Restriction Map of GPA2/YER020W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GPA2/YER020W on chromosome V from coordinates 195168 to 196517.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30723

MboII | BsmAI | Eco31I AciI | |Hin6I | Cac8I | ||GlaI TseI Hpy178III* | | Hin6I | ||MstI* Hpy188I |BisI | BbvI | | |GlaI | |||HhaI |SfaNI ||BlsI | |BceAI | | |Eco47III \ \\\\ \\ \\\ \ \\ \ \ \\ ATGGGTCTCTGCGCATCTTCAGAAAAGAACGGCAGCACTCCTGACACGCAGACCGCCAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCAGAGACGCGTAGAAGTCTTTTCTTGCCGTCGTGAGGACTGTGCGTCTGGCGGTCG / //// / / /// / // / //// | |||| | SfaNI ||TseI | |BbvI | |||Eco47III | |||| Hpy188I |BisI | BceAI | |||GlaI | |||Eco31I BlsI Hpy178III* | ||HhaI | |||BsmAI | |HaeII | ||Hin6I | Cac8I | |MstI* AciI | |GlaI | HhaI MboII M G L C A S S E K N G S T P D T Q T A S W V S A H L Q K R T A A L L T R R P P A G S L R I F R K E R Q H S * H A D R Q R ----:----|----:----|----:----|----:----|----:----|----:----| X P R Q A D E S F F P L V G S V C V A L X P D R R M K L F S R C C E Q C A S R W H T E A C R * F L V A A S R V R L G G A Acc65I HgiCI* AclI |Csp6I HhaI MaeII ||RsaI NlaIV |HaeII | SetI ||SetI |CviJI || MaeIII | TaiI ||NlaIV || BdaI || Tsp45I | | Hin4II* ||| KpnI || BdaI Tsp4CI* \\ \ \ \ \ \\\ \ \\ \ \ GCTGGTAGTGACAACGTTGGCAAAGCGAAGGTACCACCAAAGCAGGAGCCACAGAAGACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCATCACTGTTGCAACCGTTTCGCTTCCATGGTGGTTTCGTCCTCGGTGTCTTCTGA / // / / / / /// /// / Hin6I || | Hin4II* | | ||HgiCI* ||BdaI Tsp4CI* || MaeII | | ||Acc65I ||BdaI || AclI | | |Csp6I |CviJI |TaiI | | NlaIV NlaIV |SetI | | RsaI Tsp45I | KpnI MaeIII SetI A G S D N V G K A K V P P K Q E P Q K T L V V T T L A K R R Y H Q S R S H R R L W * * Q R W Q S E G T T K A G A T E D C ----:----|----:----|----:----|----:----|----:----|----:----| A P L S L T P L A F T G G F C S G C F V R Q Y H C R Q C L S P V V L A P A V S S S T T V V N A F R L Y W W L L L W L L S TseI |BisI ||BlsI |||TseI ||||BisI |||||BlsI ||||||TseI BbvII* ||||||MwoI | MboII |||||||BisI | | Tsp4CI* ||||||||BlsI | | | HindII BdaI MnlI |||||||||CviJI | | | Hpy166II BdaI | BceAI |||||||||| BbvI \ \ \ \ \ \ \ \\\\\\\\\\ \ GTGAGAACAGTCAACACAGCAAATCAACAAGAAAAGCAACAACAGAGGCAGCAGCAGCCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CACTCTTGTCAGTTGTGTCGTTTAGTTGTTCTTTTCGTTGTTGTCTCCGTCGTCGTCGGC / / / / / / ///////// / | | Hpy166II BdaI MnlI | ||||||||| MwoI | | HindII BdaI | ||||||||CviJI | Tsp4CI* | ||||||||TseI BbvII* | |||||||BisI MboII | ||||||BlsI | |||||TseI | ||||BisI | |||BlsI | ||MwoI | ||TseI | |BisI | BlsI BceAI V R T V N T A N Q Q E K Q Q Q R Q Q Q P * E Q S T Q Q I N K K S N N R G S S S R E N S Q H S K S T R K A T T E A A A A V ----:----|----:----|----:----|----:----|----:----|----:----| T L V T L V A F * C S F C C C L C C C G Q S F L * C L L D V L F A V V S A A A A H S C D V C C I L L F L L L L P L L L R MseI MwoI | AsuI* BbvI | AvaII |AciI | |EcoP15I ||BsmAI | |BmgT120I ||Esp3I | || AciI MseI FnuDII* |||BbvI | || |EcoP15I VspI | EcoRV \\\\ \ \\ \\ \ \ \ TCTCCGCATAATGTTAAGGACCGCAAGGAGCAAAACGGGAGCATTAATAACGCGATATCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGCGTATTACAATTCCTGGCGTTCCTCGTTTTGCCCTCGTAATTATTGCGCTATAGA / // // / // // / / / | || |BbvI | || |EcoP15I VspI | EcoRV | || Esp3I | || AciI MseI FnuDII* | || BsmAI | |EcoP15I | |BbvI | |AvaII | AciI | |AsuI* BbvI | BmgT120I MseI S P H N V K D R K E Q N G S I N N A I S L R I M L R T A R S K T G A L I T R Y L S A * C * G P Q G A K R E H * * R D I S ----:----|----:----|----:----|----:----|----:----|----:----| D G C L T L S R L S C F P L M L L A I D T E A Y H * P G C P A F R S C * Y R S I R R M I N L V A L L L V P A N I V R Y R BceAI | AciI | | MboI | | |BceAI | | ||DpnI | | |||BstKTI | | |||| BinI* | | |||| | MboI | | |||| | | DpnI | | |||| | | |BstKTI | | |||| | | || MlyI | | |||| | | || PleI | | |||| | | || BsaBI | | |||| | | || | TaqI | | |||| | | || | | HinfI | | |||| | | || | | BseMII SecI* | | |||| | | || | | |BspCNI DsaI* | | |||| | | || | | || BsmAI | CviJI | | |||| | | || | | || | DdeI \ \ \ \ \\\\ \ \ \\ \ \ \\ \ \ CCCACGGCTACGGCAAATACAAGCGGATCGCAACAGATCAATATCGACTCTGCCCTGAGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGCCGATGCCGTTTATGTTCGCCTAGCGTTGTCTAGTTATAGCTGAGACGGGACTCT // / ///// / // /// /// / // |CviJI | ||||MboI | || ||| ||| HinfI |DdeI DsaI* | |||BceAI | || ||| ||TaqI BsmAI SecI* | ||DpnI | || ||| |BspCNI | |BstKTI | || ||| BseMII | AciI | || ||PleI BceAI | || |BsaBI | || |MlyI | || MboI | |DpnI | BstKTI BinI* P T A T A N T S G S Q Q I N I D S A L R P R L R Q I Q A D R N R S I S T L P * E H G Y G K Y K R I A T D Q Y R L C P E R ----:----|----:----|----:----|----:----|----:----|----:----| G V A V A F V L P D C C I L I S E A R L E W P * P L Y L R I A V S * Y R S Q G S G R S R C I C A S R L L D I D V R G Q S TaqI SetI | MaeIII | | AclI | | MaeII | | | MmeI | | | SetI | | | TaiI HgaI | | | | TseI | TseI | | | | CviRI* | |BisI | | | | |BisI BccI | |EcoP15I | | | | ||BlsI BbvI | Hpy188I | ||BlsI \ \ \ \ \\\ \ \ \ \ \\\ GACAGGTCGAGTAACGTTGCAGCACAACCATCATTGTCGGACGCTTCAAGTGGCAGCAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCCAGCTCATTGCAACGTCGTGTTGGTAGTAACAGCCTGCGAAGTTCACCGTCGTTG / / / // //// / // /// SetI | | || |||TseI | |Hpy188I ||EcoP15I | | || ||BisI | BccI ||TseI | | || |BlsI BbvI |BisI | | || CviRI* HgaI | | |MaeII BlsI | | |AclI | | MaeIII | | MmeI | TaiI | SetI TaqI D R S S N V A A Q P S L S D A S S G S N T G R V T L Q H N H H C R T L Q V A A T Q V E * R C S T T I I V G R F K W Q Q R ----:----|----:----|----:----|----:----|----:----|----:----| S L D L L T A A C G D N D S A E L P L L L C T S Y R Q L V V M M T P R K L H C C V P R T V N C C L W * Q R V S * T A A V HphI BseYI | SecI* | GsaI | DsaI* | HgiCI* | Hpy166II | | NlaIV | | Tsp4CI* | | |Cfr10I | | | TseI BbvI TaqII | | ||HpaII | | | CviRI* \ \ \ \ \\\ \ \ \ \ GACAAAGAACTGAAAGTGCTACTGCTGGGTGCCGGTGAAAGTGGTAAGTCCACGGTATTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTCTTGACTTTCACGATGACGACCCACGGCCACTTTCACCATTCAGGTGCCATAAC / / / / / / // / / // / BbvI TaqII | | | | |Cfr10I HphI | |DsaI* CviRI* | | | | HpaII | |SecI* | | | HgiCI* | Tsp4CI* | | NlaIV Hpy166II | BseYI GsaI D K E L K V L L L G A G E S G K S T V L T K N * K C Y C W V P V K V V S P R Y C Q R T E S A T A G C R * K W * V H G I A ----:----|----:----|----:----|----:----|----:----|----:----| S L S S F T S S S P A P S L P L D V T N R C L V S L A V A P H R H F H Y T W P I V F F Q F H * Q Q T G T F T T L G R Y Q TatI FokI |Csp6I BisI EcoP15I |TspEI ||RsaI |BlsI BbvI MboII | Cac8I || MseI |||BseGI \\ \ \ \ \ \\ \ \\\\ CAGCAGTTGAAGATTTTACACCAGAACGGGTTTAGCGAGCAGGAAATTAAAGAGTACATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTCAACTTCTAAAATGTGGTCTTGCCCAAATCGCTCGTCCTTTAATTTCTCATGTAG /// / / / / /// //// ||TseI | MboII | Cac8I ||MseI |||TatI |BisI BbvI EcoP15I |TspEI ||Csp6I BlsI FokI |RsaI BseGI Q Q L K I L H Q N G F S E Q E I K E Y I S S * R F Y T R T G L A S R K L K S T S A V E D F T P E R V * R A G N * R V H P ----:----|----:----|----:----|----:----|----:----|----:----| C C N F I K C W F P N L S C S I L S Y M A A T S S K V G S R T * R A P F * L T C L L Q L N * V L V P K A L L F N F L V D NlaIV | SetI | BseGI | | EcoNI MboI | | |BssKI | DpnI | | |EcoRII | |BstKTI | | ||BsiYI* | || Hpy188I | | |||ScrFI | || |TfiI TspEI | | |||BseBI | || |HinfI | FokI | | |||| MnlI \ \\ \\ \ \ \ \ \\\\ \ CCCTTGATCTATCAGAATCTATTGGAAATTGGCAGGAACCTCATCCAGGCGAGAACAAGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAACTAGATAGTCTTAGATAACCTTTAACCGTCCTTGGAGTAGGTCCGCTCTTGTTCC // / / / / / / / / / /// / || | | HinfI | FokI | | | | ||EcoRII SetI || | | TfiI TspEI | | | | ||BssKI || | Hpy188I | | | | |MnlI || MboI | | | | BseBI |DpnI | | | | ScrFI BstKTI | | | EcoNI | | BsiYI* | BseGI NlaIV SetI P L I Y Q N L L E I G R N L I Q A R T R P * S I R I Y W K L A G T S S R R E Q G L D L S E S I G N W Q E P H P G E N K V ----:----|----:----|----:----|----:----|----:----|----:----| G K I * * F R N S I P L F R M W A L V L G R S R D S D I P F Q C S G * G P S F L G Q D I L I * Q F N A P V E D L R S C P SetI |MseI || MaeII || | TstI || | |SetI || | |TaiI SetI || | ||HindII | TaqI || | ||Hpy166II | |Hpy178III* || | ||| NlaIV | || FatI || | ||| |BetI* TstI | || |CviAII || | ||| ||HpaII Hpy166II | HgaI | || || NlaIII \\ \ \\\ \\\ \ \ \ \ \\ \\ \ TTTAACGTCAACTTGGAACCGGAGTGTGAACTGACGCAACAAGACCTGTCGAGAACCATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGCAGTTGAACCTTGGCCTCACACTTGACTGCGTTGTTCTGGACAGCTCTTGGTAC / / / / / // / / / / // / // | | | | | |BetI* | TstI | | || | |FatI | | | | | HpaII Hpy166II | | || | CviAII | | | | NlaIV | | || NlaIII | | | Hpy166II | | |Hpy178III* | | | HindII | | TaqI | | MaeII | HgaI | MseI SetI | TaiI | SetI TstI F N V N L E P E C E L T Q Q D L S R T M L T S T W N R S V N * R N K T C R E P C * R Q L G T G V * T D A T R P V E N H V ----:----|----:----|----:----|----:----|----:----|----:----| N L T L K S G S H S S V C C S R D L V M T * R * S P V P T H V S A V L G T S F W K V D V Q F R L T F Q R L L V Q R S G H AsuI* |BmgT120I ||CviJI ||HaeIII ||| TspEI ||| | PfoI ||| | BssKI ||| | |BsiYI* ||| | ||HpaII ||| | ||ScrFI ||| | ||CauII* ||| | ||| FauI ||| | ||| | EcoRV ||| | ||| | | AciI ||| | ||| | | FnuDII* ||| | ||| | | | Cac8I TspDTI ||| | ||| | | | |MboII \ \\\ \ \\\ \ \ \ \\ TCCTATGAAATGCCCAATAACTACACGGGCCAATTCCCGGAAGATATCGCGGGCGTAATA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGGATACTTTACGGGTTATTGATGTGCCCGGTTAAGGGCCTTCTATAGCGCCCGCATTAT / // / / /// // / / TspDTI || | | ||| || | MboII || | | ||| || | Cac8I || | | ||| || | AciI || | | ||| || FnuDII* || | | ||| |EcoRV || | | ||| FauI || | | ||BssKI || | | ||PfoI || | | |HpaII || | | CauII* || | | ScrFI || | TspEI || BsiYI* |AsuI* BmgT120I HaeIII CviJI S Y E M P N N Y T G Q F P E D I A G V I P M K C P I T T R A N S R K I S R A * Y L * N A Q * L H G P I P G R Y R G R N I ----:----|----:----|----:----|----:----|----:----|----:----| D * S I G L L * V P W N G S S I A P T I T R H F A W Y S C P G I G P L Y R P R L G I F H G I V V R A L E R F I D R A Y Y MaeII | SetI | TaiI | | AsuI* AsuI* | | |BmgT120I |BmgT120I | | ||CviJI ||CviJI | | ||HaeIII MnlI ||HaeIII TaqI \ \ \\\ \ \\\ \ TCTACGTTGTGGGCCTTGCCCTCAACACAAGATTTAGTCAATGGGCCTAACGCATCGAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGCAACACCCGGAACGGGAGTTGTGTTCTAAATCAGTTACCCGGATTGCGTAGCTTC / / // / // / | MaeII |AsuI* MnlI |AsuI* TaqI TaiI BmgT120I BmgT120I SetI HaeIII HaeIII CviJI CviJI S T L W A L P S T Q D L V N G P N A S K L R C G P C P Q H K I * S M G L T H R S Y V V G L A L N T R F S Q W A * R I E V ----:----|----:----|----:----|----:----|----:----|----:----| D V N H A K G E V C S K T L P G L A D F I * T T P R A R L V L N L * H A * R M S R R Q P G Q G * C L I * D I P R V C R L BssKI EcoRII | ScrFI MlyI FatI | BseBI PleI |CviAII | | MboI |HinfI || HphI | | | DpnI || TaqI || NlaIII | | | |BstKTI MlyI || | HinfI || | ApoI | | | || BinI* SfaNI PleI || | TspDTI || | TspEI | | | || | TspEI \ \ \\ \ \ \\ \ \ \ \ \ \\ \ \ TTCTATCTAATGGACTCGACTCCTTACTTCATGGAAAATTTCACCAGGATCACTTCGCCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATAGATTACCTGAGCTGAGGAATGAAGTACCTTTTAAAGTGGTCCTAGTGAAGCGGG / // // / / / / // / / // / / | || || | | HinfI | |FatI TspEI | || MboI BinI* | || || | TaqI | CviAII ApoI | |DpnI | || || TspDTI | HphI | EcoRII | || || HinfI NlaIII | BstKTI | || |PleI | BssKI | || MlyI BseBI | |PleI ScrFI | MlyI SfaNI F Y L M D S T P Y F M E N F T R I T S P S I * W T R L L T S W K I S P G S L R P L S N G L D S L L H G K F H Q D H F A Q ----:----|----:----|----:----|----:----|----:----|----:----| N * R I S E V G * K M S F K V L I V E G T R D L P S S E K S * P F N * W S * K A E I * H V R S R V E H F I E G P D S R G MseI TaqII AcyI | BsmAI MaeII | |MboI EcoP15I | || DpnI |ZraI | || |TaqI || SetI BseYI | || |BstKTI || TaiI | GsaI | || ||Hpy178III* || AatII \ \ \ \\ \\\ \\ \ AATTACAGACCCACCCAGCAGGACATATTAAGATCGAGACAGATGACGTCAGGGATTTTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGTCTGGGTGGGTCGTCCTGTATAATTCTAGCTCTGTCTACTGCAGTCCCTAAAAA / / / / / ////// / // // TspEI | BseYI | | |||||| | |EcoP15I |MmeI GsaI | | |||||| | |MaeII Hin4I | | |||||| | |AcyI Hin4I | | |||||| | ZraI | | |||||| AatII | | |||||| TaiI | | |||||| SetI | | |||||Hpy178III* | | ||||TaqI | | |||MboI | | ||BsmAI | | |DpnI | | BstKTI | MseI TaqII N Y R P T Q Q D I L R S R Q M T S G I F I T D P P S R T Y * D R D R * R Q G F L L Q T H P A G H I K I E T D D V R D F * ----:----|----:----|----:----|----:----|----:----|----:----| L * L G V W C S M N L D L C I V D P I K W N C V W G A P C I L I S V S S T L S K I V S G G L L V Y * S R S L H R * P N K SfaNI |Hpy188I || EcoRV MmeI || | Hpy178III* | Hin4I || | | Hin4I MaeII | Hin4I || | | Hin4I |BtrI | Tth111I || | | CviRI* ||Hpy99I | | Tsp4CI* || | | | EcoT22I |||SetI | | | MslI || | | | | TaqII |||TaiI Hpy166II \ \ \ \ \\ \ \ \ \ \ \\\\ \ GACACCGTCATTGATATGGGGTCGGATATCAAGATGCATATTTACGACGTGGGTGGACAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGGCAGTAACTATACCCCAGCCTATAGTTCTACGTATAAATGCTGCACCCACCTGTC / / / / // / / / / / // / Tth111I MslI | | || | | TaqII | | |MaeII Hpy166II Tsp4CI* | | || | CviRI* | | BtrI | | || EcoT22I | TaiI | | |Hpy178III* | SetI | | Hin4I Hpy99I | | Hin4I | EcoRV | SfaNI Hpy188I D T V I D M G S D I K M H I Y D V G G Q T P S L I W G R I S R C I F T T W V D S H R H * Y G V G Y Q D A Y L R R G W T A ----:----|----:----|----:----|----:----|----:----|----:----| S V T M S I P D S I L I C I * S T P P C Q C R * Q Y P T P Y * S A Y K R R P H V V G D N I H P R I D L H M N V V H T S L Tth111I TspRI | MaeIII Hpy188I BciVI BtsI |TaqI | Tsp45I \ \ \ \\ \ \ CGTTCCGAAAGAAAAAAATGGATACACTGCTTCGACAATGTCACTCTGGTCATATTTTGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAGGCTTTCTTTTTTTACCTATGTGACGAAGCTGTTACAGTGAGACCAGTATAAAACG / / / / / / Hpy188I BciVI TspRI | | Tsp45I BtsI | | MaeIII | Tth111I TaqI R S E R K K W I H C F D N V T L V I F C V P K E K N G Y T A S T M S L W S Y F A F R K K K M D T L L R Q C H S G H I L R ----:----|----:----|----:----|----:----|----:----|----:----| R E S L F F H I C Q K S L T V R T M N Q A N R F F F I S V S S R C H * E P * I K T G F S F F P Y V A E V I D S Q D Y K A Hpy188I BccI | Csp6I | MnlI SetI | |RsaI | AlwNI HgaI | Hpy178III* \ \\ \ \ \ \ \ GTTTCTCTATCGGAGTACGACCAGACGCTGATGGAGGACAAGAACCAGAACAGGTTTCAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAGATAGCCTCATGCTGGTCTGCGACTACCTCCTGTTCTTGGTCTTGTCCAAAGTC / // /// / / / | |Csp6I ||MnlI HgaI SetI Hpy178III* | RsaI |BccI Hpy188I AlwNI V S L S E Y D Q T L M E D K N Q N R F Q F L Y R S T T R R * W R T R T R T G F R F S I G V R P D A D G G Q E P E Q V S G ----:----|----:----|----:----|----:----|----:----|----:----| T E R D S Y S W V S I S S L F W F L N * R K E I P T R G S A S P P C S G S C T E N R * R L V V L R Q H L V L V L V P K L BsePI Hin6I FnuDII* |GlaI ||HhaI ||Hin6I ||Cac8I ||FnuDII* |||GlaI HindII ||||HhaI Hpy166II ||||| MaeII | BccI ||||| |BtrI TfiI | | Tsp4CI* ||||| || SetI HinfI TaqI SspI | | | BcgI ||||| || TaiI \ \ \ \ \ \ \ \\\\\ \\ \ GAATCGCTGGTGCTTTTCGATAATATTGTCAACAGTAGATGGTTCGCGCGCACGTCTGTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGCGACCACGAAAAGCTATTATAACAGTTGTCATCTACCAAGCGCGCGTGCAGACAG / / / / / / ////// // HinfI TaqI SspI | | BcgI |||||| |MaeII TfiI | Tsp4CI* |||||| BtrI | BccI |||||TaiI Hpy166II |||||SetI HindII ||||BsePI ||||Hin6I |||GlaI ||FnuDII* ||Hin6I ||Cac8I ||HhaI |GlaI FnuDII* HhaI E S L V L F D N I V N S R W F A R T S V N R W C F S I I L S T V D G S R A R L S I A G A F R * Y C Q Q * M V R A H V C R ----:----|----:----|----:----|----:----|----:----|----:----| S D S T S K S L I T L L L H N A R V D T P I A P A K R Y Y Q * C Y I T R A C T Q F R Q H K E I I N D V T S P E R A R R D BcgI Csp6I |Hpy188I DdeI |RsaI || BcgI TaqI SetI | BcgI TspEI \\ \\ \ \ \ \ \ \ GTACTCTTTCTGAATAAAATCGACCTTTTTGCTGAAAAACTAAGCAAAGTGCCTATGGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CATGAGAAAGACTTATTTTAGCTGGAAAAACGACTTTTTGATTCGTTTCACGGATACCTT // / // / // || | |BcgI TaqI |DdeI || | Hpy188I SetI BcgI || BcgI |Csp6I RsaI V L F L N K I D L F A E K L S K V P M E Y S F * I K S T F L L K N * A K C L W K T L S E * N R P F C * K T K Q S A Y G K ----:----|----:----|----:----|----:----|----:----|----:----| T S K R F L I S R K A S F S L L T G I S R V R E S Y F R G K Q Q F V L C L A * P Y E K Q I F D V K K S F F * A F H R H F TseI CviJI |BisI ||BlsI ||| DdeI FauI ||| | TatI | SgrAI ||| | |Csp6I | Cfr10I ||| | ||RsaI | |HpaII BbvI ||| | ||| MnlI | || AciI Hpy188I ||| | ||| | Hpy178III* \ \\ \ \ \\\ \ \\\ \ \ AATTACTTCCCAGACTACACCGGCGGGTCAGACATCAACAAGGCTGCTAAGTACATACTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGAAGGGTCTGATGTGGCCGCCCAGTCTGTAGTTGTTCCGACGATTCATGTATGAG / / // / / / //// / //// TspEI | || | | BbvI |||| | |||MnlI | || | Hpy188I |||| | ||TatI | || AciI |||| | |Csp6I | |Cfr10I |||| | RsaI | |SgrAI |||| DdeI | HpaII |||TseI FauI ||BisI |BlsI CviJI N Y F P D Y T G G S D I N K A A K Y I L I T S Q T T P A G Q T S T R L L S T Y S L L P R L H R R V R H Q Q G C * V H T L ----:----|----:----|----:----|----:----|----:----|----:----| F * K G S * V P P D S M L L A A L Y M S F N S G L S C R R T L C * C P Q * T C V I V E W V V G A P * V D V L S S L V Y E MaeII |PmaCI |BsaAI GsuI |MaeIII Eco57MI |Tsp45I | TfiI || SetI | HinfI || TaiI CviJI SetI MseI | | DdeI || | MnlI HaeIII \ \ \ \ \ \\ \ \ \ TGGAGGTTTGTTCAGTTAAACAGGGCGAATCTAAGCATATATCCTCACGTGACACAGGCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTCCAAACAAGTCAATTTGTCCCGCTTAGATTCGTATATAGGAGTGCACTGTGTCCGG // // / / / // // / |SetI |Eco57MI | DdeI | || || HaeIII Hpy178III* |GsuI HinfI | || || CviJI MseI TfiI | || |Tsp45I | || |MaeIII | || MnlI | |MaeII | BsaAI | PmaCI TaiI SetI W R F V Q L N R A N L S I Y P H V T Q A G G L F S * T G R I * A Y I L T * H R P E V C S V K Q G E S K H I S S R D T G H ----:----|----:----|----:----|----:----|----:----|----:----| Q L N T * N F L A F R L M Y G * T V C A R S T Q E T L C P S D L C I D E R S V P P P K N L * V P R I * A Y I R V H C L G AflIII | MaeII | |BtrI | || TaqI AciI | || SetI BisI | || TaiI |BlsI BccI | || | Hpy99I ||TauI | TspEI \ \\ \ \ \\\ \ \ ACAGACACGTCGAATATAAGATTAGTATTTGCCGCCATCAAAGAAACAATTTTGGAAAAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTGTGCAGCTTATATTCTAATCATAAACGGCGGTAGTTTCTTTGTTAAAACCTTTTA //// / //// / / |||| TaqI |||AciI BccI TspEI |||AflIII ||BisI |||MaeII |BlsI ||BtrI TauI |Hpy99I TaiI SetI T D T S N I R L V F A A I K E T I L E N Q T R R I * D * Y L P P S K K Q F W K I R H V E Y K I S I C R H Q R N N F G K Y ----:----|----:----|----:----|----:----|----:----|----:----| V S V D F I L N T N A A M L S V I K S F W L C T S Y L I L I Q R W * L F L K P F C V R R I Y S * Y K G G D F F C N Q F I HinfI MlyI | Hpy178III* PleI | | MaeIII \ \ \ \ ACATTGAAAGACTCTGGAGTGTTACAATGA 1330 1340 1350 ----:----|----:----|----:----| TGTAACTTTCTGAGACCTCACAATGTTACT // / / / |PleI | | MaeIII MlyI | Hpy178III* HinfI T L K D S G V L Q * H * K T L E C Y N X I E R L W S V T M X ----:----|----:----|----:----| V N F S E P T N C H Y M S L S Q L T V I C Q F V R S H * L S # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AciI 7 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 BceAI 4 BcgI 2 BciVI 1 BfuI BdaI 2 BetI* 1 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 9 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 9 BmgT120I 4 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BsePI 1 BssHII,PauI BseYI 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 4 Alw26I,BstMAI BspCNI 1 BssKI 3 BstSCI,StyD4I BstKTI 5 BtrI 3 BmgBI,AjiI BtsI 1 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I Csp6I 5 CviQI,RsaNI CviAII 2 CviJI 8 CviKI-1 CviRI* 3 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 5 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 3 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 2 FauI 2 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 4 GsaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 4 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 1 HpyAV Hin6I 4 HinP1I,HspAI HindII 3 HincII HinfI 7 HpaII 4 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 8 Hpy99I 2 KpnI 1 MaeII 9 HpyCH4IV MaeIII 5 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 4 SchI MmeI 2 MnlI 6 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I PfoI 1 PleI 4 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI RsaI 5 AfaI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 17 SfaNI 3 LweI SgrAI 1 SspI 1 TaiI 9 TaqI 10 TaqII 3 TatI 2 TauI 1 TfiI 3 PfeI TseI 8 ApeKI Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 7 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 1 Tth111I 2 PflFI,PsyI,AspI VspI 1 PshBI,AseI ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AccI AflII AgeI AhaIII* AjuI AlfI AloI AluI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BclI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaXI BseRI BseSI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco57I EcoICRI EcoRI EgeI EheI EspI* FalI FaqI FseI FspAI HgiAI* HgiJII* HindIII HpaI KasI Ksp632I* MaeI MauBI McrI* MfeI MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TsoI TspGWI TspMI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769