Restriction Map of NPP2/YEL016C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NPP2/YEL016C on chromosome V from coordinates 126218 to 124737.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.2100

EMBOSS_001 SetI | HindII | Hpy166II MboII TaqI | | SetI |TspDTI \ \ \ \ \\ ATGCTTCTTTTCGAGCAACCTGTTGACCTTGAAAAAAATAATGAAGATGATACGAACATA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAGAAAAGCTCGTTGGACAACTGGAACTTTTTTTATTACTTCTACTATGCTTGTAT / / // / | SetI |SetI TspDTI TaqI Hpy166II MboII HindII M L L F E Q P V D L E K N N E D D T N I C F F S S N L L T L K K I M K M I R T * A S F R A T C * P * K K * * R * Y E H K ----:----|----:----|----:----|----:----|----:----|----:----| X S R K S C G T S R S F F L S S S V F M X A E K R A V Q Q G Q F F Y H L H Y S C H K K E L L R N V K F F I I F I I R V Y SetI Hpy178III* AciI \ \ \ AAACCTTTCGCAATATCACGACATTTTTTATTGAAACTTTTGCTTTGCGGTATAATACTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGAAAGCGTTATAGTGCTGTAAAAAATAACTTTGAAAACGAAACGCCATATTATGAG / / / SetI Hpy178III* AciI K P F A I S R H F L L K L L L C G I I L N L S Q Y H D I F Y * N F C F A V * Y S T F R N I T T F F I E T F A L R Y N T H ----:----|----:----|----:----|----:----|----:----|----:----| F G K A I D R C K K N F S K S Q P I I S L V K R L I V V N K I S V K A K R Y L V F R E C Y * S M K * Q F K Q K A T Y Y E AsuI* Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I |||BssKI |||SecI* |||NlaIV ||||ApaI ||||SduI ||||BseSI ||||HgiJII* |||||HpaII |||||ScrFI |||||CauII* TaqI SduI |||||| MfeI AsuII BseSI SetI |||||| TspEI \ \ \ \\\\\\ \ ATTGAGTTGCTTTTATATTCGAAGTGCCCAAAACCTATTGATAATGGGCCCCGGACAATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTCAACGAAAATATAAGCTTCACGGGTTTTGGATAACTATTACCCGGGGCCTGTTAA / / / / /// /// / | BseSI SetI | ||| ||BssKI TspEI | SduI | ||| |SecI* MfeI AsuII | ||| |HpaII TaqI | ||| CauII* | ||| ScrFI | ||Bsp120I | ||DraII | ||AsuI* | |BmgT120I | |AsuI* | |NlaIV | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI I E L L L Y S K C P K P I D N G P R T I L S C F Y I R S A Q N L L I M G P G Q L * V A F I F E V P K T Y * * W A P D N C ----:----|----:----|----:----|----:----|----:----|----:----| M S N S K Y E F H G F G I S L P G R V I * Q T A K I N S T G L V * Q Y H A G S L N L Q K * I R L A W F R N I I P G P C N FatI |CviAII || NlaIII || | BceAI || | Hpy178III* || | | MaeII || | | | MseI || | | | SetI || | | | TaiI MboI || | | | |HpaI | DpnI || | | | |HindII | |BstKTI || | | | |Hpy166II \ \\ \\ \ \ \ \\ GCGAATAGATCAAATACTTACTTCAACGGCACACATGATTTCAAGACGTTAACGATATTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTTATCTAGTTTATGAATGAAGTTGCCGTGTGTACTAAAGTTCTGCAATTGCTATAAC // / / // // / // || MboI | |FatI || | |MseI |DpnI | CviAII || | Hpy166II BstKTI NlaIII || | HindII || | HpaI || MaeII |TaiI |SetI Hpy178III* BceAI A N R S N T Y F N G T H D F K T L T I L R I D Q I L T S T A H M I S R R * R Y * E * I K Y L L Q R H T * F Q D V N D I D ----:----|----:----|----:----|----:----|----:----|----:----| A F L D F V * K L P V C S K L V N V I N Q S Y I L Y K S * R C V H N * S T L S I R I S * I S V E V A C M I E L R * R Y Q EcoRV | BccI NlaIV | BsaBI | BseGI | |FokI | | Hpy188I | || TaqI | | |SfaNI | || ClaI | | || BccI CviRI* \ \\ \ \ \ \\ \ \ ATATCTATCGATGGGTTCCATCCGAGATTGATAGATGCAAAATACACGCCATTTCTTTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGATAGCTACCCAAGGTAGGCTCTAACTATCTACGTTTTATGTGCGGTAAAGAAATG / // // / / // / | || |ClaI NlaIV | |SfaNI CviRI* | || |TaqI BseGI | BccI | || FokI Hpy188I | |BccI | BsaBI EcoRV I S I D G F H P R L I D A K Y T P F L Y Y L S M G S I R D * * M Q N T R H F F T I Y R W V P S E I D R C K I H A I S L Q ----:----|----:----|----:----|----:----|----:----|----:----| I D I S P N W G L N I S A F Y V G N R * S I * R H T G D S I S L H L I C A M E K Y R D I P E M R S Q Y I C F V R W K K V BslFI | CviRI* | | TspEI | | | MwoI | | | BstAPI | | | | AciI | | | | | AsuI* Hpy178III* | | | | | AvaII | CviRI* | | | | | |BmgT120I | TspDTI | | | | | ||NlaIV | | Tsp4CI* | | | | | ||| SplI* | | |BinI* | | | | | ||| |Csp6I | | || MboI | | | | | ||| ||RsaI | | || | DpnI | | | | | ||| ||| BsgI | | || | |BstKTI \ \ \ \ \ \\\ \\\ \ \ \ \\ \ \\ AACTTGCACAATTTGCGGTCCCCGTACGATATGAATATCACGACTGCACCGTATATGATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACGTGTTAAACGCCAGGGGCATGCTATACTTATAGTGCTGACGTGGCATATACTAG // / / / // /// / / / / / // / || | | | || ||SplI* | | | | | || MboI || | | | || ||BsgI | | | | | |DpnI || | | | || |Csp6I | | | | | BstKTI || | | | || RsaI | | | | BinI* || | | | |AvaII | | | Tsp4CI* || | | | |AsuI* | | CviRI* || | | | BmgT120I | TspDTI || | | | NlaIV Hpy178III* || | | AciI || | TspEI || BstAPI || MwoI |BslFI CviRI* N L H N L R S P Y D M N I T T A P Y M I T C T I C G P R T I * I S R L H R I * S L A Q F A V P V R Y E Y H D C T V Y D P ----:----|----:----|----:----|----:----|----:----|----:----| L K C L K R D G Y S I F I V V A G Y I I C S A C N A T G T R Y S Y * S Q V T Y S V Q V I Q P G R V I H I D R S C R I H D BspCNI |BseMII || PflMI || BsiYI* || | BsrI || | TspRI || | |FatI || | ||CviAII DdeI || | ||| MaeIII GsuI | Hpy188I || | ||| NlaIII Eco57MI \ \ \\ \ \\\ \ \ CCAAGTTTTCCCACTCAGACATTTCCCAACCACTGGAGCATGGTAACGGGAAAATATCCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCAAAAGGGTGAGTCTGTAAAGGGTTGGTGACCTCGTACCATTGCCCTTTTATAGGG // // // / / // / / |DdeI || || | | |FatI | Eco57MI Hpy188I || || | | | | GsuI || || | | | MaeIII || || | | CviAII || || | NlaIII || || BsrI || |BsiYI* || |PflMI || TspRI |BseMII BspCNI P S F P T Q T F P N H W S M V T G K Y P Q V F P L R H F P T T G A W * R E N I P K F S H S D I S Q P L E H G N G K I S H ----:----|----:----|----:----|----:----|----:----|----:----| G L K G V * V N G L W Q L M T V P F Y G G L N E W E S M E W G S S C P L P F I D W T K G S L C K G V V P A H Y R S F I G BsiI* SduI Hpy178III* HgiAI* | ApoI | Tsp4CI* TspEI | TspEI \ \ \ \ \ ATTGAGCACGGTATTGTTTCCAATATATTCTGGGATAATTTCACGAGTAGCGAATTTAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTCGTGCCATAACAAAGGTTATATAAGACCCTATTAAAGTGCTCATCGCTTAAATCT / / / / / / | Tsp4CI* | | BsiI* TspEI HgiAI* | Hpy178III* ApoI SduI TspEI I E H G I V S N I F W D N F T S S E F R L S T V L F P I Y S G I I S R V A N L D * A R Y C F Q Y I L G * F H E * R I * T ----:----|----:----|----:----|----:----|----:----|----:----| M S C P I T E L I N Q S L K V L L S N L W Q A R Y Q K W Y I R P Y N * S Y R I * N L V T N N G I Y E P I I E R T A F K S Hpy99I | MnlI | |ApoI MwoI TaqI | |TspEI BstAPI SetI | || HgaI CviJI BceAI | CviRI* \ \ \\ \ \ \ \ \ CCAAATAACCTCGACGCAAGAATTTGGAGCAACACGGCTGACCCTATTTGGCAACTACTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTATTGGAGCTGCGTTCTTAAACCTCGTTGTGCCGACTGGGATAAACCGTTGATGAC / / / / / / / / / / | | TaqI MnlI | HgaI CviJI | | CviRI* | Hpy99I TspEI | BstAPI SetI ApoI | MwoI BceAI P N N L D A R I W S N T A D P I W Q L L Q I T S T Q E F G A T R L T L F G N Y C K * P R R K N L E Q H G * P Y L A T T A ----:----|----:----|----:----|----:----|----:----|----:----| G F L R S A L I Q L L V A S G I Q C S S V L Y G R R L F K S C C P Q G * K A V V W I V E V C S N P A V R S V R N P L * Q CfrI | BalI | CviJI | HaeIII | | MslI | | |NdeI | | || MwoI | | || | BssKI | | || | CviJI | | || | EcoRII | | || | HaeIII | | || | | ScrFI TfiI | | || | | BseBI SetI HinfI | | || | | |MnlI |MnlI \ \ \ \\ \ \ \\ \\ CAAACTGAATCGCAAGGCGAATATAAAGTGGCCACGCATATGTGGCCTGGAAGTGAGGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGACTTAGCGTTCCGCTTATATTTCACCGGTGCGTATACACCGGACCTTCACTCCAA / / / / // / // / / / HinfI | | | |NdeI | || | | MnlI TfiI | | | MwoI | || | SetI | | MslI | || EcoRII | CfrI | || BssKI HaeIII | |BseBI CviJI | |ScrFI BalI | MnlI HaeIII CviJI Q T E S Q G E Y K V A T H M W P G S E V K L N R K A N I K W P R I C G L E V R L N * I A R R I * S G H A Y V A W K * G C ----:----|----:----|----:----|----:----|----:----|----:----| C V S D C P S Y L T A V C I H G P L S T A F Q I A L R I Y L P W A Y T A Q F H P L S F R L A F I F H G R M H P R S T L N Csp6I |RsaI ||BseGI AsuI* |||StyI AvaII |||AvrII |BmgT120I |||SecI* || SecI* ||||MaeI || DsaI* |||||SetI ApoI || | MslI |||||| FokI BsmI TspEI \\ \ \ \\\\\\ \ \ \ GTGTATGAGGACCACGGGGATGTACCTAGGGAAAGAATGCCATTTTATTTTGGGAAATTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CACATACTCCTGGTGCCCCTACATGGATCCCTTTCTTACGGTAAAATAAAACCCTTTAAG // // /// // / / / || |MslI ||| |SecI* | BsmI TspEI || DsaI* ||| |AvrII FokI ApoI || SecI* ||| |StyI |AvaII ||| MaeI |AsuI* ||Csp6I BmgT120I |RsaI |SetI BseGI V Y E D H G D V P R E R M P F Y F G K F C M R T T G M Y L G K E C H F I L G N S V * G P R G C T * G K N A I L F W E I Q ----:----|----:----|----:----|----:----|----:----|----:----| T Y S S W P S T G L S L I G N * K P F N Q T H P G R P H V * P F F A M K N Q S I H I L V V P I Y R P F S H W K I K P F E AluI CviJI | SetI DdeI Hpy178III* | | ApoI BbvCI XmnI | TspEI | | TspEI Hpy188I MslI Bpu10I \ \ \ \ \ \ \ \ \ AATCAATGGGAAAAACTTCAAGATAAATTAGCTCAAATTTTCCGATACATAGATATGCCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTACCCTTTTTGAAGTTCTATTTAATCGAGTTTAAAAGGCTATGTATCTATACGGA / / / / / / / XmnI | | CviJI | Hpy188I MslI | | AluI TspEI | TspEI ApoI | SetI Hpy178III* N Q W E K L Q D K L A Q I F R Y I D M P I N G K N F K I N * L K F S D T * I C L S M G K T S R * I S S N F P I H R Y A S ----:----|----:----|----:----|----:----|----:----|----:----| L * H S F S * S L N A * I K R Y M S I G * D I P F V E L Y I L E F K G I C L Y A I L P F F K L I F * S L N E S V Y I H R AluI CviJI | MseI | SetI | | MnlI | | | BspCNI TfiI | | | |BseMII HinfI | | | || CviJI | SplI* | | | || HaeIII | |Csp6I | | | || | TspEI | ||RsaI \ \ \ \\ \ \ \ \\\ CAGCTTAAAGATAGGCCAGAATTGGTCATAAGTTATATACCCAATGTTGATTCGTACGGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGAATTTCTATCCGGTCTTAACCAGTATTCAATATATGGGTTACAACTAAGCATGCCT /// / // / / / /// ||| | || HaeIII TspEI | ||SplI* ||| | || CviJI | |Csp6I ||| | |BseMII | RsaI ||| | BspCNI HinfI ||| MnlI TfiI ||| MseI ||CviJI ||AluI |Bpu10I |BbvCI |DdeI SetI Q L K D R P E L V I S Y I P N V D S Y G S L K I G Q N W S * V I Y P M L I R T D A * R * A R I G H K L Y T Q C * F V R T ----:----|----:----|----:----|----:----|----:----|----:----| * S L S L G S N T M L * I G L T S E Y P E A * L Y A L I P * L N Y V W H Q N T R L K F I P W F Q D Y T I Y G I N I R V S MwoI | AluI | CviJI | | MboI | | SetI AciI | | | DpnI |BisI | | | |BstKTI BciVI ||BlsI | | | || BccI Tsp4CI* |||TauI | | | || |Hin4I | TspGWI |||CviJI | | | || || TaqI \ \ \\\\ \ \ \ \\ \\ \ CACAGTTTTGGATACGATTTACGAGATAAGCGGCTACAAAAGCTGATCGGTGAAGTCGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTCAAAACCTATGCTAAATGCTCTATTCGCCGATGTTTTCGACTAGCCACTTCAGCTA / / //// / / / // / / / / | TspGWI |||| | | | || | BccI | HphI Tsp4CI* |||| | | | || Hin4I TaqI BciVI |||| | | | || MboI |||| | | | |DpnI |||| | | | BstKTI |||| | | CviJI |||| | | AluI |||| | SetI |||| MwoI |||CviJI ||BisI ||AciI |BlsI TauI H S F G Y D L R D K R L Q K L I G E V D T V L D T I Y E I S G Y K S * S V K S M Q F W I R F T R * A A T K A D R * S R W ----:----|----:----|----:----|----:----|----:----|----:----| C L K P Y S K R S L R S C F S I P S T S V C N Q I R N V L Y A A V F A S R H L R V T K S V I * S I L P * L L Q D T F D I Hin4I |StuI |CviJI HphI |HaeIII |TfiI Hpy178III* || Cac8I |HinfI |TaqI Hin4II* || | CviRI* TspEI \\ \\ \ \\ \ \ \ GGATTCTTTCTCGATTTGATTGAAGGCCTGCAAAAAAGAAACTTGTTGAAAATTAGCAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAGAAAGAGCTAAACTAACTTCCGGACGTTTTTTCTTTGAACAACTTTTAATCGTTA / // / / / / / / HinfI || | Hin4I | | CviRI* TspEI TfiI || Hin4II* | Cac8I |TaqI HaeIII Hpy178III* CviJI StuI G F F L D L I E G L Q K R N L L K I S N D S F S I * L K A C K K E T C * K L A M I L S R F D * R P A K K K L V E N * Q C ----:----|----:----|----:----|----:----|----:----|----:----| P N K R S K I S P R C F L F K N F I L L H I R E R N S Q L G A F F F S T S F * C S E K E I Q N F A Q L F S V Q Q F N A I MaeIII Tsp45I | BdaI | BdaI | | FatI | | NcoI | | StyI | | SecI* BdaI | | DsaI* BdaI | | |CviAII Tsp4CI* | | || NlaIII BsrDI | FatI | | || |FatI HindII | |CviAII | | || ||CviAII Hpy166II | || NspI BsrDI | | || ||| NlaIII | FnuDII* | || NlaIII \ \ \ \\ \\\ \ \ \ \ \\ \ GTTATGATTGTTAGTGACCATGGCATGAGCAATGTCAACGCGAATGACGGTGAGCATGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACTAACAATCACTGGTACCGTACTCGTTACAGTTGCGCTTACTGCCACTCGTACAA / / / /// // / / / // / /// / BsrDI BdaI | ||| |FatI | | | || | ||| HphI BdaI | ||| CviAII | | | || | ||FatI | ||NlaIII | | | || | |CviAII | |DsaI* | | | || | AloI | |SecI* | | | || NlaIII | |StyI | | | || NspI | |NcoI | | | |Tsp4CI* | |FatI | | | BdaI | CviAII | | | BdaI Tsp45I | | FnuDII* MaeIII | Hpy166II NlaIII | HindII BsrDI V M I V S D H G M S N V N A N D G E H V L * L L V T M A * A M S T R M T V S M L Y D C * * P W H E Q C Q R E * R * A C C ----:----|----:----|----:----|----:----|----:----|----:----| T I I T L S W P M L L T L A F S P S C T H * S Q * H G H C S C H * R S H R H A H N H N N T V M A H A I D V R I V T L M N BssKI | HpaII | ScrFI | CauII* | |CfrI | |XmaIII* | || CviJI | || HaeIII | || |McrI* | || || BcgI | || || | Hpy99I | || || | | AloI | || || | | | MwoI | || || | | | HgaI | || || | | | |Hin6I | || || | | | |BsrDI MnlI AloI | || || | | | ||GlaI | PsiI HphI | || || | | | |||HhaI | |SfaNI \ \ \\ \\ \ \ \ \\\\ \ \\ GTTGTGTGGGAAAGGGTGTTCCCGGCCGACGCAATGAGCGCATTTATTTCGCATCTTTAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAACACACCCTTTCCCACAAGGGCCGGCTGCGTTACTCGCGTAAATAAAGCGTAGAAATA ////// / / /// / / / |||||AloI | | ||| HgaI | PsiI ||||| | | ||Hin6I MnlI ||||| | | |GlaI ||||| | | HhaI ||||| | BsrDI ||||| MwoI ||||XmaIII* ||||CfrI ||||BcgI |||Hpy99I ||HaeIII ||BssKI ||CviJI |HpaII |McrI* CauII* ScrFI V V W E R V F P A D A M S A F I S H L Y L C G K G C S R P T Q * A H L F R I F I C V G K G V P G R R N E R I Y F A S L * ----:----|----:----|----:----|----:----|----:----|----:----| T T H S L T N G A S A I L A N I E C R * Q Q T P F P T G P R R L S R M * K A D K N H P F P H E R G V C H A C K N R M K I BcgI | AsuI* | DraII | Bsp120I | |AsuI* | |DraII | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | |||NlaIV | ||||ApaI | ||||SduI | ||||BseSI BsmAI | ||||HgiJII* | AvaI | |||||FatI | XhoI | ||||||BccI | SmlI | ||||||CviAII | |TaqI BsrDI | ||||||| NlaIII | |BmeT110I | Hin4I | ||||||| |MslI | ||Hpy178III* | |MaeIII | ||||||| || BstXI | ||| MnlI | |Tsp45I \ \\\\\\\ \\ \ \ \\\ \ \ \\ AACGAGGGCCCCATGATGATGGTATGTTTGAAAAACCCTCGAGACAAGCAATGGATTTGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTCCCGGGGTACTACTACCATACAAACTTTTTGGGAGCTCTGTTCGTTACCTAAACA / / / //// //// / // / // | | | |||| |||MslI | || MnlI |BsrDI | | | |||| ||FatI | || Hin4I | | | |||| |CviAII | |Hpy178III* | | | |||| |BstXI | |SmlI | | | |||| BccI | |XhoI | | | |||NlaIII | |AvaI | | | ||Bsp120I | BmeT110I | | | ||DraII | TaqI | | | ||AsuI* BsmAI | | | |BmgT120I | | | |DraII | | | |AsuI* | | | |NlaIV | | | BmgT120I | | | HaeIII | | | NlaIV | | | CviJI | | HgiJII* | | BseSI | | SduI | | ApaI | SfaNI BcgI N E G P M M M V C L K N P R D K Q W I C T R A P * * W Y V * K T L E T S N G F V R G P H D D G M F E K P S R Q A M D L * ----:----|----:----|----:----|----:----|----:----|----:----| L S P G M I I T H K F F G R S L C H I Q Y R P G W S S P I N S F G E L C A I S K V L A G H H H Y T Q F V R S V L L P N T TspDTI BspCNI | BinI* |Hin4I | | MaeII AluI |Hin4I | | |PmaCI CviJI |BseMII | | |BsaAI |DdeI ||Hin4I | | |Hin4I ||SetI |||NdeI MnlI TaqI | | |Hin4I \\\ \\\\ \ \ \ \ \\ GACTTGATTGAAGCTCAGTTAGAGAAAGCATATGGAGATGAAATATCGAGGAAGTTTCAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACTAACTTCGAGTCAATCTCTTTCGTATACCTCTACTTTATAGCTCCTTCAAAGTG / / / / //// / / / / / / / Tsp45I | | DdeI |||| NdeI MnlI | | | | BsaAI MaeIII | CviJI |||BseMII | | | | PmaCI | AluI ||BspCNI | | | BinI* SetI |Hin4I | | | TaiI Hin4I | | | SetI Hin4I | | Hin4I | | Hin4I | TspDTI TaqI D L I E A Q L E K A Y G D E I S R K F H T * L K L S * R K H M E M K Y R G S F T L D * S S V R E S I W R * N I E E V S R ----:----|----:----|----:----|----:----|----:----|----:----| S K I S A * N S F A Y P S S I D L F N * H S S Q L E T L S L M H L H F I S S T E V Q N F S L * L F C I S I F Y R P L K V TaqI MboI | AvaI SetI | |MboII TaiI | |BmeT110I | DpnI | || AluI | |BstKTI | || CviJI SspI | ||Hpy178III* | || | SetI XmnI \ \\\ \ \\ \ \ \ GTGATCCTGAAAGAAGATTTCGACCCGAGCTGGAAATATTTCCAATACGATAACAGAAAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACTAGGACTTTCTTCTAAAGCTGGGCTCGACCTTTATAAAGGTTATGCTATTGTCTTTC / // / / / / /// / | || | Hpy178III* | | ||CviJI XmnI | || MboI | | ||AluI SspI | |DpnI | | |AvaI | BstKTI | | BmeT110I MaeII | | SetI | MboII TaqI V I L K E D F D P S W K Y F Q Y D N R K * S * K K I S T R A G N I S N T I T E S D P E R R F R P E L E I F P I R * Q K A ----:----|----:----|----:----|----:----|----:----|----:----| T I R F S S K S G L Q F Y K W Y S L L F R S G S L L N R G S S S I N G I R Y C F H D Q F F I E V R A P F I E L V I V S L EcoRV | Hpy178III* | | TfiI MslI DrdI | | HinfI TspDTI \ \ \ \ \ \ CACAGATATGACGATAGGGTCGGCGATATCTGGATTCTCGCAGATGAATACTACGCCATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTCTATACTGCTATCCCAGCCGCTATAGACCTAAGAGCGTCTACTTATGATGCGGTAA / / / / / / / MslI DrdI | | HinfI | TaqII | | TfiI TspDTI | Hpy178III* EcoRV H R Y D D R V G D I W I L A D E Y Y A I T D M T I G S A I S G F S Q M N T T P L Q I * R * G R R Y L D S R R * I L R H C ----:----|----:----|----:----|----:----|----:----|----:----| C L Y S S L T P S I Q I R A S S Y * A M A C I H R Y P R R Y R S E R L H I S R W V S I V I P D A I D P N E C I F V V G N SduI BciVI BseSI | FatI | |CviAII TaqII HphI MwoI | || NlaIII MseI \ \ \ \ \\ \ \ GTAAAAGAAATGGGTGATGTGCCTATCGGCATTATGGGCACACATGGATACAACTTTAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTTCTTTACCCACTACACGGATAGCCGTAATACCCGTGTGTACCTATGTTGAAATTG / / / / / // / / HphI | | | | |FatI | MseI | | | | CviAII Hin4I | | | NlaIII Hin4I | | BciVI | BseSI | SduI MwoI V K E M G D V P I G I M G T H G Y N F N * K K W V M C L S A L W A H M D T T L T K R N G * C A Y R H Y G H T W I Q L * Q ----:----|----:----|----:----|----:----|----:----|----:----| T F S I P S T G I P M I P V C P Y L K L Q L L F P H H A * R C * P C V H I C S * Y F F H T I H R D A N H A C M S V V K V MslI | Hin4I | Hin4I | | AsuI* Hin4I | | AvaII Hin4I | | |NlaIV | SfeI* | | |BmgT120I | |Tsp4CI* TspDTI SfaNI | | || Hpy188I \ \\ \ \ \ \ \\ \ AACTGTAGTGATATGGCATCTATATTCATTGGAATGGGTCCGATGTTCAACAATGAAGTC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACATCACTATACCGTAGATATAAGTAACCTTACCCAGGCTACAAGTTGTTACTTCAG / / / // / /// | SfeI* TspDTI || MslI ||Hpy188I Tsp4CI* |SfaNI ||AvaII Hin4I ||AsuI* Hin4I |BmgT120I NlaIV N C S D M A S I F I G M G P M F N N E V T V V I W H L Y S L E W V R C S T M K S L * * Y G I Y I H W N G S D V Q Q * S R ----:----|----:----|----:----|----:----|----:----|----:----| L Q L S I A D I N M P I P G I N L L S T C S Y H Y P M * I * Q F P D S T * C H L V T T I H C R Y E N S H T R H E V I F D Csp6I |RsaI MboI || SetI AccI BclI Hin6I || | TspDTI |BssNAI | DpnI |GlaI || | | MnlI TaqI |Hpy166II | |BstKTI ||HhaI \\ \ \ \ \ \\ \ \\ \\\ GTACCTCCATTTGAAAACATCGAAGTATACAATATGCTGATCAAGGCAAGTGCGCTTTTG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CATGGAGGTAAACTTTTGTAGCTTCATATGTTATACGACTAGTTCCGTTCACGCGAAAAC // / / / // // / /// || TspDTI MnlI TaqI |AccI || BclI ||Hin6I |Csp6I Hpy166II || MboI |GlaI RsaI BssNAI |DpnI HhaI SetI BstKTI V P P F E N I E V Y N M L I K A S A L L Y L H L K T S K Y T I C * S R Q V R F W T S I * K H R S I Q Y A D Q G K C A F G ----:----|----:----|----:----|----:----|----:----|----:----| T G G N S F M S T Y L I S I L A L A S K R V E M Q F C R L I C Y A S * P L H A K Y R W K F V D F Y V I H Q D L C T R K Q Hin4II* | MboII | | Ksp632I* MboII \ \ \ \ GGAGAAGAAAAGACAAAGAAGGAGAAGAGTTTATTACAATAA 1450 1460 1470 1480 ----:----|----:----|----:----|----:----|-- CCTCTTCTTTTCTGTTTCTTCCTCTTCTCAAATAATGTTATT / / / / | MboII Ksp632I* MboII Hin4II* G E E K T K K E K S L L Q * E K K R Q R R R R V Y Y N X R R K D K E G E E F I T I X ----:----|----:----|----:----|----:----|-- P S S F V F F S F L K N C Y P L L F S L S P S S N I V I S F F L C L L L L T * * L L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AloI 1 AluI 5 AluBI ApaI 2 ApoI 4 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 1 BccI 4 BceAI 2 BcgI 1 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 2 BmgT120I 7 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 3 BseSI 4 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 2 PspOMI BspCNI 3 BsrDI 4 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 2 BstKTI 5 BstXI 1 Cac8I 1 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 7 CviJI 14 CviKI-1 CviRI* 5 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 5 MalI DraII 3 EcoO109I DrdI 1 AasI,DseDI DsaI* 2 BtgI,BstDSI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FatI 7 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 GsuI 1 BpmI HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 3 HincII HinfI 4 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 4 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MnlI 8 MseI 3 Tru1I,Tru9I MslI 6 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 2 FauNDI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PsiI 1 AanI RsaI 4 AfaI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 15 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SplI* 2 Pfl23II,PspLI,BsiWI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 10 TaqII 1 TauI 1 TfiI 4 PfeI Tsp45I 2 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AlwNI ApaLI AscI Asp718I BaeI BamHI BarI BbvI BbvII* Bce83I* BetI* BfiI BglI BglII BmtI BplI BsaXI BsePI BseRI BseYI Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BstEII BtgZI BtrI BtsI Cfr10I Cfr9I CspCI DinI DraIII Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FauI FseI FspAI GsaI HaeII HgiCI* HindIII KasI KpnI MauBI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PleI PmeI PpiI PpuMI PshAI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SrfI Sse232I* Sse8387I SwaI TatI TseI TsoI TspMI TstI Tth111I VspI XbaI XcmI XhoII XmaCI XmaI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769