Restriction Map of URA3/YEL021W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

URA3/YEL021W on chromosome V from coordinates 116167 to 116970.


FokI |MaeII || SetI AluI || TaiI CviJI || |TseI BseGI TseI | SetI || ||BisI | BbvI |BisI AluI TaqI | | BbvI || |||BlsI | | MaeI ||BlsI CviJI \ \ \ \ \\ \\\\ \ \ \ \\\ \ ATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCTTTCGATGTATATTCCTTGCACGACGATGAGTAGGATCAGGACAACGACGGTTC / / / / / // /// / / /// / / | | CviJI | | || ||| BseGI MaeI ||| | CviJI | | AluI | | || ||TseI BbvI ||| | AluI | SetI | | || |BisI ||| SetI TaqI | | || BlsI ||TseI | | |FokI |BisI | | MaeII BlsI | TaiI | SetI BbvI M S K A T Y K E R A A T H P S P V A A K C R K L H I R N V L L L I L V L L L P S V E S Y I * G T C C Y S S * S C C C Q A ----:----|----:----|----:----|----:----|----:----|----:----| X D F A V Y L S R A A V * G L G T A A L X T S L * M Y P V H Q * E D * D Q Q Q W H R F S C I L F T S S S M R T R N S G L FatI |CviAII || CviRI* BseGI SetI || NlaIII | Csp6I | MseI || | MwoI TspDTI | |RsaI \ \ \\ \ \ \ \ \\ CTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAATTATAGTACGTGCTTTTCGTTTGTTTGAACACACGAAGTAACCTACAAGCATGG / / // / / / // | | || MwoI TspDTI | |Csp6I | | |CviRI* | RsaI | | |FatI BseGI | | CviAII | NlaIII MseI L F N I M H E K Q T N L C A S L D V R T Y L I S C T K S K Q T C V L H W M F V P I * Y H A R K A N K L V C F I G C S Y H ----:----|----:----|----:----|----:----|----:----|----:----| S N L I M C S F C V F K H A E N S T R V A I * Y * A R F A F L S T H K M P H E Y * K I D H V F L L C V Q T S * Q I N T G GsuI AsuI* AvaII DraII PpuMI Eco57MI FokI |BmgT120I |StyI ||SetI |SecI* ||NlaIV FatI || TspEI BsrI ||| ApoI AflIII || | XcmI | BslFI ||| TspEI Hpy166II BspLU11I* \\ \ \ \ \ \\\ \ \ \ ACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCCTTAATGACCTCAATCAACTTCGTAATCCAGGGTTTTAAACAAATGATTTTTGT // / / / / / // / / / || | | BsrI BslFI | |PpuMI | Hpy166II NlaIII || | TspEI | |DraII TspEI NspI || XcmI | |AvaII ApoI |SecI* | |AsuI* |StyI | BmgT120I FokI | NlaIV Eco57MI GsuI SetI T K E L L E L V E A L G P K I C L L K T P R N Y W S * L K H * V P K F V Y * K H Q G I T G V S * S I R S Q N L F T K N T ----:----|----:----|----:----|----:----|----:----|----:----| V L S N S S N T S A N P G L I Q K S F V W W P I V P T L Q L M L D W F K N V L F G L F * Q L * N F C * T G F N T * * F C SduI BseSI MnlI | Tsp4CI* | FatI | | MseI | NcoI | | | CviJI CviAII | StyI | | | |AciI | NspI | SecI* | | | |BisI | NlaIII | DsaI* | | | ||BlsI | | EcoRV | |CviAII | | | |||TauI | | | Hpy178III* | || NlaIII | | | |||| EciI \ \ \ \ \ \\ \ \ \ \ \\\\ \ CATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTACACCTATAGAACTGACTAAAAAGGTACCTCCCGTGTCAATTCGGCGATTTCCGTAAT // / / / / // / / / ///// / || | | | | || | | | ||||EciI MwoI || | | | | || | | | |||AciI || | | | | || | | | ||BisI || | | | | || | | | |BlsI || | | | | || | | | CviJI || | | | | || | | | TauI || | | | | || | | MseI || | | | | || | Tsp4CI* || | | | | || BseSI || | | | | || SduI || | | | | |DsaI* || | | | | |SecI* || | | | | |StyI || | | | | |NcoI || | | | | |FatI || | | | | CviAII || | | | NlaIII || | | MnlI || | Hpy178III* || EcoRV |BspLU11I* |AflIII |FatI CviAII H V D I L T D F S M E G T V K P L K A L M W I S * L I F P W R A Q L S R * R H Y C G Y L D * F F H G G H S * A A K G I I ----:----|----:----|----:----|----:----|----:----|----:----| C T S I K V S K E M S P V T L G S F A N V H P Y R S Q N K W P P C L * A A L P M M H I D Q S I K G H L A C N L R * L C * TaqI AsuII TatI | Ksp632I* |Csp6I | | BbvII* ||RsaI | | | ApoI AlfI MwoI ||| TspEI | | | TspEI AlfI |AciI ||| | MboII | | | | MboII | Tsp4CI* \\ \\\ \ \ \ \ \ \ \ \ \ TCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGGTTCATGTTAAAAAATGAGAAGCTTCTGTCTTTTAAACGACTGTAACCATTATGT / /// / / / / / / / / AciI ||| | TspEI | | | TspEI | Tsp4CI* ||| MboII | | | ApoI AlfI ||TatI | | BbvII* AlfI |Csp6I | | MboII RsaI | Ksp632I* AsuII TaqI S A K Y N F L L F E D R K F A D I G N T P P S T I F Y S S K T E N L L T L V I Q R Q V Q F F T L R R Q K I C * H W * Y S ----:----|----:----|----:----|----:----|----:----|----:----| D A L Y L K K S K S S L F N A S M P L V I R W T C N K V R R L C F I Q Q C Q Y Y G G L V I K * E E F V S F K S V N T I C TspEI | CviRI* | | TatI AccI | | |FauI |BssNAI | | |Csp6I |Hpy166II | | ||RsaI || AlfI | | ||ScaI AciI || AlfI MwoI \ \ \\\ \ \\ \ \ GTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTAACGTCATGAGACGCCCACATATGTCTTATCGTCTTACCCGTCTGTAATGCTTA // /// / // / / || ||TatI AciI || AlfI MwoI || |Csp6I || AlfI || |FauI |AccI || ScaI Hpy166II || RsaI BssNAI |CviRI* TspEI V K L Q Y S A G V Y R I A E W A D I T N S N C S T L R V Y T E * Q N G Q T L R M Q I A V L C G C I Q N S R M G R H Y E C ----:----|----:----|----:----|----:----|----:----|----:----| T L N C Y E A P T Y L I A S H A S M V F L * I A T S Q P H I C F L L I P L C * S D F Q L V R R T Y V S Y C F P C V N R I CviRI* | BsmI | | DraIII | | Tsp4CI* | | | DraIII | | | | AsuI* | | | | Bsp120I | | | | |AsuI* | | | | |BmgT120I | | | | ||CviJI | | | | ||NlaIV | | | | ||HaeIII | | | | ||BmgT120I | | | | |||BssKI | | | | |||SecI* | | | | |||EcoRII | | | | ||||ApaI | | | | ||||SduI Cac8I | | | | ||||BseSI | AciI | | | | ||||HgiJII* | |BisI | | | | |||||ScrFI | ||BlsI | | | | |||||BseBI | |||AciI | | | | |||||| SetI AciI | |||TauI MaeIII \ \ \ \ \\\\\\ \ \ \ \\\\ \ GCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCGGAAGAAGTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTGCCACACCACCCGGGTCCATAACAATCGCCAAACTTCGTCCGCCGCCTTCTTCAT / / / / /////// / / /// / | | Tsp4CI* | ||||||EcoRII AciI | ||| AciI | | DraIII | ||||||BssKI | ||BisI | DraIII | |||||SecI* | ||AciI CviRI* | ||||BseBI | |BlsI BsmI | ||||ScrFI | TauI | |||SetI Cac8I | ||Bsp120I | ||AsuI* | |BmgT120I | |AsuI* | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI A H G V V G P G I V S G L K Q A A E E V H T V W W A Q V L L A V * S R R R K K * T R C G G P R Y C * R F E A G G G R S N ----:----|----:----|----:----|----:----|----:----|----:----| A C P T T P G P I T L P K F C A A S S T H V R H P P G L Y Q * R N S A P P P L L C V T H H A W T N N A T Q L L R R F F Y FatI |CviAII || CviRI* || NlaIII || | CviJI || | |NlaIV EciI || | ||SduI MboII || | ||HgiJII* | MnlI || | ||| MaeI | |NlaIV StuI || | ||| | AluI | || MaeI CviJI || | ||| | CviJI | || |SetI HaeIII TspEI || | ||| | | SetI \ \\ \\ \ \ \\ \ \\\ \ \ \ ACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTAGCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTCCTTGGATCTCCGGAAAACTACAATCGTCTTAACAGTACGTTCCCGAGGGATCGA // / / / / / / // / // /// || | | | HaeIII | | || | || ||CviJI || | | | CviJI | | || | || ||AluI || | | | StuI | | || | || |MaeI || | | MaeI | | || | || SetI || | NlaIV | | || | |NlaIV || | SetI | | || | CviJI || MnlI | | || HgiJII* |MboII | | || SduI MaeIII | | |CviRI* EciI | | |FatI | | CviAII | NlaIII TspEI T K E P R G L L M L A E L S C K G S L A Q R N L E A F * C * Q N C H A R A P * L K G T * R P F D V S R I V M Q G L P S Y ----:----|----:----|----:----|----:----|----:----|----:----| V F S G L P R K I N A S N D H L P E R A L L P V * L G K S T L L I T M C P S G L C L F R S A K Q H * C F Q * A L A G * S Csp6I |RsaI || GsuI || Eco57MI || |Tsp4CI* || || HindII || || Hpy166II || || | BsrDI || || | | SapI BsrI DdeI || || | | Ksp632I* MboII \ \ \\ \\ \ \ \ \ ACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCTCTTATATGATTCCCATGACAACTGTAACGCTTCTCGCTGTTTCTAAAACAATAG / / /// / / / BsrI | ||| | Ksp632I* MboII | ||| | SapI | ||| Hpy166II | ||| HindII | ||| BsrDI | ||Tsp4CI* | |Csp6I | Eco57MI | GsuI | RsaI DdeI T G E Y T K G T V D I A K S D K D F V I L E N I L R V L L T L R R A T K I L L S W R I Y * G Y C * H C E E R Q R F C Y R ----:----|----:----|----:----|----:----|----:----|----:----| V P S Y V L P V T S M A F L S L S K T I * Q L I Y * P Y Q Q C Q S S R C L N Q * S S F I S L T S N V N R L A V F I K N D FatI |CviAII || NlaIII MaeIII BsmAI || Ksp632I* |MboII CviJI | TaqII || | Hin4II* ||SetI TspDTI \ \ \ \\ \ \ \\\ \ GGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAAATAACGAGTTTCTCTGTACCCACCTTCTCTACTTCCAATGCTAACCAACTAATAC / / / / // / / / / / / CviJI | | | || | Hin4II* | | | TspDTI | | | || Ksp632I* | | MaeIII | | | |FatI | MboII | | | CviAII SetI | | NlaIII | BsmAI TaqII G F I A Q R D M G G R D E G Y D W L I M A L L L K E T W V E E M K V T I G * L * L Y C S K R H G W K R * R L R L V D Y D ----:----|----:----|----:----|----:----|----:----|----:----| P K I A * L S M P P L S S P * S Q N I I R S * Q E F L C P H F L H L N R N T S * A K N S L S V H T S S I F T V I P Q N H BssKI | HpaII | ScrFI HgaI Hin4I | CauII* | HindII |SecI* | | DraIII Esp3I | Hpy166II |DsaI* | | | BsiYI* BsmAI | | Tsp4CI* ||Tsp4CI* \ \ \ \ \ \ \ \ \\\ ACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGGCCACACCCAAATCTACTGTTCCCTCTGCGTAACCCAGTTGTCATATCTTGGCAC / /// / / // / / / | ||BssKI BsmAI | || Hin4I | DsaI* | |BsiYI* Esp3I | |Tsp4CI* | SecI* | |HpaII | HgaI Tsp4CI* | CauII* Hpy166II | ScrFI HindII DraIII T P G V G L D D K G D A L G Q Q Y R T V H P V W V * M T R E T H W V N S I E P W T R C G F R * Q G R R I G S T V * N R G ----:----|----:----|----:----|----:----|----:----|----:----| V G P T P K S S L P S A N P * C Y L V T S V R H P N L H C P L R M P D V T Y F R C G T H T * I V L S V C Q T L L I S G H FokI |SfeI* ||BsmAI ||Eco31I ||| MmeI ||| |MboI ||| |XhoII ||| || DpnI ||| || |AlwNI ||| || |BstKTI MboII ||| || || Hpy188I | CviRI* ||| || || | BinI* Ksp632I* | |Hin4II* BseGI ||| || || | Hin4I |MnlI | ||SfaNI \ \\\ \\ \\ \ \ \\ \ \\\ GATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACACCAGAGATGTCCTAGACTGTAATAATAACAACCTTCTCCTGATAAACGTTTC / //////// / / / / / BseGI |||||||| BinI* | Ksp632I* | Hin4II* |||||||Hpy188I MnlI | CviRI* |||||||XhoII MboII |||||||MboI ||||||Hin4I |||||DpnI ||||BstKTI |||Eco31I |||BsmAI |||AlwNI ||SfeI* |FokI MmeI D D V V S T G S D I I I V G R G L F A K M M W S L Q D L T L L L L E E D Y L Q R * C G L Y R I * H Y Y C W K R T I C K G ----:----|----:----|----:----|----:----|----:----|----:----| S S T T E V P D S M I I T P L P S N A F P H H P R * L I Q C * * Q Q F L V I Q L I I H D R C S R V N N N N S S S * K C L Hpy166II DdeI | AclI Bpu10I | MaeII |MnlI | |MaeIII Cac8I |BseGI | || SetI | BseYI || SetI | || TaiI | CviJI || | FokI | || | HphI | | GsaI SfaNI \\ \ \ \ \\ \ \ \ \ \ \ GGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCCCTACGATTCCATCTCCCACTTGCAATGTCTTTTCGTCCGACCCTTCGTATAAAC / // // / // / / / / / / SfaNI || |Bpu10I | || | MaeIII | | BseYI SfaNI || |DdeI | || | HphI | CviJI || SetI | || MaeII | GsaI |MnlI | || AclI Cac8I BseGI | |TaiI | |SetI | Hpy166II FokI G R D A K V E G E R Y R K A G W E A Y L E G M L R * R V N V T E K Q A G K H I * K G C * G R G * T L Q K S R L G S I F E ----:----|----:----|----:----|----:----|----:----|----:----| P L S A L T S P S R * L F A P Q S A Y K P F P H * P L P H V N C F L L S P L M N S P I S L Y L T F T V S F C A P F C I Q AciI |CfrI |BisI ||BlsI |||TauI |||CviJI |||HaeIII |||| Cac8I |||| |MboII \\\\ \\ AGAAGATGCGGCCAGCAAAACTAA 790 800 ----:----|----:----|---- TCTTCTACGCCGGTCGTTTTGATT //// / |||| MboII |||| Cac8I |||| CfrI |||HaeIII |||CviJI ||BisI ||AciI |BlsI TauI R R C G Q Q N * E D A A S K T X K M R P A K L X ----:----|----:----|---- L L H P W C F * S F I R G A F S S S A A L L V L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AlfI 2 AluI 3 AluBI AlwNI 1 CaiI ApaI 1 ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 3 Bpu10I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseSI 2 BaeGI,BstSLI BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 5 CviJI 10 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 1 MalI DraII 1 EcoO109I DraIII 3 AdeI DsaI* 2 BtgI,BstDSI EciI 2 Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FatI 5 FauI 1 SmuI FokI 4 GsaI 1 GsuI 2 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 2 HpyAV HindII 2 HincII HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MmeI 1 MnlI 4 MseI 2 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PpuMI 1 Psp5II,PspPPI RsaI 4 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 10 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TaqII 1 TatI 2 TauI 3 TseI 2 ApeKI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 6 TasI,Tsp509I,Sse9I XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AgeI AhaIII* AjuI AloI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BmeT110I BmtI BplI BsaAI BsaBI BsaXI BseMII BsePI BseRI BsgI BsiI* Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BstAPI BstEII BstXI BtgZI BtrI BtsI Cfr10I Cfr9I ClaI CspCI DinI DrdI Eam1105I Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI EspI* FalI FnuDII* FseI FspAI GlaI HaeII HgiAI* HgiCI* HhaI Hin6I HindIII HinfI HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* SchI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI SwaI TfiI TsoI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769