Sequence for a region of GDA1/YEL042W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GDA1/YEL042W on chromosome V from coordinates 73771 to 75327.

This is the genomic DNA sequence and may contain untranslated regions or bases (e. g. introns, or the site of a programmed translational frameshift). For a version of the sequence that does not contain these untranslated sequence region(s), please go back and select the coding sequence option.

Other Formats Available: GCG

>YEL042W  Chr 5  
ATGGCGCCCATCTTTAGAAATTACCGGTTCGCTATCGGTGCTTTTGCCGTTATTATGCTC
ATTTTGTTGATTAAAACATCTTCCATCGGTCCACCTTCTATTGCACGTACAGTTACTCCT
AATGCTAGTATTCCCAAAACTCCGGAGGACATCTCTATCTTGCCCGTCAATGATGAACCA
GGTTACCTTCAAGATTCGAAGACTGAACAAAACTATCCTGAGCTTGCCGATGCTGTGAAG
TCACAAACAAGTCAAACATGCAGCGAAGAACATAAGTATGTTATCATGATCGATGCCGGC
TCTACCGGTTCCCGAGTACATATATACAAGTTTGACGTCTGTACTTCCCCACCTACATTA
CTTGATGAAAAATTCGACATGTTAGAGCCTGGTTTATCTTCTTTCGATACCGATTCCGTT
GGTGCCGCTAACTCCCTTGACCCATTACTGAAAGTAGCAATGAACTATGTCCCTATTAAG
GCAAGAAGTTGTACTCCCGTTGCGGTGAAAGCTACTGCAGGCCTAAGACTCTTGGGTGAT
GCCAAATCTTCAAAAATTTTGAGCGCTGTAAGGGATCATTTGGAGAAGGACTATCCTTTC
CCAGTTGTCGAAGGTGATGGTGTTTCCATCATGGGCGGTGATGAAGAAGGTGTCTTCGCC
TGGATTACTACAAACTACCTATTAGGTAATATCGGTGCTAATGGCCCCAAGTTACCTACT
GCTGCCGTTTTTGACTTAGGCGGAGGGTCTACACAAATTGTTTTTGAGCCTACTTTCCCA
ATAAATGAAAAAATGGTCGATGGTGAGCATAAATTTGATTTGAAGTTTGGTGATGAAAAT
TACACCTTGTACCAATTTTCTCATCTAGGTTACGGTTTGAAGGAAGGAAGAAATAAAGTT
AACTCTGTTCTTGTGGAAAATGCATTAAAAGACGGCAAAATATTGAAGGGTGATAACACT
AAGACTCATCAATTGTCATCTCCATGCCTACCGCCTAAAGTTAATGCCACAAATGAAAAG
GTTACATTAGAATCCAAGGAAACTTATACCATTGACTTTATAGGGCCGGACGAGCCAAGT
GGTGCACAATGTAGATTTCTGACTGATGAAATTTTGAATAAAGATGCTCAGTGCCAGTCT
CCACCATGCTCTTTCAATGGGGTTCACCAACCTTCTTTAGTTCGTACATTCAAAGAATCG
AACGATATCTATATTTTCTCTTATTTCTACGACAGAACCCGTCCATTGGGTATGCCCTTG
TCCTTTACTTTGAATGAATTGAACGATTTGGCAAGAATAGTGTGTAAAGGCGAAGAAACT
TGGAATAGTGTCTTCAGTGGCATTGCGGGGTCCCTAGATGAATTGGAAAGTGACTCGCAC
TTCTGTTTGGACTTATCTTTTCAAGTGTCCTTATTACATACGGGATATGACATTCCATTA
CAAAGAGAATTGAGAACTGGAAAGAAAATTGCCAATAAAGAAATCGGTTGGTGTTTAGGT
GCGTCATTACCATTGTTGAAAGCTGATAACTGGAAATGTAAAATTCAATCAGCTTGA