTGTTCTTAAAATCCACAAGGCCTATGGGTCTTATCATCTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAACTATATGTGATTTGACAAGAATTTTAGGTGTTCCGGATACCCAGAATAGTAGAGG / / / // CviJI Tsp4CI* MseI |HaeIII |CviJI |StuI XcmI G L I Y T K L F L K S T R P M G L I I S A * Y T L N C S * N P Q G L W V L S S P L D I H * T V L K I H K A Y G S Y H L P ----:----|----:----|----:----|----:----|----:----|----:----| P K I Y V L S N K F D V L G I P R I M E P S S I C * V T R L I W L A * P D * * R A Q Y V S F Q E * F G C P R H T K D D G FokI TaqII |AsuI* |Bsp120I ||AsuI* ||BmgT120I |||CviJI |||NlaIV |||HaeIII |||BmgT120I |||| FatI |||| NcoI |||| StyI |||| ApaI |||| SduI |||| SecI* |||| DsaI* |||| BseSI |||| HgiJII* |||| |CviAII MboI |||| || NlaIII BglII |||| || |TseI XhoII |||| || ||BisI MnlI | DpnI |||| || |||BlsI MwoI | HphI | |BstKTI |||| || ||||BseGI Hin4I \ \ \ \\ \\\\ \\ \\\\\ \ CTCTCTGTTTCTAATAACTTATCACCCAGATCTCGTAGTGGGCCCATGGCAGCATCCTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAGACAAAGATTATTGAATAGTGGGTCTAGAGCATCACCCGGGTACCGTCGTAGGAAG / / // / / / /// // //// / | HphI || | | | ||| || |||| MwoI MnlI || | | | ||| || |||Hin4I || | | | ||| || ||TseI || | | | ||| || |BisI || | | | ||| || BseGI || | | | ||| || BlsI || | | | ||| |DsaI* || | | | ||| |SecI* || | | | ||| |StyI || | | | ||| |NcoI || | | | ||| |FatI || | | | ||| CviAII || | | | ||Bsp120I || | | | ||NlaIII || | | | ||AsuI* || | | | |BmgT120I || | | | |AsuI* || | | | |FokI || | | | BmgT120I || | | | HaeIII || | | | NlaIV || | | | CviJI || | | HgiJII* || | | BseSI || | | SduI || | | ApaI || | TaqII || XhoII || BglII || MboI |DpnI BstKTI L S V S N N L S P R S R S G P M A A S F S L F L I T Y H P D L V V G P W Q H P S L C F * * L I T Q I S * W A H G S I L R ----:----|----:----|----:----|----:----|----:----|----:----| R E T E L L K D G L D R L P G M A A D K G R Q K * Y S I V W I E Y H A W P L M R E R N R I V * * G S R T T P G H C C G E BbvI SfaNI | Hin4II* | | MaeII | | | SetI Hpy178III* | | | TaiI | Hin4I \ \ \ \ \ \ GCTAAAGACGTTATATCACTTCCTGAATAG 310 320 330 ----:----|----:----|----:----| CGATTTCTGCAATATAGTGAAGGACTTATC / / / // | | MaeII |Hin4I | TaiI Hpy178III* | SetI Hin4II* SfaNI BbvI A K D V I S L P E * L K T L Y H F L N X * R R Y I T S * I X ----:----|----:----|----:----| A L S T I D S G S Y R * L R * I V E Q I S F V N Y * K R F L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 1 AluBI ApaI 1 ApaLI 1 Alw44I,VneI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BciVI 1 BfuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseSI 2 BaeGI,BstSLI Bsp120I 1 PspOMI BspHI 1 CciI,PagI,RcaI BssKI 1 BstSCI,StyD4I BstKTI 3 ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 6 CviKI-1 CviRI* 2 HpyCH4V DpnI 3 MalI DsaI* 1 BtgI,BstDSI EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FokI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 1 HpyAV HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 1 MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MnlI 2 MseI 1 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 3 SfaNI 1 LweI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 1 TaqII 1 TseI 1 ApeKI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApoI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BclI BdaI BetI* BfiI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI CspCI DdeI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiCI* HhaI Hin6I HindII HindIII HinfI HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI Ksp632I* MaeIII MauBI MboII McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TatI TauI TfiI TsoI Tsp45I TspMI TspRI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769