Restriction Map of GCN4/YEL009C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GCN4/YEL009C on chromosome V from coordinates 139763 to 138918.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.3291

EMBOSS_001 MseI PflMI Hpy188I CviJI |AhaIII* HphI BccI BsiYI* \ \ \\ \ \ \ ATGTCCGAATATCAGCCAAGTTTATTTGCTTTAAATCCAATGGGTTTCTCACCATTGGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGCTTATAGTCGGTTCAAATAAACGAAATTTAGGTTACCCAAAGAGTGGTAACCTA / / // / / / Hpy188I CviJI |MseI HphI | BsiYI* AhaIII* | PflMI BccI M S E Y Q P S L F A L N P M G F S P L D C P N I S Q V Y L L * I Q W V S H H W M V R I S A K F I C F K S N G F L T I G W ----:----|----:----|----:----|----:----|----:----|----:----| X D S Y * G L K N A K F G I P K E G N S X T R I D A L N I Q K L D L P N R V M P H G F I L W T * K S * I W H T E * W Q I BstXI | PflMI | BsiYI* BseGI FokI | | CfrI \ \ \ \ \ GGTTCTAAATCAACCAACGAAAATGTATCTGCTTCCACTTCTACTGCCAAACCAATGGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGATTTAGTTGGTTGCTTTTACATAGACGAAGGTGAAGATGACGGTTTGGTTACCAA / / / / BseGI FokI | BsiYI* | PflMI BstXI G S K S T N E N V S A S T S T A K P M V V L N Q P T K M Y L L P L L L P N Q W L F * I N Q R K C I C F H F Y C Q T N G W ----:----|----:----|----:----|----:----|----:----|----:----| P E L D V L S F T D A E V E V A L G I T H N * I L W R F H I Q K W K * Q W V L P T R F * G V F I Y R S G S R S G F W H N Hpy178III* | Ksp632I* | |MnlI | || BinI* | || | MboI | || | BamHI | || | XhoII | || | | DpnI | || | | NlaIV | || | | |BstKTI | || | | || TspEI BalI | || | | || | MboII CviJI | || | | || | |BinI* HaeIII | || | | || | || BciVI | MfeI ApoI | || | | || | || | Eco57I | TspEI TspDTI TspEI | || | | || | || | Eco57MI \ \ \ \ \ \\ \ \ \\ \ \\ \ \ GGCCAATTGATTTTTGATAAATTCATCAAGACTGAAGAGGATCCAATTATCAAACAGGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTAACTAAAAACTATTTAAGTAGTTCTGACTTCTCCTAGGTTAATAGTTTGTCCTA / / / / / / / / // / / / // | | | TspDTI TspEI | | | || | | | |Eco57MI | | TspEI ApoI | | | || | | | |Eco57I | | MfeI | | | || | | | BciVI | CfrI | | | || | | BinI* HaeIII | | | || | | TspEI CviJI | | | || | MboII BalI | | | || XhoII | | | || BamHI | | | || MboI | | | |NlaIV | | | |DpnI | | | BstKTI | | BinI* | Ksp632I* Hpy178III* MnlI G Q L I F D K F I K T E E D P I I K Q D A N * F L I N S S R L K R I Q L S N R I P I D F * * I H Q D * R G S N Y Q T G Y ----:----|----:----|----:----|----:----|----:----|----:----| P W N I K S L N M L V S S S G I I L C S Q G I S K Q Y I * * S Q L P D L * * V P A L Q N K I F E D L S F L I W N D F L I SfaNI | CviRI* | | SetI BsgI | | |MwoI TaqI SetI | SapI | | |BstAPI AsuII Hin4II* MboII | Ksp632I* | | ||BceAI \ \ \ \ \ \ \ \\\ ACCCCTTCGAACCTTGATTTTGATTTTGCTCTTCCACAAACGGCAACTGCACCTGATGCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGGAAGCTTGGAACTAAAACTAAAACGAGAAGGTGTTTGCCGTTGACGTGGACTACGG // / / / / // / / || Hin4II* MboII BsgI Ksp632I* || | BceAI |SetI SapI || BstAPI AsuII || MwoI TaqI |SetI CviRI* SfaNI T P S N L D F D F A L P Q T A T A P D A P L R T L I L I L L F H K R Q L H L M P P F E P * F * F C S S T N G N C T * C Q ----:----|----:----|----:----|----:----|----:----|----:----| V G E F R S K S K A R G C V A V A G S A Y G K S G Q N Q N Q E E V F P L Q V Q H G R R V K I K I K S K W L R C S C R I G TspEI | BetI* | BspMII* | |HpaII | |Hpy178III* | || AluI SfeI* | || CviJI | HgaI | || |MaeI | | TfiI Tsp4CI* | || ||SetI | | HinfI \ \ \\ \\\ \ \ \ AAGACCGTTTTGCCAATTCCGGAGCTAGATGACGCTGTAGTGGAATCTTTCTTTTCGTCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGCAAAACGGTTAAGGCCTCGATCTACTGCGACATCACCTTAGAAAGAAAAGCAGT / / // / / / // / Tsp4CI* | || | MaeI SfeI* |HinfI TspRI | || CviJI |TfiI | || AluI HgaI | |BspMII* | |BetI* | |SetI | Hpy178III* | HpaII TspEI K T V L P I P E L D D A V V E S F F S S R P F C Q F R S * M T L * W N L S F R Q D R F A N S G A R * R C S G I F L F V K ----:----|----:----|----:----|----:----|----:----|----:----| L V T K G I G S S S S A T T S D K K E D W S R K A L E P A L H R Q L P I K R K T L G N Q W N R L * I V S Y H F R E K R * TspDTI TfiI | BbvII* HinfI MaeI | |FokI | TspRI |SetI | || MboII \ \ \\ \ \\ \ AGCACTGATTCAACTCCAATGTTTGAGTATGAAAACCTAGAAGACAACTCTAAAGAATGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGACTAAGTTGAGGTTACAAACTCATACTTTTGGATCTTCTGTTGAGATTTCTTACC / / / / // / HinfI SetI | TspDTI |FokI BseGI TfiI MaeI BbvII* MboII S T D S T P M F E Y E N L E D N S K E W A L I Q L Q C L S M K T * K T T L K N G H * F N S N V * V * K P R R Q L * R M D ----:----|----:----|----:----|----:----|----:----|----:----| L V S E V G I N S Y S F R S S L E L S H L C Q N L E L T Q T H F G L L C S * L I A S I * S W H K L I F V * F V V R F F P BsrI TspDTI BseGI | MaeIII | TspRI CviJI MwoI \ \ \ \ \ \ \ ACATCCTTGTTTGACAATGACATTCCAGTTACCACTGACGATGTTTCATTGGCTGATAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGGAACAAACTGTTACTGTAAGGTCAATGGTGACTGCTACAAAGTAACCGACTATTC / / // / / BsrI | |TspDTI | MwoI | MaeIII CviJI TspRI T S L F D N D I P V T T D D V S L A D K H P C L T M T F Q L P L T M F H W L I R I L V * Q * H S S Y H * R C F I G * * G ----:----|----:----|----:----|----:----|----:----|----:----| V D K N S L S M G T V V S S T E N A S L S M R T Q C H C E L * W Q R H K M P Q Y C G Q K V I V N W N G S V I N * Q S I L MboII | Acc65I | HgiCI* | |Csp6I | ||RsaI | ||NlaIV | ||| KpnI | ||| BseGI | ||| |Eco57I | ||| |Eco57MI | ||| || BccI | ||| || |Hpy178III* MfeI | ||| || || TspDTI TspEI | ||| || || |Hpy178III* | TfiI TspRI | ||| || || ||TaqI | HinfI | FokI | ||| || || ||| BsmAI \ \ \ \ \ \\\ \\ \\ \\\ \ GCAATTGAATCCACTGAAGAAGTTTCTCTGGTACCATCCAATCTGGAAGTCTCGACAACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAACTTAGGTGACTTCTTCAAAGAGACCATGGTAGGTTAGACCTTCAGAGCTGTTGA / // / / / /// / / / // / | |HinfI | | | ||HgiCI* | | | || BsmAI | |TfiI | | | ||Acc65I | | | |TaqI | TspRI | | | |Eco57MI | | | Hpy178III* TspEI | | | |Eco57I | | TspDTI MfeI | | | |Csp6I | Hpy178III* | | | NlaIV BccI | | | BseGI | | | RsaI | | KpnI | MboII FokI A I E S T E E V S L V P S N L E V S T T Q L N P L K K F L W Y H P I W K S R Q L N * I H * R S F S G T I Q S G S L D N F ----:----|----:----|----:----|----:----|----:----|----:----| A I S D V S S T E R T G D L R S T E V V P L Q I W Q L L K E P V M W D P L R S L C N F G S F F N R Q Y W G I Q F D R C S SfaNI MlyI | XbaI PleI | |MaeI | MboII MseI | |Hpy178III* | | HinfI SetI \ \\ \ \ \ \ TCATTCTTACCCACTCCTGTTCTAGAAGATGCTAAACTGACTCAAACAAGAAAGGTTAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAGAATGGGTGAGGACAAGATCTTCTACGATTTGACTGAGTTTGTTCTTTCCAATTC / // // / / / / | |XbaI || MboII HinfI SetI MseI | | |PleI | | MlyI | Hpy178III* | MaeI SfaNI S F L P T P V L E D A K L T Q T R K V K H S Y P L L F * K M L N * L K Q E R L R I L T H S C S R R C * T D S N K K G * E ----:----|----:----|----:----|----:----|----:----|----:----| E N K G V G T R S S A L S V * V L F T L K M R V W E Q E L L H * V S E F L F P * * E * G S R N * F I S F Q S L C S L N L Hin4I | BsmAI | BseGI FatI | |TfiI |CviAII | |HinfI || Hin4I | || TaqI ApoI MmeI MaeIII || Hin4I | || |Hpy178III* TspEI | MseI Tsp45I || NlaIII | || || FokI MboI \ \ \ \ \\ \ \ \\ \\ \ \ AAACCAAATTCAGTCGTTAAGAAGTCACATCATGTTGGAAAGGATGACGAATCGAGACTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGTTTAAGTCAGCAATTCTTCAGTGTAGTACAACCTTTCCTACTGCTTAGCTCTGAC / / / /// // / / / // // | MmeI MseI ||| |FatI Hin4I BseGI | || |BsrI TspEI ||| CviAII | || FokI ApoI ||NlaIII | |Hpy178III* |Hin4I | TaqI |Hin4I HinfI Tsp45I BsmAI MaeIII TfiI K P N S V V K K S H H V G K D D E S R L N Q I Q S L R S H I M L E R M T N R D W T K F S R * E V T S C W K G * R I E T G ----:----|----:----|----:----|----:----|----:----|----:----| F G F E T T L F D C * T P F S S S D L S S V L N L R * S T V D H Q F P H R I S V F W I * D N L L * M M N S L I V F R S Q DpnI BsrI |BstKTI || Hin4I || Hin4I || |MaeI || ||MslI TaqI EcoP15I || ||BinI* | TfiI | MfeI || ||| SetI Hin4I AciI | HinfI | TspEI \\ \\\ \ \ \ \ \ \ \ GATCATCTAGGTGTTGTTGCTTACAACCGCAAACAGCGTTCGATTCCACTTTCTCCAATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTAGATCCACAACAACGAATGTTGGCGTTTGTCGCAAGCTAAGGTGAAAGAGGTTAA // / // / / / / / / || | || Hin4I AciI | HinfI | TspEI || | |BinI* | TfiI | MfeI || | |MaeI TaqI EcoP15I || | MslI || | SetI || MboI |DpnI BstKTI Hin4I Hin4I D H L G V V A Y N R K Q R S I P L S P I I I * V L L L T T A N S V R F H F L Q L S S R C C C L Q P Q T A F D S T F S N C ----:----|----:----|----:----|----:----|----:----|----:----| S * R P T T A * L R L C R E I G S E G I P D D L H Q Q K C G C V A N S E V K E L I M * T N N S V V A F L T R N W K R W N SduI BseSI | TfiI | HinfI TspRI | | BbvI |CviJI | | |BinI* ||AciI | | ||BsrI ||BisI | | ||| MboI |||BlsI | | ||| | DpnI ||||TauI | | ||| | |TspRI ||||BssKI | | ||| | |BstKTI MaeII ||||EcoRII | | ||| | || TseI | SetI ||||| ScrFI | | ||| | || |BisI | TaiI ||||| BseBI | | ||| | || ||BlsI | | MaeI ||||| | BcgI \ \ \\\ \ \\ \\\ \ \ \ \\\\\ \ \ GTGCCCGAATCCAGTGATCCTGCTGCTCTAAAACGTGCTAGAAACACTGAAGCCGCCAGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGGCTTAGGTCACTAGGACGACGAGATTTTGCACGATCTTTGTGACTTCGGCGGTCC / /// / // / /// / / / / //// / / BseSI ||| | || | ||TseI | | | TspRI |||| | EcoRII SduI ||| | || | |BisI | | MaeI |||| | BssKI ||| | || | BlsI | MaeII |||| BseBI ||| | || MboI TaiI |||| ScrFI ||| | |DpnI SetI |||| BcgI ||| | BstKTI |||AciI ||| BbvI ||BisI ||BinI* |BlsI |HinfI CviJI |TfiI TauI TspRI BsrI V P E S S D P A A L K R A R N T E A A R C P N P V I L L L * N V L E T L K P P G A R I Q * S C C S K T C * K H * S R Q A ----:----|----:----|----:----|----:----|----:----|----:----| T G S D L S G A A R F R A L F V S A A L Q A R I W H D Q Q E L V H * F C Q L R W H G F G T I R S S * F T S S V S F G G P TspDTI |FalI |FalI || BbvII* BsiI* || | SetI | Eco57I || | | MboII | Eco57MI CviRI* BcgI || | | | TspEI \ \ \ \ \\ \ \ \ \ CGTTCTCGTGCGAGAAAGTTGCAAAGAATGAAACAACTTGAAGACAAGGTTGAAGAATTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCAAGAGCACGCTCTTTCAACGTTTCTTACTTTGTTGAACTTCTGTTCCAACTTCTTAAC / / / / / / / / / | BsiI* CviRI* BcgI | | SetI BbvII* TspEI Eco57MI | TspDTI MboII Eco57I FalI FalI R S R A R K L Q R M K Q L E D K V E E L V L V R E S C K E * N N L K T R L K N C F S C E K V A K N E T T * R Q G * R I A ----:----|----:----|----:----|----:----|----:----|----:----| R E R A L F N C L I F C S S S L T S S N A N E H S F T A F F S V V Q L C P Q L I T R T R S L Q L S H F L K F V L N F F Q TaqI AsuII MboII FalI | TspEI FalI MnlI SetI MseI TspEI \ \ \ \ \ \ \ CTTTCGAAAAATTATCACTTGGAAAATGAGGTTGCCAGATTAAAGAAATTAGTTGGCGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGCTTTTTAATAGTGAACCTTTTACTCCAACGGTCTAATTTCTTTAATCAACCGCTT / / / / / / / / | | | TspEI MnlI SetI MseI TspEI | | FalI | | FalI | AsuII | TaqI MboII L S K N Y H L E N E V A R L K K L V G E F R K I I T W K M R L P D * R N * L A N F E K L S L G K * G C Q I K E I S W R T ----:----|----:----|----:----|----:----|----:----|----:----| S E F F * * K S F S T A L N F F N T P S A K S F N D S P F H P Q W I L S I L Q R K R F I I V Q F I L N G S * L F * N A F CGCTGA ----:- GCGACT R * A X L X ----:- R Q V S A S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 2 BspACI,SsiI AhaIII* 1 DraI AluI 1 AluBI ApoI 2 AcsI,XapI AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 2 BceAI 1 BcgI 1 BciVI 1 BfuI BetI* 1 BsaWI BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 3 BstXI 1 CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 5 CviKI-1 CviRI* 2 HpyCH4V DpnI 3 MalI Eco57I 3 AcuI Eco57MI 3 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 1 FokI 4 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 3 Hin4II* 1 HpyAV HinfI 7 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy178III* 6 Hpy188III Hpy188I 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 3 MunI MlyI 1 SchI MmeI 1 MnlI 2 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PflMI 2 BasI,AccB7I,Van91I PleI 1 PpsI RsaI 1 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 9 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI TaiI 1 TaqI 5 TauI 1 TfiI 6 PfeI TseI 1 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 10 TasI,Tsp509I,Sse9I TspRI 5 TscAI XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuI* AvaI AvaII AvrII BaeI BarI BbvCI Bce83I* BclI BdaI BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseYI BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI Hpy166II Hpy8I Hpy99I HspAI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TatI TsoI TspGWI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769