Restriction Map of EAF5/YEL018W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

EAF5/YEL018W on chromosome V from coordinates 121471 to 122310.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.7424

TseI CviRI* |BisI ||BlsI |||AluI BbvI |||CviJI | MseI MnlI SetI TspEI |||| SetI | |TspEI \ \ \ \\\\ \ \ \\ ATGGATAAAGAGGTAAGTGAATTGGTAGTGTTGCAGCTAATACACACTTTAATTTCCAAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTATTTCTCCATTCACTTAACCATCACAACGTCGATTATGTGTGAAATTAAAGGTTG / / / //// / / / MnlI SetI TspEI |||CviJI | | TspEI |||TseI | MseI |||AluI BbvI ||BisI |BlsI |SetI CviRI* M D K E V S E L V V L Q L I H T L I S N W I K R * V N W * C C S * Y T L * F P T G * R G K * I G S V A A N T H F N F Q Q ----:----|----:----|----:----|----:----|----:----|----:----| X S L S T L S N T T N C S I C V K I E L X P Y L P L H I P L T A A L V C K L K W H I F L Y T F Q Y H Q L * Y V S * N G V BsrI | MboII FatI | |MmeI |CviAII | |TspDTI TfiI || NlaIII TaqI TsoI | || MnlI HinfI || | MboII AsuII \ \ \\ \ \ \\ \ \ \ AAGAATGAAGAACTGGTTAGGAACGGGGGAGGAATCAACATGATTGGGAATAATCTTCGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTACTTCTTGACCAATCCTTGCCCCCTCCTTAGTTGTACTAACCCTTATTAGAAGCT / / / / / / // / / TsoI | | MnlI | | || MboII AsuII | TspDTI | | |FatI TaqI | MboII | | CviAII | MmeI | NlaIII BsrI HinfI TfiI K N E E L V R N G G G I N M I G N N L R R M K N W L G T G E E S T * L G I I F E E * R T G * E R G R N Q H D W E * S S N ----:----|----:----|----:----|----:----|----:----|----:----| L F S S S T L F P P P I L M I P F L R R C S H L V P * S R P L F * C S Q S Y D E L I F F Q N P V P S S D V H N P I I K S AluI CviJI | SetI HindII | | ApoI MaeI Hpy166II TspEI | | TspEI \ \ \ \ \ \ ATATCGCTAGTCAAGTTGACTAACGAAATACAAAACAATTTGCTAATCAACGAGCTGACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGCGATCAGTTCAACTGATTGCTTTATGTTTTGTTAAACGATTAGTTGCTCGACTGT / / / / / MaeI Hpy166II TspEI | CviJI HindII | AluI SetI I S L V K L T N E I Q N N L L I N E L T Y R * S S * L T K Y K T I C * S T S * Q I A S Q V D * R N T K Q F A N Q R A D K ----:----|----:----|----:----|----:----|----:----|----:----| I D S T L N V L S I C F L K S I L S S V F I A L * T S * R F V F C N A L * R A S Y R * D L Q S V F Y L V I Q * D V L Q C BfiI MaeII | SfaNI Hin4II* | SetI | |EcoRV | MseI | TaiI BsrI | || Hpy178III* \ \ \ \ \ \ \\ \ AATTTAAGAAGGCAAAGCAACGTGGCAAATGGAAACAGGAAACTGGGCATCAACGATATC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATTCTTCCGTTTCGTTGCACCGTTTACCTTTGTCCTTTGACCCGTAGTTGCTATAG / / / / / / / / / | | MseI | MaeII BsrI BfiI | SfaNI | TspEI TaiI EcoRV | ApoI SetI Hin4II* N L R R Q S N V A N G N R K L G I N D I I * E G K A T W Q M E T G N W A S T I S F K K A K Q R G K W K Q E T G H Q R Y P ----:----|----:----|----:----|----:----|----:----|----:----| F K L L C L L T A F P F L F S P M L S I L N L F A F C R P L H F C S V P C * R Y I * S P L A V H C I S V P F Q A D V I D MseI | ApoI TatI | TspEI |Csp6I DdeI | | XmnI ||RsaI BccI |DrdI \ \ \ \\\ \ \\ CTGACCATAGTTAAGAATTTATTCCCAGAGTACAGAACAACACTAAACGATGGACAACTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGGTATCAATTCTTAAATAAGGGTCTCATGTCTTGTTGTGATTTGCTACCTGTTGAA / / / /// / / Hpy178III* MseI TspEI ||TatI BccI DrdI XmnI |Csp6I ApoI RsaI L T I V K N L F P E Y R T T L N D G Q L * P * L R I Y S Q S T E Q H * T M D N L D H S * E F I P R V Q N N T K R W T T * ----:----|----:----|----:----|----:----|----:----|----:----| R V M T L F K N G S Y L V V S F S P C S G S W L * S N I G L T C F L V L R H V V Q G Y N L I * E W L V S C C * V I S L K FatI Csp6I CviRI* |RsaI |CviAII || MboI ||EcoT22I || | DpnI ||| NlaIII || | |TaqI ||| | EcoRV || | |ClaI ||| | | TaqI || | |PvuI ||| | | |Hpy178III* || | |McrI* AccI ||| | | || AluI || | |BstKTI |Hpy166II ||| | | || CviJI || | || TfiI || Tsp4CI* ||| | | || | SetI || | || HinfI \\ \ \\\ \ \ \\ \ \ \\ \ \\ \ AGTCTACACGGTTTGGAAATGCATGATATCGAGAAGCTCCTTGACGAAAAGTACGATCGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGATGTGCCAAACCTTTACGTACTATAGCTCTTCGAGGAACTGCTTTTCATGCTAGCT / // / / / // / // / / // // // | || Tsp4CI* | | || | || | CviJI || || |ClaI | |AccI | | || | || | AluI || || |TaqI | Hpy166II | | || | || SetI || || MboI DdeI | | || | |Hpy178III* || |DpnI | | || | TaqI || BstKTI | | || EcoRV || McrI* | | |FatI || PvuI | | CviAII |Csp6I | CviRI* RsaI | NlaIII EcoT22I S L H G L E M H D I E K L L D E K Y D R V Y T V W K C M I S R S S L T K S T I D S T R F G N A * Y R E A P * R K V R S I ----:----|----:----|----:----|----:----|----:----|----:----| L R C P K S I C S I S F S R S S F Y S R * D V R N P F A H Y R S A G Q R F T R D T * V T Q F H M I D L L E K V F L V I S BspMI TaqI BccI FokI Tsp4CI* Hpy178III* SetI | MnlI BseGI | BseGI FokI |BtgZI \ \ \ \ \ \ \ \ \\ TTCAAGAAAACGCAGGTCGAACAAATAAGGATGATGGAGGATGAGATATTGAAGAACGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTTTTGCGTCCAGCTTGTTTATTCCTACTACCTCCTACTCTATAACTTCTTGCCA / / / / / // / / / // | | BspMI SetI TaqI || BseGI | FokI |Tsp4CI* | Hpy178III* |MnlI BseGI FokI HinfI BccI TfiI F K K T Q V E Q I R M M E D E I L K N G S R K R R S N K * G * W R M R Y * R T V Q E N A G R T N K D D G G * D I E E R Y ----:----|----:----|----:----|----:----|----:----|----:----| N L F V C T S C I L I I S S S I N F F P I * S F A P R V F L S S P P H S I S S R E L F R L D F L Y P H H L I L Y Q L V T SfaNI MboII | CviRI* | AgeI | | EcoP15I | BetI* | | | FatI | Cfr10I | | | |CviAII MboI | |HpaII | | | || NspI XhoII | || AlfI | | | || CviRI* Cac8I | DpnI | || AlfI | | | || NlaIII | AlfI | |BstKTI | || CviRI* | | | || |MslI | AlfI | || BinI* \ \\ \ \ \ \ \\ \\ \ \ \ \\ \ ATAAAGACCGGTGCATCGCAACTGCAACCACATGCAAATGCTGGCAAAAGTGGATCTGCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTCTGGCCACGTAGCGTTGACGTTGGTGTACGTTTACGACCGTTTTCACCTAGACGA // // / / / / /// / / // / |BtgZI || CviRI* | | | ||MslI | AlfI || XhoII MboII |Cfr10I | | | |CviRI* | AlfI || MboI |BetI* | | | |FatI Cac8I |DpnI |AgeI | | | CviAII BstKTI |AlfI | | EcoP15I |AlfI | | NlaIII HpaII | | NspI | SfaNI CviRI* I K T G A S Q L Q P H A N A G K S G S A * R P V H R N C N H M Q M L A K V D L L K D R C I A T A T T C K C W Q K W I C W ----:----|----:----|----:----|----:----|----:----|----:----| I F V P A D C S C G C A F A P L L P D A Y L S R H M A V A V V H L H Q C F H I Q Y L G T C R L Q L W M C I S A F T S R S Acc65I FatI HgiCI* |CviAII |Csp6I || NlaIII ||RsaI || |Hin6I AsuI* ||NlaIV || ||GlaI AvaII ||| BsrI || |||BsmI |BmgT120I ||| KpnI TspRI || |||HhaI ||NlaIV \\\ \ \ \\ \\\\ \\\ GGTACCAGTGCTACTATAACTACGACTACGCCACACATGGCGCATTCAATGGACCCAAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGTCACGATGATATTGATGCTGATGCGGTGTGTACCGCGTAAGTTACCTGGGTTTT / /// / ///// // | ||HgiCI* | ||||Hin6I |AvaII | ||Acc65I | |||GlaI |AsuI* | |Csp6I | ||HhaI BmgT120I | NlaIV | ||BsmI NlaIV | TspRI | |FatI | RsaI | CviAII | BsrI NlaIII BinI* KpnI G T S A T I T T T T P H M A H S M D P K V P V L L * L R L R H T W R I Q W T Q K Y Q C Y Y N Y D Y A T H G A F N G P K K ----:----|----:----|----:----|----:----|----:----|----:----| P V L A V I V V V V G C M A C E I S G F Q Y W H * * L * S * A V C P A N L P G L T G T S S Y S R S R W V H R M * H V W F Tsp4CI* TspEI | Hpy188I |PpiI | | TspEI PpiI \\ \ \ \ \ AGAGAAAAACTATTGAAATTATACAGAGATACCGTTCTGAATAAATTGGAAAGTAAAACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTTTTGATAACTTTAATATGTCTCTATGGCAAGACTTATTTAACCTTTCATTTTGA / / / / / / PpiI TspEI | | | TspEI | | PpiI | Hpy188I Tsp4CI* R E K L L K L Y R D T V L N K L E S K T E K N Y * N Y T E I P F * I N W K V K L R K T I E I I Q R Y R S E * I G K * N W ----:----|----:----|----:----|----:----|----:----|----:----| L S F S N F N Y L S V T R F L N S L L V F L F V I S I I C L Y R E S Y I P F Y F S F F * Q F * V S I G N Q I F Q F T F S ApoI BsrI TspEI | BfiI | | BslFI | | Hpy188I | | | AluI | | | CviJI | | | |XmnI | | | ||SetI | | | ||| Hpy178III* | | | ||| | HinfI | | | ||| | |BccI | | | ||| | || Hpy178III* | | | ||| | || | PleI | | | ||| | || | |MlyI Hpy178III* TspEI \ \ \ \\\ \ \\ \ \\ \ \ GGGAATTTTCAGAAGCTATTCAAGAGTCCCGATGGTAGCATTATCAAGAATGAGATAAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTTAAAAGTCTTCGATAAGTTCTCAGGGCTACCATCGTAATAGTTCTTACTCTATTTA / / / / // / // / / / BsrI | | | |XmnI | || | PleI Hpy178III* | | | CviJI | || | MlyI | | | BslFI | || Hpy178III* | | | AluI | |HinfI | | SetI | BccI | Hpy188I Hpy178III* TspEI BfiI ApoI G N F Q K L F K S P D G S I I K N E I N G I F R S Y S R V P M V A L S R M R * I E F S E A I Q E S R W * H Y Q E * D K L ----:----|----:----|----:----|----:----|----:----|----:----| P F K * F S N L L G S P L M I L F S I F Q S N E S A I * S D R H Y C * * S H S L P I K L L * E L T G I T A N D L I L Y I FatI BspHI |CviAII |Hpy178III* || NlaIII || |BbvI || || SfeI* || || | TseI || || | CviRI* || || | |BisI || || | |MboII || || | ||BlsI || || | ||PstI || || | |||AluI BssKI || || | |||CviJI |TspDTI || || | |||PvuII ||HpaII || || | |||NspBII* ||ScrFI || || | |||| SetI ||CauII* || || | |||| |TfiI ||| TseI || || | |||| |HinfI BbvII* ||| |BisI || || | |||| || TspDTI | MboII ||| ||BlsI || || | |||| || | BbvI \ \ \\\ \\\ \\ \\ \ \\\\ \\ \ \ TACGAAGACATAAAGAACGAAACGCCCGGCAGCGTTCATGAACTGCAGCTGATTCTTCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTCTGTATTTCTTGCTTTGCGGGCCGTCGCAAGTACTTGACGTCGACTAAGAAGTT / / / ////// / // / //// / / TspEI BbvII* | |||||| | || | |||| | HinfI MboII | |||||| | || | |||| | TfiI | |||||| | || | |||| TspDTI | |||||| | || | |||NspBII* | |||||| | || | |||PvuII | |||||| | || | |||CviJI | |||||| | || | |||TseI | |||||| | || | |||AluI | |||||| | || | ||SfeI* | |||||| | || | ||BisI | |||||| | || | |BlsI | |||||| | || | |SetI | |||||| | || | CviRI* | |||||| | || | MboII | |||||| | || | BbvI | |||||| | || PstI | |||||| | |BspHI | |||||| | |FatI | |||||| | Hpy178III* | |||||| | CviAII | |||||| NlaIII | |||||TseI | ||||BisI | |||BlsI | ||BssKI | |HpaII | CauII* | ScrFI TspDTI Y E D I K N E T P G S V H E L Q L I L Q T K T * R T K R P A A F M N C S * F F K R R H K E R N A R Q R S * T A A D S S K ----:----|----:----|----:----|----:----|----:----|----:----| * S S M F F S V G P L T * S S C S I R * N R L C L S R F A R C R E H V A A S E E V F V Y L V F R G A A N M F Q L Q N K L BsrI TspEI | TspGWI Csp6I | | CviJI Tsp4CI* TspGWI SetI |RsaI TsoI | | |MaeI \ \ \ \\ \ \ \ \\ AAGAGCATAACGGACGGTGTAATGCGAAAGGTCATTGGTACGGACGACTGGAAATTGGCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCGTATTGCCTGCCACATTACGCTTTCCAGTAACCATGCCTGCTGACCTTTAACCGA / / / / // / / / / / BbvI Tsp4CI* | SetI || TsoI | | | CviJI TspGWI |Csp6I | | TspEI RsaI | TspGWI BsrI K S I T D G V M R K V I G T D D W K L A R A * R T V * C E R S L V R T T G N W L E H N G R C N A K G H W Y G R L E I G * ----:----|----:----|----:----|----:----|----:----|----:----| F L M V S P T I R F T M P V S S Q F N A F S C L P R H L A F P * Q Y P R S S I P L A Y R V T Y H S L D N T R V V P F Q S BseGI TspDTI |BsgI || Tsp4CI* || | CviRI* || | |FokI || | || FatI || | || BspHI || | || |SapI SduI || | || |CviAII HgiAI* || | || |Ksp632I* |MaeI || | || |Hpy178III* |BsgI CviRI* TspEI || | || || NlaIII || MboII \ \ \\ \ \\ \\ \ \\ \ AGACAAGTGCAGTTTGAATTGGATGATACGGTGCAGTTCATGAGAAGAGCACTAGAGTAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTCACGTCAAACTTAACCTACTATGCCACGTCAAGTACTCTTCTCGTGATCTCATT / / / // / / / // / / // MaeI CviRI* | || | | | || | | |MboII | || | | | || | | MaeI | || | | | || | BsgI | || | | | || HgiAI* | || | | | || SduI | || | | | |Ksp632I* | || | | | |BspHI | || | | | |FatI | || | | | |SapI | || | | | Hpy178III* | || | | | CviAII | || | | NlaIII | || | | FokI | || | CviRI* | || Tsp4CI* | |BsgI | TspDTI | BseGI TspEI R Q V Q F E L D D T V Q F M R R A L E * D K C S L N W M I R C S S * E E H * S X T S A V * I G * Y G A V H E K S T R V X ----:----|----:----|----:----|----:----|----:----|----:----| L C T C N S N S S V T C N M L L A S S Y * V L A T Q I P H Y P A T * S F L V L T S L H L K F Q I I R H L E H S S C * L L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AlfI 2 AluI 5 AluBI ApoI 3 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BetI* 1 BsaWI BfiI 2 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BseGI 3 BstF5I,BtsCI BsgI 2 BslFI 1 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 BtgZI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 6 CviJI 6 CviKI-1 CviRI* 8 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DrdI 1 AasI,DseDI EcoP15I 1 EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 6 FokI 3 GlaI 1 HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 2 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 2 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 1 MnlI 3 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PleI 1 PpsI PpiI 1 PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 1 RsaI 4 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 9 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI TaiI 1 TaqI 4 TatI 1 TfiI 3 PfeI TseI 3 ApeKI TsoI 2 Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AciI AclI AcyI AflII AflIII AhaIII* AjuI AloI AlwNI ApaI ApaLI AscI AvaI AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BclI BdaI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsiI* BsiYI* BsmAI Bsp120I Bsp1407I BspCNI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstXI BstZ17I BtrI BtsI Cfr9I CfrI CspCI DinI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiJII* Hin4I HindIII HpaI HphI Hpy99I KasI MaeIII MauBI MfeI MluI MroNI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI RsrII SacI SacII SalI SanDI SauI* ScaI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TauI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769