Restriction Map of PHM8/YER037W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHM8/YER037W on chromosome V from coordinates 225889 to 226854.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21910

TspEI \ ATGACTATCGCTAAAGATTACAGAACAATTTATAGAAACCAAATCAAAAAGCAGATACGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGATAGCGATTTCTAATGTCTTGTTAAATATCTTTGGTTTAGTTTTTCGTCTATGCT / TspEI M T I A K D Y R T I Y R N Q I K K Q I R * L S L K I T E Q F I E T K S K S R Y D D Y R * R L Q N N L * K P N Q K A D T T ----:----|----:----|----:----|----:----|----:----|----:----| X V I A L S * L V I * L F W I L F C I R X S * R * L N C F L K Y F G F * F A S V H S D S F I V S C N I S V L D F L L Y S MnlI TspEI | TaqI CviRI* | | BinI* | HindIII | | | SetI | | AluI | | | |MboI | | CviJI MaeI | | | |BamHI Hpy178III* | | | SetI | CviJI | | | |XhoII \ \ \ \ \ \ \ \ \ \ \\ CTAAATCAGGAGCATTTGCAAAGCTTGACACATCTAGGCTCACAAATCAATTTCGAGGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTAGTCCTCGTAAACGTTTCGAACTGTGTAGATCCGAGTGTTTAGTTAAAGCTCCAC / / / / / / / / / // | | | | HindIII | CviJI MnlI | |BinI* | | | CviJI MaeI | TaqI | | | AluI | SetI | | SetI TspEI | CviRI* Hpy178III* L N Q E H L Q S L T H L G S Q I N F E V * I R S I C K A * H I * A H K S I S R W K S G A F A K L D T S R L T N Q F R G G ----:----|----:----|----:----|----:----|----:----|----:----| S F * S C K C L K V C R P E C I L K S T V L D P A N A F S S V D L S V F * N R P * I L L M Q L A Q C M * A * L D I E L H DpnI NlaIV |BstKTI || BinI* || | TspEI || | | BinI* || | | |MnlI || | | ||BetI* || | | |||HpaII || | | |||| MboI || | | |||| BamHI || | | |||| XhoII || | | |||| |BinI* || | | |||| ||DpnI || | | |||| ||NlaIV || | | |||| |||BetI* || | | |||| |||BstKTI || | | |||| |||BspMII* || | | |||| ||||HpaII || | | |||| ||||Hpy178III* || | | |||| |||||BsaBI || | | |||| ||||||MboI || | | |||| ||||||BamHI || | | |||| ||||||XhoII || | | |||| ||||||| DpnI || | | |||| ||||||| NlaIV || | | |||| ||||||| BinI* || | | |||| ||||||| |BstKTI EcoRV || | | |||| ||||||| || BinI* | TaqI || | | |||| ||||||| || |TaqI | ClaI \\ \ \ \\\\ \\\\\\\ \\ \\ \ \ GATCCTCCCAAATTACCGGATCCGGATCCTGCTCGAAAAGTATTTTTCTTTGATATCGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGAGGGTTTAATGGCCTAGGCCTAGGACGAGCTTTTCATAAAAAGAAACTATAGCTA // / / // /// /////// / / / / || | | || ||| ||||||| | TaqI | ClaI || | | || ||| ||||||| BinI* | TaqI || | | || ||| ||||||XhoII EcoRV || | | || ||| ||||||BamHI || | | || ||| ||||||MboI || | | || ||| |||||BinI* || | | || ||| ||||NlaIV || | | || ||| ||||DpnI || | | || ||| |||BspMII* || | | || ||| |||BstKTI || | | || ||| |||BetI* || | | || ||| ||Hpy178III* || | | || ||| ||HpaII || | | || ||| |BsaBI || | | || ||| XhoII || | | || ||| BamHI || | | || ||| MboI || | | || ||NlaIV || | | || ||BinI* || | | || ||DpnI || | | || |BstKTI || | | || |BetI* || | | || HpaII || | | |TspEI || | | |BinI* || | | MnlI || | BinI* || XhoII || BamHI || MboI |NlaIV |DpnI BstKTI D P P K L P D P D P A R K V F F F D I D I L P N Y R I R I L L E K Y F S L I S I S S Q I T G S G S C S K S I F L * Y R * ----:----|----:----|----:----|----:----|----:----|----:----| S G G L N G S G S G A R F T N K K S I S P D E W I V P D P D Q E F L I K R Q Y R I R G F * R I R I R S S F Y K E K I D I Csp6I TatI |RsaI FatI Bsp1407I |SetI |CviAII |Csp6I || MfeI || CviRI* ApoI ||RsaI Hin4II* || TspEI || NlaIII TspEI \\\ \ \\ \ \\ \ \ AACACTTTGTACAGAAAATCTACGAAGGTACAATTGCTCATGCAACAATCATTATCAAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGAAACATGTCTTTTAGATGCTTCCATGTTAACGAGTACGTTGTTAGTAATAGTTTA /// / / // / / // ||| Hin4II* | || | | |CviRI* ||Bsp1407I | || | | |FatI ||TatI | || | | CviAII |Csp6I | || | NlaIII RsaI | || TspEI | || MfeI | |Csp6I | RsaI SetI N T L Y R K S T K V Q L L M Q Q S L S N T L C T E N L R R Y N C S C N N H Y Q I H F V Q K I Y E G T I A H A T I I I K F ----:----|----:----|----:----|----:----|----:----|----:----| L V K Y L F D V F T C N S M C C D N D F Y C K T C F I * S P V I A * A V I M I L V S Q V S F R R L Y L Q E H L L * * * I MseI TaqI |AhaIII* MnlI | TfiI || TspEI | Hpy99I | HinfI \\ \ \ \ \ \ TTCTTTAAATACGAATTGGGGTTTGACGACGATGAGGCAGAACGCCTAATCGAATCGTAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAAATTTATGCTTAACCCCAAACTGCTGCTACTCCGTCTTGCGGATTAGCTTAGCATA / // / / / / / | |MseI TspEI Hpy99I | | TstI | AhaIII* MnlI | HinfI TspEI | TfiI ApoI TaqI F F K Y E L G F D D D E A E R L I E S Y S L N T N W G L T T M R Q N A * S N R I L * I R I G V * R R * G R T P N R I V L ----:----|----:----|----:----|----:----|----:----|----:----| K K L Y S N P N S S S S A S R R I S D Y N R * I R I P T Q R R H P L V G L R I T E K F V F Q P K V V I L C F A * D F R I AcyI MaeII |ZraI Hpy178III* || SetI |TstI SetI || TaiI || TspGWI |MseI TstI TspEI || AatII \\ \ \\ \ \ \\ \ TATCAAGAATATGGATTATCCGTGAAAGGTTTAATAAAGAATAAACAAATTGATGACGTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTTCTTATACCTAATAGGCACTTTCCAAATTATTTCTTATTTGTTTAACTACTGCAG // / // / / // |TspGWI SetI |MseI | | |MaeII Hpy178III* TstI | | |AcyI | | ZraI | AatII | TaiI | SetI TspEI Y Q E Y G L S V K G L I K N K Q I D D V I K N M D Y P * K V * * R I N K L M T S S R I W I I R E R F N K E * T N * * R P ----:----|----:----|----:----|----:----|----:----|----:----| * * S Y P N D T F P K I F F L C I S S T N D L I H I I R S L N L L S Y V F Q H R I L F I S * G H F T * Y L I F L N I V D EcoP15I |MseI TaqI TfiI SetI ||AhaIII* TspDTI ClaI HinfI | CviRI* ||| CviJI \ \ \ \ \ \\\ \ CTACAATATAATACATTCATCGATGATTCCTTACCTTTGCAAGACTATTTAAAGCCTGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTTATATTATGTAAGTAGCTACTAAGGAATGGAAACGTTCTGATAAATTTCGGACTA / / / / / // / TspDTI ClaI | SetI CviRI* || CviJI TaqI HinfI |MseI TfiI AhaIII* EcoP15I L Q Y N T F I D D S L P L Q D Y L K P D Y N I I H S S M I P Y L C K T I * S L I T I * Y I H R * F L T F A R L F K A * L ----:----|----:----|----:----|----:----|----:----|----:----| R C Y L V N M S S E K G K C S * K F G S G V I Y Y M * R H N R V K A L S N L A Q * L I I C E D I I G * R Q L V I * L R I TseI AluI CviJI |BisI ||BlsI ||SetI ||| MboI ||| BclI ||| | DpnI ||| | |BstKTI ||| | |NmeAIII ||| | ||TspEI AluI ||| | ||| MseI CviJI ApoI BbvI MseI ||| | ||| |AhaIII* | SetI TspEI \ \ \\\ \ \\\ \\ \ \ \ TGGAAGTTAAGGGAGCTGCTGATCAATTTAAAGAAAAAGAAGCTCGGCAAATTTGACAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTCAATTCCCTCGACGACTAGTTAAATTTCTTTTTCTTCGAGCCGTTTAAACTGTTT / / / //// // / /// / / / | | | |||| || | ||MseI | CviJI TspEI | | | |||| || | |AhaIII* | AluI ApoI | | | |||| || | TspEI SetI | | | |||| || BclI | | | |||| || MboI | | | |||| |DpnI | | | |||| NmeAIII | | | |||| BstKTI | | | |||TseI | | | ||BisI | | | |BlsI | | | CviJI | | | AluI | | SetI | MseI BbvI W K L R E L L I N L K K K K L G K F D K G S * G S C * S I * R K R S S A N L T N E V K G A A D Q F K E K E A R Q I * Q T ----:----|----:----|----:----|----:----|----:----|----:----| Q F N L S S S I L K F F F F S P L N S L N S T L P A A S * N L S F S A R C I Q C P L * P L Q Q D I * L F L L E A F K V F FatI |CviAII || NlaIII || | Hpy188I CviJI Csp6I || | | BccI | Hpy166II |RsaI || | | | MseI SspI SetI \ \ \\ \\ \ \ \ \ \ \ CTATGGCTGTTTACAAACTCGTACAAAAATCATGCCATCAGATGTGTTAAAATATTAGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GATACCGACAAATGTTTGAGCATGTTTTTAGTACGGTAGTCTACACAATTTTATAATCCA / / // / // / / / / / | Hpy166II |Csp6I | |FatI | BccI | | SetI CviJI RsaI | | Hpy188I | SspI | CviAII MseI NlaIII L W L F T N S Y K N H A I R C V K I L G Y G C L Q T R T K I M P S D V L K Y * V M A V Y K L V Q K S C H Q M C * N I R Y ----:----|----:----|----:----|----:----|----:----|----:----| S H S N V F E Y L F * A M L H T L I N P V I A T * L S T C F D H W * I H * F I L * P Q K C V R V F I M G D S T N F Y * T TaqI |TspDTI || BccI MboI || | ApoI | DpnI || | TspEI | |BstKTI SetI BceAI MnlI || | EcoRI \ \\ \ \ \ \\ \ \ ATTGCTGATCTATTTGACGGCATAACCTATTGCCACTACGACAGACCCATCGAGGAAGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGACTAGATAAACTGCCGTATTGGATAACGGTGATGCTGTCTGGGTAGCTCCTTCTT // / / / / / / / || MboI SetI BceAI MnlI | | BccI |DpnI | TaqI BstKTI TspDTI I A D L F D G I T Y C H Y D R P I E E E L L I Y L T A * P I A T T T D P S R K N C * S I * R H N L L P L R Q T H R G R I ----:----|----:----|----:----|----:----|----:----|----:----| I A S R N S P M V * Q W * S L G M S S S Y Q Q D I Q R C L R N G S R C V W R P L N S I * K V A Y G I A V V V S G D L F F MboII |CviRI* || BinI* || Cac8I || | CviJI || | | MboI || | | XhoII || | | | DpnI AluI || | | | |MboII CviJI || | | | |BstKTI | SetI || | | | || ApoI TaqI | |TspEI || | | | || TspEI AsuII | || CviRI* TaqI \\ \ \ \ \\ \ \ \ \\ \ \ TTCATTTGCAAGCCAGATCCAAAATTCTTCGAAACAGCTAAATTGCAAAGTGGGTTGTCG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAAACGTTCGGTCTAGGTTTTAAGAAGCTTTGTCGATTTAACGTTTCACCCAACAGC / / / /// // / / / / / // / | | | ||| || XhoII | | | CviJI |CviRI* TaqI | | | ||| || MboI | | | AluI TspEI SetI | | | ||| |MboII | | SetI | | | ||| |DpnI | AsuII | | | ||| BstKTI | TaqI | | | ||CviJI TspEI | | | |BinI* ApoI | | | Cac8I | | CviRI* | MboII EcoRI TspEI ApoI F I C K P D P K F F E T A K L Q S G L S S F A S Q I Q N S S K Q L N C K V G C R H L Q A R S K I L R N S * I A K W V V E ----:----|----:----|----:----|----:----|----:----|----:----| N M Q L G S G F N K S V A L N C L P N D I * K C A L D L I R R F L * I A F H T T E N A L W I W F E E F C S F Q L T P Q R AciI BsrDI AluI | Hin6I CviJI | |GlaI | SetI | ||HhaI | | CviRI* | ||FnuDII* | | | BssKI | ||| MwoI | | | EcoRII | ||| | FatI | | | | ScrFI | ||| | |BccI | | | | BseBI | ||| | |CviAII \ \ \ \ \ \ \\\ \ \\ AGCTTTGCAAATGCCTGGTTTATTGATGACAACGAAAGCAATGTGCGGAGCGCGTTGAGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAAACGTTTACGGACCAAATAACTACTGTTGCTTTCGTTACACGCCTCGCGCAACTCG / / / / / / //// / | CviRI* | EcoRII | | |||MwoI NlaIII CviJI | BssKI | | ||FnuDII* AluI BseBI | | ||Hin6I ScrFI | | |GlaI | | HhaI | AciI BsrDI S F A N A W F I D D N E S N V R S A L S A L Q M P G L L M T T K A M C G A R * A L C K C L V Y * * Q R K Q C A E R V E H ----:----|----:----|----:----|----:----|----:----|----:----| L K A F A Q N I S S L S L L T R L A N L S S Q L H R T * Q H C R F C H A S R T S A K C I G P K N I V V F A I H P A R Q A NlaIII | AsuI* | |BmgT120I | ||CviJI | ||BseGI HinfI | ||HaeIII | Hpy188I | |||FatI | | PleI | ||||CviAII | | |MlyI | ||||| NlaIII | | || SspI |MslI ||||| | FokI MnlI | | || | MaeIII \\ \\\\\ \ \ \ \ \ \\ \ \ ATGGGGATGGGCCATGTTATCCATTTGATAGAGGATTACCAATATGAGTCAGAAAATATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCCTACCCGGTACAATAGGTAAACTATCTCCTAATGGTTATACTCAGTCTTTTATAA //// / // // // // / / |||MslI | || |FatI |MnlI || | SspI ||FatI | || CviAII FokI || PleI |CviAII | |NlaIII || MlyI BccI | |AsuI* |Hpy188I | BmgT120I HinfI | HaeIII | CviJI BseGI M G M G H V I H L I E D Y Q Y E S E N I W G W A M L S I * * R I T N M S Q K I L G D G P C Y P F D R G L P I * V R K Y C ----:----|----:----|----:----|----:----|----:----|----:----| M P I P W T I W K I S S * W Y S D S F I C P S P G H * G N S L P N G I H T L F Y H P H A M N D M Q Y L I V L I L * F I N DdeI | AsuI* | AvaII FalI EcoRV TfiI | |BmgT120I TspEI FalI | SmlI HinfI \ \\ \ \ \ \ \ GTTACTAAGGACCACAAAAATAAGCAACAATTTTCCATATTGAAAGATATCCTTGAGATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGATTCCTGGTGTTTTTATTCGTTGTTAAAAGGTATAACTTTCTATAGGAACTCTAA / / // / / / / / | | |AvaII | TspEI EcoRV | HinfI | | |AsuI* FalI | TfiI | | BmgT120I FalI SmlI | DdeI MaeIII V T K D H K N K Q Q F S I L K D I L E I L L R T T K I S N N F P Y * K I S L R F Y * G P Q K * A T I F H I E R Y P * D S ----:----|----:----|----:----|----:----|----:----|----:----| T V L S W L F L C C N E M N F S I R S I Q * * P G C F Y A V I K W I S L Y G Q S N S L V V F I L L L K G Y Q F I D K L N Bce83I* |MaeII || SetI Hpy166II FalI || TaiI | Tsp4CI* MmeI XcmI FalI || |FokI | | BseGI BccI |MnlI | Ksp632I* \ \\ \\ \ \ \ \ \\ \ \ CCATTGATAATGGACGTTGAAGTTTACCGTCCATCCTCTATTGCCATAAAGGAAATGGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAACTATTACCTGCAACTTCAAATGGCAGGTAGGAGATAACGGTATTTCCTTTACCTT / / / / / / / / / / / / / FalI | | MaeII | | | BseGI | | MnlI XcmI Ksp632I* FalI | TaiI | | Tsp4CI* | MmeI | SetI | Hpy166II BccI Bce83I* FokI P L I M D V E V Y R P S S I A I K E M E H * * W T L K F T V H P L L P * R K W K I D N G R * S L P S I L Y C H K G N G R ----:----|----:----|----:----|----:----|----:----|----:----| G N I I S T S T * R G D E I A M F S I S E M S L P R Q L K G D M R * Q W L P F P W Q Y H V N F N V T W G R N G Y L F H F Ksp632I* |MnlI HindII MboI || Hin4II* Hpy166II | DpnI || | MboII MboII | BsrI | |BstKTI \\ \ \ \ \ \ \ \\ GAGTTGGAAGAGGAAGGGGAAGCAGTCAACTGGTCAAATCAACAGATCAATGTTCAGTCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAACCTTCTCCTTCCCCTTCGTCAGTTGACCAGTTTAGTTGTCTAGTTACAAGTCAGT / // / / / / // / | || MboII MboII | BsrI || MboI | |Hin4II* Hpy166II |DpnI | Ksp632I* HindII BstKTI MnlI E L E E E G E A V N W S N Q Q I N V Q S S W K R K G K Q S T G Q I N R S M F S H V G R G R G S S Q L V K S T D Q C S V I ----:----|----:----|----:----|----:----|----:----|----:----| S N S S S P S A T L Q D F * C I L T * D L T P L P L P L L * S T L D V S * H E T L Q F L F P F C D V P * I L L D I N L * FatI BspHI |CviAII |Hpy178III* || NlaIII \\ \ TCATGA ----:- AGTACT / // | |BspHI | |FatI | Hpy178III* | CviAII NlaIII S * H X M X ----:- D H M M * S # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 3 DraI AluI 5 AluBI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BamHI 3 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BetI* 2 BsaWI BinI* 7 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI Bsp1407I 1 BsrGI,BstAUI BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 7 Cac8I 1 BstC8I ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 5 CviJI 10 CviKI-1 CviRI* 6 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 7 MalI EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FalI 2 FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 4 HpaII 2 HapII,BsiSI,MspI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 2 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 7 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NmeAIII 1 PleI 1 PpsI RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 13 SmlI 1 SmoI SspI 2 TaiI 2 TaqI 8 TatI 1 TfiI 3 PfeI TseI 1 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 XcmI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BarI BbvCI BbvII* BcgI BciVI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I BspCNI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* Hin4I HpaI HphI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TauI TsoI Tsp45I TspMI TspRI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769