Restriction Map of YEL045C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YEL045C on chromosome V from coordinates 69265 to 68840.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28222

EMBOSS_001 MaeIII Tsp45I | TstI | | FnuDII* | | | TspDTI | | | | AsuI* | | | | AvaII TspGWI BsiYI* | | | | |BmgT120I |BglI |BceAI | | | | ||NlaIV |MwoI Hpy99I |Hpy178III* \ \ \ \ \\\ \\ \ \\ ATGAAATGTCACGCGAAACGGACCCTTGCCTTTTTGGCGACGGCACTTCCCCTATCTGGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTACAGTGCGCTTTGCCTGGGAACGGAAAAACCGCTGCCGTGAAGGGGATAGACCT / /// // / / / / TstI ||TspDTI |AvaII | Hpy99I | Hpy178III* |FnuDII* |AsuI* TspGWI | BceAI Tsp45I BmgT120I MwoI BsiYI* MaeIII NlaIV BglI M K C H A K R T L A F L A T A L P L S G * N V T R N G P L P F W R R H F P Y L E E M S R E T D P C L F G D G T S P I W K ----:----|----:----|----:----|----:----|----:----|----:----| X F H * A F R V R A K K A V A S G R D P X S I D R S V S G Q R K P S P V E G I Q H F T V R F P G K G K Q R R C K G * R S BetI* |HpaII || BceAI || | BssKI || | BsiYI* || | |HpaII CviJI || | ||ScrFI | FatI || | ||CauII* | |MwoI || | ||| TseI | |CviAII || | ||| |BisI | ||Cac8I || | ||| |FalI | ||| SphI || | ||| |FalI | ||| NspI || | ||| ||BlsI | ||| CviRI* || | ||| |||TseI | ||| NlaIII HindIII || | ||| ||||BisI | ||| | Csp6I |NmeAIII || | ||| |||||BlsI | ||| | |FalI ||AluI || | ||| ||||||Hin6I | ||| | |FalI ||CviJI || | ||| |||||||GlaI | ||| | |RsaI ||| SetI || | ||| ||||||||HhaI \ \\\ \ \\ \\\ \ \\ \ \\\ \\\\\\\\\ AAAAGCCGAGCATGCACCCGTACCCCACAAAGCTTCGCTTCCGGTTTCCGGGCAGCAGCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGGCTCGTACGTGGGCATGGGGTGTTTCGAAGCGAAGGCCAAAGGCCCGTCGTCGC / / / /// / // // / / // // / ///////// | | | ||| FalI |Csp6I || | HindIII || || | ||||||||Hin6I | | | ||| FalI RsaI || CviJI || || | |||||||GlaI | | | ||CviRI* || AluI || || | ||||||TseI | | | ||FatI |SetI || || | ||||||HhaI | | | |CviAII NmeAIII || || | |||||HaeII | | | Cac8I || || | |||||BisI | | NlaIII || || | ||||BlsI | | NspI || || | |||TseI | | SphI || || | ||BisI | MwoI || || | |BlsI CviJI || || | BssKI || || CauII* || || HpaII || || ScrFI || |FalI || |FalI || BceAI |BsiYI* |BetI* HpaII K S R A C T R T P Q S F A S G F R A A A K A E H A P V P H K A S L P V S G Q Q R K P S M H P Y P T K L R F R F P G S S A ----:----|----:----|----:----|----:----|----:----|----:----| F L R A H V R V G C L K A E P K R A A A F F G L M C G Y G V F S R K R N G P L L F A S C A G T G W L A E S G T E P C C R AciI | TseI | NspBII* BsrDI | |BisI | Hin6I HaeII | ||BlsI | |GlaI | BbvI | ||| FauI | |MstI* | | BbvI | ||| |EcoP15I | ||HhaI \ \ \ \ \\\ \\ \ \\\ CCGTTTCTTTTTTCCCGCTGCTTCGCCCTTTGTATTACTCATTGCGCACTTTTTCACTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAAAGAAAAAAGGGCGACGAAGCGGGAAACATAATGAGTAACGCGTGAAAAAGTGAAC / / //// // / /// | BbvI |||| |EcoP15I BsrDI ||Hin6I BbvI |||| FauI |MstI* |||TseI |GlaI ||BisI HhaI |BlsI NspBII* AciI P F L F S R C F A L C I T H C A L F H L R F F F P A A S P F V L L I A H F F T C V S F F P L L R P L Y Y S L R T F S L A ----:----|----:----|----:----|----:----|----:----|----:----| G N R K E R Q K A R Q I V * Q A S K * K A T E K K G S S R G K Y * E N R V K E S R K K K G A A E G K T N S M A C K K V Q Hpy166II | AgeI | BetI* | Cfr10I HphI | |HpaII MboII MboII \ \ \\ \ \ CCATATTCGTTCACCGGTTTTTCTTTTTATTTCTTCGTCTTTTTTCGTCTTTTTCTTCAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGTATAAGCAAGTGGCCAAAAAGAAAAATAAAGAAGCAGAAAAAAGCAGAAAAAGAAGTG / / // / / / HphI | || MboII MboII TspRI | |Cfr10I | |BetI* | |AgeI | HpaII Hpy166II P Y S F T G F S F Y F F V F F R L F L H H I R S P V F L F I S S S F F V F F F T I F V H R F F F L F L R L F S S F S S L ----:----|----:----|----:----|----:----|----:----|----:----| G Y E N V P K E K * K K T K K R R K R * A M N T * R N K K K N R R R K E D K E E W I R E G T K R K I E E D K K T K K K V NdeI BsrI CviRI* |OliI TspRI | CviRI* |MslI \ \ \ \\ TGGATATACGCTTTTTGCATTTGCAATAGCACATATGTGTATATATATAAGCAAGTGTTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTATATGCGAAAAACGTAAACGTTATCGTGTATACACATATATATATTCGTTCACAAC / / / // / BsrI | CviRI* |NdeI SetI CviRI* MslI OliI W I Y A F C I C N S T Y V Y I Y K Q V L G Y T L F A F A I A H M C I Y I S K C * D I R F L H L Q * H I C V Y I * A S V E ----:----|----:----|----:----|----:----|----:----|----:----| Q I Y A K Q M Q L L V Y T Y I Y L C T N S S I R K K C K C Y C M H T Y I Y A L T P Y V S K A N A I A C I H I Y I L L H Q AluI FatI CviJI |CviAII | SetI || NlaIII | Cac8I || | MnlI Hin4II* \ \ \\ \ \ \ AGCTTGCCTGTCAAATCCTCCATGTGTCCTTCTCGTCTATCTTGTTCTGTCTGGTATAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAACGGACAGTTTAGGAGGTACACAGGAAGAGCAGATAGAACAAGACAGACCATATCT / / / // / / | Cac8I | || MnlI Hin4II* CviJI | |FatI AluI | CviAII NlaIII S L P V K S S M C P S R L S C S V W Y R A C L S N P P C V L L V Y L V L S G I E L A C Q I L H V S F S S I L F C L V * S ----:----|----:----|----:----|----:----|----:----|----:----| L K G T L D E M H G E R R D Q E T Q Y L S S A Q * I R W T D K E D I K N Q R T Y A Q R D F G G H T R R T * R T R D P I S MaeII |BsaAI AciI |SnaBI | NspBII* ||Csp6I | | Cac8I |||RsaI | | | CviJI |||SetI | | | |MaeI |||TaiI | | | || TstI |||| TsoI | | | || | MaeIII SetI \\\\ \ \ \ \ \\ \ \ \ GTAATACTTACATACATATACGTACATTGTTTCCGCTGGCTAGTTCGTAACCACCTCCTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CATTATGAATGTATGTATATGCATGTAACAAAGGCGACCGATCAAGCATTGGTGGAGGAA / ///// / /// / // | ||||TsoI | ||| MaeI |SetI | |||Csp6I | ||CviJI MaeIII | ||RsaI | |TstI | |MaeII | Cac8I | SnaBI NspBII* | BsaAI AciI TaiI SetI V I L T Y I Y V H C F R W L V R N H L L * Y L H T Y T Y I V S A G * F V T T S F N T Y I H I R T L F P L A S S * P P P F ----:----|----:----|----:----|----:----|----:----|----:----| T I S V Y M Y T C Q K R Q S T R L W R R L L V * M C I R V N N G S A L E Y G G G Y Y K C V Y V Y M T E A P * N T V V E K MaeI |MnlI |TsoI \\ TCCTAG ----:- AGGATC // / || MaeI |MnlI TsoI S * P X L X ----:- E * K R G L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 2 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BceAI 2 BetI* 2 BsaWI BglI 1 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 4 CviKI-1 CviRI* 3 HpyCH4V EcoP15I 1 FalI 2 FatI 2 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 2 HaeII 1 BstH2I HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III Hpy99I 1 MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboII 2 MnlI 2 MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 4 SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI TaiI 1 TseI 3 ApeKI TsoI 2 Tsp45I 1 NmuCI TspDTI 1 TspGWI 1 TspRI 1 TscAI TstI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BfiI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cfr9I CfrI ClaI CspCI DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FokI FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4I HindII HinfI HpaI Hpy188I KasI KpnI Ksp632I* MauBI MboI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MseI MvaI NaeI NarI NcoI NgoMIV NheI NotI NruI NsiI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqI TaqII TatI TauI TfiI Tsp4CI* TspEI TspMI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769