Restriction Map of YDRWTy2-2



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YDRWTy2-2 on chromosome IV from coordinates 871821 to 877779.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.22107

MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI \\ \\ \ \\ TGTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTTATTTTTAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATATAATAG // / / / // |SpeI | | | |SpeI MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI C W N K N Q L S S T N * Y L R Y * Y I I V G I K I N Y H L L T S I Y V T S I L S L E * K S T I I Y * L V F T L L V Y Y H ----:----|----:----|----:----|----:----|----:----|----:----| X Q F L F * S D D V L * Y K R * * Y I I X N S Y F D V I M * * S T N V N S T Y * T P I F I L * * R S V L I * T V L I N D Hin4I Hin4I | MboII | AluI Tsp4CI* | | HgaI TspEI | CviJI \ \ \ \ \ \ \ ATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCCACAATCTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCACCTTCG / / / / // / / Tsp4CI* Hin4I MboII HgaI |TspEI | CviJI Hin4I | AluI SetI I Y G V R R * R K * * E I V I * I S G S Y T V L E D D A N D E K * S S K L V E A I R C * K M T Q M M R N S H L N * W K L ----:----|----:----|----:----|----:----|----:----|----:----| M Y P T L L H R L H H S I T M * I L P L * I R H * F I V C I I L F L * R F * H F Y V T N S S S A F S S F Y D D L N T S A MboI | DpnI | |BstKTI | || BinI* | || | SspI SetI | || | | MseI TspDTI \ \ \\ \ \ \ \ TGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAACGATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATAATTGTATATTTTGCTACTA // / / / / / || MboI | | | TspDTI |DpnI | | MseI BstKTI | SspI BinI* * N A R I D N V I G S M N I N I * N D D E T Q G L I M * * D Q * I L T Y K T M I K R K D * * C N R I N E Y * H I K R * * ----:----|----:----|----:----|----:----|----:----|----:----| Q F A L I S L T I P D I F I L M Y F S S S F R L S Q Y H L L I L S Y * C I F R H S V C P N I I Y Y S * H I N V Y L V I I TspEI | CviRI* BsiYI* | | TfiI | TfiI MnlI SspI TspEI | | HinfI | HinfI | SmlI \ \ \ \ \ \ \ \ \ AATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATAAATATCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAA / / // / / / / SspI TspEI || | BsiYI* | MnlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI N N I Y R I V * N C R F P F M D S * I L I I F I E L C R I A D S L L W I P K S L * Y L * N C V E L Q I P F Y G F L N P * ----:----|----:----|----:----|----:----|----:----|----:----| L L I * L I T Y F Q L N G K I S E * I R Y Y Y K Y F Q T S N C I G K * P N R F G I I N I S N H L I A S E R K H I G L D K MaeI | BseRI SetI CviJI TfiI | | Bce83I* | SspI | MseI HinfI \ \ \ \ \ \ \ \ GAGGAGAACTTCTAGTATATCTACATACCTAATATTATAGCCTTAATCACAATGGAATCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTGAAGATCATATAGATGTATGGATTATAATATCGGAATTAGTGTTACCTTAGG / / / / / / / / SmlI | Bce83I* SetI SspI | MseI HinfI BseRI CviJI TfiI MaeI E E N F * Y I Y I P N I I A L I T M E S R R T S S I S T Y L I L * P * S Q W N P G E L L V Y L H T * Y Y S L N H N G I P ----:----|----:----|----:----|----:----|----:----|----:----| S S F K * Y I * M G L I I A K I V I S D Q P S S R T Y R C V * Y * L R L * L P I L L V E L I D V Y R I N Y G * D C H F G FatI |CviAII || NlaIII || | Hin6I || | |GlaI || | ||HhaI MaeIII TspEI || | |||HaeII |BslFI DdeI \ \\ \ \\\\ \\ \ CAACAATTACATCAAAATCCACATTCCCAACATGGTAGCGCCTATGCTTCGGTTACTTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTAATGTAGTTTTAGGTGTAAGGGTTGTACCATCGCGGATACGAAGCCAATGAAGA / / // //// / TspEI | || |||Hin6I MaeIII | || ||GlaI BslFI | || |HhaI | || HaeII | |FatI | CviAII NlaIII Q Q L H Q N P H S Q H G S A Y A S V T S N N Y I K I H I P N M V A P M L R L L L T I T S K S T F P T W * R L C F G Y F * ----:----|----:----|----:----|----:----|----:----|----:----| W C N C * F G C E W C P L A * A E T V E G V I V D F D V N G V H Y R R H K P * K L L * M L I W M G L M T A G I S R N S R TspGWI | BceAI | BinI* | | BccI | | |Hpy178III* MwoI | | || MboI | AluI BetI* | | || XhoII | CviJI |HpaII | | || | DpnI | | SetI || ApoI | | || | |BstKTI CviJI | | | TspEI || TspEI \ \ \\ \ \\ \ \ \ \ \ \\ \ AAGGAAGTCCCATCAAATCAAGATCCGTTAGCCGTTTCAGCTTCCAATTTACCGGAATTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTCAGGGTAGTTTAGTTCTAGGCAATCGGCAAAGTCGAAGGTTAAATGGCCTTAAA / / /// /// / / / / / / // / DdeI | ||| ||| XhoII | | | CviJI | || TspEI | ||| ||| MboI | | | AluI | || ApoI | ||| ||DpnI | | SetI | |BetI* | ||| |BstKTI | MwoI | HpaII | ||| | CviJI TspEI | ||| Hpy178III* | ||BccI | |BceAI | BinI* TspGWI K E V P S N Q D P L A V S A S N L P E F R K S H Q I K I R * P F Q L P I Y R N L G S P I K S R S V S R F S F Q F T G I * ----:----|----:----|----:----|----:----|----:----|----:----| L S T G D F * S G N A T E A E L K G S N * P L G M L D L D T L R K L K W N V P I L F D W * I L I R * G N * S G I * R F K MseI BssKI SetI EcoRII AluI |TspEI |SecI* CviJI TfiI || SmlI |MboII PvuII HinfI || Ksp632I* ||ScrFI NspBII* | Bce83I* || | BsmAI ||BseBI | SetI | | DdeI || | Hpy178III* |||SetI | | BslFI \ \ \ \\ \ \ \\\\ \ \ \ GATAGAGATTCCACTAAGGTTAATTCTCAAGAAGAGACAACACCTGGGACATCAGCTGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCTCTAAGGTGATTCCAATTAAGAGTTCTTCTCTGTTGTGGACCCTGTAGTCGACAA // // / / // / // / / / / |HinfI |DdeI | | || BsmAI || | | | NspBII* |TfiI SetI | | |Hpy178III* || | | | PvuII Bce83I* | | |SmlI || | | | CviJI | | Ksp632I* || | | | AluI | TspEI || | | SetI MseI || | EcoRII || | BssKI || | SecI* || BseBI || ScrFI |MboII SetI D R D S T K V N S Q E E T T P G T S A V I E I P L R L I L K K R Q H L G H Q L F * R F H * G * F S R R D N T W D I S C S ----:----|----:----|----:----|----:----|----:----|----:----| S L S E V L T L E * S S V V G P V D A T Q Y L N W * P * N E L L S L V Q S M L Q I S I G S L N I R L F L C C R P C * S N MslI BseRI |FatI ||CviAII |||BccI SetI |||| NlaIII | MnlI |||| |Eco57I | | BspMI PflMI |||| |Eco57MI | | |Csp6I BsiYI* Hpy178III* |||| || BsmAI | | ||RsaI SetI |MnlI \ \\\\ \\ \ \ \ \\\ \ \\ CCAGAGAACCATCATCATGTCTCTCCTCAACCTGCTTCAGTACCACCTCCACAGAATGGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTCTTGGTAGTAGTACAGAGAGGAGTTGGACGAAGTCATGGTGGAGGTGTCTTACCT // / // // // / //// / / |BslFI | || |FatI |SetI MnlI |||SetI | MnlI | | || Eco57MI BsmAI ||BspMI BsiYI* | | || CviAII |Csp6I PflMI | | || Eco57I RsaI | | || BccI | | |NlaIII | | MslI | BseRI Hpy178III* P E N H H H V S P Q P A S V P P P Q N G Q R T I I M S L L N L L Q Y H L H R M D R E P S S C L S S T C F S T T S T E W T ----:----|----:----|----:----|----:----|----:----|----:----| G S F W * * T E G * G A E T G G G C F P E L S G D D H R E E V Q K L V V E V S H W L V M M M D R R L R S * Y W R W L I S BsiYI* AluI | MnlI CviJI | |BsrI Tsp4CI* FatI | SetI | || SduI |Csp6I |CviAII | | CviJI | || BseSI ||RsaI || NlaIII BceAI | | HaeIII | || | BfiI \\\ \\ \ \ \ \ \ \ \\ \ \ CAGTACCAACAGCACGGCATGATGACCCCAAACAAAGCTATGGCCTCTAACTGGGCACAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATGGTTGTCGTGCCGTACTACTGGGGTTTGTTTCGATACCGGAGATTGACCCGTGTA / // / // / / / / / / / | |Csp6I | |FatI | | CviJI | | BseSI BfiI | RsaI | CviAII | | AluI | | MnlI Tsp4CI* NlaIII | SetI | | BsrI BceAI | | SduI | BsiYI* HaeIII CviJI Q Y Q Q H G M M T P N K A M A S N W A H S T N S T A * * P Q T K L W P L T G H I V P T A R H D D P K Q S Y G L * L G T L ----:----|----:----|----:----|----:----|----:----|----:----| C Y W C C P M I V G F L A I A E L Q A C V T G V A R C S S G L C L * P R * S P V L V L L V A H H G W V F S H G R V P C M BccI | MaeII | AflIII | |BtrI MaeII | || SetI |MaeIII | || TaiI |Tsp45I | || | Hpy166II || SetI AarI | || | | HphI || TaiI SetI BspMI BetI* \ \\ \ \ \ \\ \ \ \ \ TACCAACAACCATCTATGATGACGTGTTCACATTATCAAACGTCACCTGCGTATTATCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTGTTGGTAGATACTACTGCACAAGTGTAATAGTTTGCAGTGGACGCATAATAGTT / / // / / / / / / / / | | || | | HphI | | | Tsp45I BspMI | | || | Hpy166II | | | MaeIII AarI | | || AflIII | | SetI | | |MaeII | MaeII | | BtrI TaiI | TaiI SetI | SetI BccI Y Q Q P S M M T C S H Y Q T S P A Y Y Q T N N H L * * R V H I I K R H L R I I N P T T I Y D D V F T L S N V T C V L S T ----:----|----:----|----:----|----:----|----:----|----:----| * W C G D I I V H E C * * V D G A Y * * N G V V M * S S T N V N D F T V Q T N D V L L W R H H R T * M I L R * R R I I L Tsp4CI* | BseMII | |BspCNI | || AciI | || | NspBII* | || | |DdeI HpaII TstI | || | || TatI BinI* | AsuI* | AciI | || | || |HphI | MboI | AvaII | | TseI | || | || |Csp6I | SetI | |BmgT120I | | NspBII* | || | || ||RsaI | | DpnI | ||BbvI | | |BisI | || | || ||ScaI | | |MnlI | ||NlaIV | | ||BlsI | || | || |||TstI | | |BstKTI \ \\\ \ \ \\\ \ \\ \ \\ \\\\ \ \ \\ CCGGACCCACACTATCCGCTGCCACAGTATATCCCACCGCTGAGTACTTCCTCACCTGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTGGGTGTGATAGGCGACGGTGTCATATAGGGTGGCGACTCATGAAGGAGTGGACTA //// / //// / // / / / /// / // |||| BbvI |||| | |BspCNI | | | ||TatI | |MnlI |||| TstI |||| | BseMII | | | |Csp6I | |DpnI |||AvaII |||| Tsp4CI* | | | ScaI | BstKTI |||AsuI* |||TseI | | | RsaI BinI* ||BmgT120I ||BisI | | DdeI SetI ||NlaIV |BlsI | | HphI |BetI* NspBII* | TstI HpaII AciI NspBII* AciI P D P H Y P L P Q Y I P P L S T S S P D R T H T I R C H S I S H R * V L P H L I G P T L S A A T V Y P T A E Y F L T * S ----:----|----:----|----:----|----:----|----:----|----:----| G S G C * G S G C Y I G G S L V E E G S V P G V S D A A V T Y G V A S Y K R V Q R V W V I R Q W L I D W R Q T S G * R I MboI |BdaI |BdaI ||DpnI |||BstKTI |||| Bce83I* |||| | BinI* |||| | | Hpy188I |||| | | | Csp6I |||| | | | |RsaI |||| | | | || SmlI |||| | | | || |SetI |||| | | | || || Hin4I |||| | | | || || |AluI |||| | | | || || |CviJI |||| | | | || || ||DdeI |||| | | | || || |||SetI |||| | | | || || |||| MnlI TaqI |||| | | | || || |||| | Eco57I ClaI |||| | | | || || |||| | Eco57MI | TfiI |||| | | | || || |||| | | BdaI | Hin4I |||| | | | || || |||| | | BdaI | HinfI |||| | | | || || |||| | | | SetI \ \ \\\\ \ \ \ \\ \\ \\\\ \ \ \ \ CCAATCGATTCACAGGATCAACACTCTGAAGTACCTCAAGCTAAGACAAAGGTGAGAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGCTAAGTGTCCTAGTTGTGAGACTTCATGGAGTTCGATTCTGTTTCCACTCTTTA // / / / //// / / /// /// /// // || | | | |||MboI | | ||| ||| ||| |SetI || | | | ||| | | ||| ||| ||| BdaI || | | | ||| | | ||| ||| ||| BdaI || | | | ||| | | ||| ||| ||Eco57MI || | | | ||| | | ||| ||| ||Eco57I || | | | ||| | | ||| ||| |DdeI || | | | ||| | | ||| ||| MnlI || | | | ||| | | ||| ||CviJI || | | | ||| | | ||| ||AluI || | | | ||| | | ||| |SmlI || | | | ||| | | ||| SetI || | | | ||| | | ||Hin4I || | | | ||| | | |Csp6I || | | | ||| | | RsaI || | | | ||| | | SetI || | | | ||| | Hpy188I || | | | ||| BinI* || | | | ||Bce83I* || | | | |DpnI || | | | BstKTI || | | BdaI || | | BdaI || | HinfI || | TfiI || ClaI || TaqI |Hin4I MboI P I D S Q D Q H S E V P Q A K T K V R N Q S I H R I N T L K Y L K L R Q R * E I N R F T G S T L * S T S S * D K G E K * ----:----|----:----|----:----|----:----|----:----|----:----| G I S E C S * C E S T G * A L V F T L F D L R N V P D V S Q L V E L * S L P S F W D I * L I L V R F Y R L S L C L H S I MboII | FatI | |CviAII | || NlaIII | || | MseI | || | | ApoI HphI MseI Hpy188I | || | | TspEI \ \ \ \ \\ \ \ \ AATGTCTTACCACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAGAATGGTGGTGTGTGAAATTGTAGTCTTCTTTTGAAAAGATGTACCCAATTTAAA / / / / / // / / HphI MseI Hpy188I | | |FatI | TspEI | | | | ApoI | | | MseI | | CviAII | NlaIII MboII N V L P P H T L T S E E N F S T W V K F M S Y H H T L * H Q K K T F L H G L N F C L T T T H F N I R R K L F Y M G * I L ----:----|----:----|----:----|----:----|----:----|----:----| L T K G G C V K V D S S F K E V H T L N Y H R V V V C K L M L L F S K * M P * I I D * W W V S * C * F F V K R C P N F K BssKI EcoRII MboII |SecI* | MaeIII ||ScrFI Hpy188I | Tsp45I HphI ||BseBI \ \ \ \ \\\ TACATCAGATTTTTGAAGAACTCTAATCTCGGTGACATTATTCCAAATGACCAGGGTGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAGTCTAAAAACTTCTTGAGATTAGAGCCACTGTAATAAGGTTTACTGGTCCCACTT / / / / / / Hpy188I MboII | HphI | EcoRII Tsp45I | BssKI MaeIII | SecI* BseBI ScrFI Y I R F L K N S N L G D I I P N D Q G E T S D F * R T L I S V T L F Q M T R V K H Q I F E E L * S R * H Y S K * P G * N ----:----|----:----|----:----|----:----|----:----|----:----| * M L N K F F E L R P S M I G F S W P S K C * I K S S S * D R H C * E L H G P H V D S K Q L V R I E T V N N W I V L T F FatI |CviAII || NspI || NlaIII || | MboII Hin4II* HphI || | |TspDTI SetI |TspDTI \ \\ \ \\ \ \\ ATCAAAAGACAAATGACTTATGAAGAACATGCGTATATATACAATACCTTCCAAGCATTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTTCTGTTTACTGAATACTTCTTGTACGCATATATATGTTATGGAAGGTTCGTAAA / / // / / / HphI | || TspDTI SetI Hin4II* | || MboII TspDTI | |FatI | CviAII NlaIII NspI I K R Q M T Y E E H A Y I Y N T F Q A F S K D K * L M K N M R I Y T I P S K H L Q K T N D L * R T C V Y I Q Y L P S I C ----:----|----:----|----:----|----:----|----:----|----:----| I L L C I V * S S C A Y I Y L V K W A N F * F V F S K H L V H T Y I C Y R G L M D F S L H S I F F M R I Y V I G E L C K TspEI | FokI FatI | |MseI |CviAII ApoI | |VspI Hpy188I || NlaIII TspEI | ||TspEI | BseGI \\ \ \ \ \\\ \ \ GCCCCATTTCATTTATTGCCAACATGGGTAAAACAAATTTTAGAAATTAATTATTCTGAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGGTAAAGTAAATAACGGTTGTACCCATTTTGTTTAAAATCTTTAATTAATAAGACTG / // / /// / // | |FatI TspEI ||| | |BseGI | CviAII ApoI ||| | Hpy188I NlaIII ||| TspEI ||FokI |VspI |MseI TspEI A P F H L L P T W V K Q I L E I N Y S D P H F I Y C Q H G * N K F * K L I I L T P I S F I A N M G K T N F R N * L F * H ----:----|----:----|----:----|----:----|----:----|----:----| A G N * K N G V H T F C I K S I L * E S Q G M E N I A L M P L V F K L F * N N Q G W K M * Q W C P Y F L N * F N I I R V Hpy178III* | TspEI Tsp4CI* CviRI* | | MseI \ \ \ \ \ ATCCTTACAGTCCTTTGTAAAAGTGTGTCCAAAATGCAAACTAACAATCAAGAATTAAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAATGTCAGGAAACATTTTCACACAGGTTTTACGTTTGATTGTTAGTTCTTAATTTT / / / // Tsp4CI* CviRI* | |MseI | TspEI Hpy178III* I L T V L C K S V S K M Q T N N Q E L K S L Q S F V K V C P K C K L T I K N * K P Y S P L * K C V Q N A N * Q S R I K R ----:----|----:----|----:----|----:----|----:----|----:----| M R V T R Q L L T D L I C V L L * S N F C G * L G K Y F H T W F A F * C D L I L D K C D K T F T H G F H L S V I L F * F AluI CviJI | SetI | | EcoP15I | | | SmlI TatI | | | |SetI |Csp6I | | | || TatI ||RsaI | | | || |Csp6I ||| Bce83I* | | | || ||RsaI ||| | TspGWI TspEI \ \ \ \\ \\\ \\\ \ \ \ GATTGGATAGCTCTTGCCAACCTTGAGTACAACGGAAGTACATCTGCTGATACATTTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACCTATCGAGAACGGTTGGAACTCATGTTGCCTTCATGTAGACGACTATGTAAACTT / / // / /// /// / | CviJI |SetI | ||TatI ||| TspGWI | AluI EcoP15I | |Csp6I ||Bce83I* SetI | RsaI ||TatI SmlI |Csp6I RsaI D W I A L A N L E Y N G S T S A D T F E I G * L L P T L S T T E V H L L I H L K L D S S C Q P * V Q R K Y I C * Y I * N ----:----|----:----|----:----|----:----|----:----|----:----| S Q I A R A L R S Y L P L V D A S V N S L N S L E Q W G Q T C R F Y M Q Q Y M Q I P Y S K G V K L V V S T C R S I C K F MboI | DpnI Tsp4CI* | |BstKTI CviJI \ \ \\ \ ATTACAGTCAGCACGATCATTCAAAGGCTAAAAGAAAACAATATCAATGTTAGCGACAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGTCAGTCGTGCTAGTAAGTTTCCGATTTTCTTTTGTTATAGTTACAATCGCTGTCT / / // / / | Tsp4CI* || MboI CviJI TspEI |DpnI BstKTI I T V S T I I Q R L K E N N I N V S D R L Q S A R S F K G * K K T I S M L A T D Y S Q H D H S K A K R K Q Y Q C * R Q I ----:----|----:----|----:----|----:----|----:----|----:----| I V T L V I M * L S F S F L I L T L S L F * L * C S * E F A L L F C Y * H * R C N C D A R D N L P * F F V I D I N A V S HphI | SetI | |MaeII CviJI | ||BsaAI HaeIII SetI | ||SnaBI | HindII | BetI* | ||| SetI | Hpy166II MseI | |HpaII | ||| TaiI \ \ \ \ \\ \ \\\ \ TTGGCCTGTCAACTAATACTTAAAGGTCTATCCGGTGATTTCAAATACCTACGTAATCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGGACAGTTGATTATGAATTTCCAGATAGGCCACTAAAGTTTATGGATGCATTAGTT / / // // // / // | Hpy166II |SetI |BetI* || | |MaeII | HindII MseI HpaII || | SnaBI HaeIII || | BsaAI CviJI || TaiI || SetI |SetI HphI L A C Q L I L K G L S G D F K Y L R N Q W P V N * Y L K V Y P V I S N T Y V I N G L S T N T * R S I R * F Q I P T * S I ----:----|----:----|----:----|----:----|----:----|----:----| N A Q * S I S L P R D P S K L Y R R L * I P R D V L V * L D I R H N * I G V Y D Q G T L * Y K F T * G T I E F V * T I L ApoI TspEI FatI | TspEI Csp6I |CviAII TspEI | | MseI |RsaI || NlaIII | TspDTI | | VspI \\ \\ \ \ \ \ \ \ TATCGTACCAAAACGAACATGAAACTTTCCCAATTATTCGCTGAAATTCAATTAATATAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCATGGTTTTGCTTGTACTTTGAAAGGGTTAATAAGCGACTTTAAGTTAATTATATA // / // / / / // |Csp6I | |FatI | TspEI | |VspI RsaI | CviAII TspDTI | |MseI NlaIII | TspEI TspEI ApoI Y R T K T N M K L S Q L F A E I Q L I Y I V P K R T * N F P N Y S L K F N * Y M S Y Q N E H E T F P I I R * N S I N I * ----:----|----:----|----:----|----:----|----:----|----:----| Y R V L V F M F S E W N N A S I * N I Y I D Y W F S C S V K G I I R Q F E I L I I T G F R V H F K G L * E S F N L * Y I FatI BspHI |CviAII |Hpy178III* || TfiI || BslFI || HinfI TspDTI || NlaIII |Tsp4CI* \\ \ \\ GACGAAAATAAAATCATGAATCTAAATAAACCGTCCCAATACAAACAACACAGCGAATAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTTTATTTTAGTACTTAGATTTATTTGGCAGGGTTATGTTTGTTGTGTCGCTTATG / // // / / | || |BslFI | Tsp4CI* | || HinfI TspDTI | || TfiI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII D E N K I M N L N K P S Q Y K Q H S E Y T K I K S * I * I N R P N T N N T A N T R K * N H E S K * T V P I Q T T Q R I Q ----:----|----:----|----:----|----:----|----:----|----:----| S S F L I M F R F L G D W Y L C C L S Y H R F Y F * S D L Y V T G I C V V C R I V F I F D H I * I F R G L V F L V A F V MaeIII Hin4II* | SetI TspEI \ \ \ \ AAAAATGTTTCTCGCACATCTCCAAACACGACTAACACGAAGGTTACAACTCGTAATTAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACAAAGAGCGTGTAGAGGTTTGTGCTGATTGTGCTTCCAATGTTGAGCATTAATA / / / / Hin4II* SetI MaeIII TspEI K N V S R T S P N T T N T K V T T R N Y K M F L A H L Q T R L T R R L Q L V I I K C F S H I S K H D * H E G Y N S * L S ----:----|----:----|----:----|----:----|----:----|----:----| L F T E R V D G F V V L V F T V V R L * C F H K E C M E L C S * C S P * L E Y N F I N R A C R W V R S V R L N C S T I I TseI |BisI ||BlsI ||| MwoI ||| | AluI ||| | CviJI ||| | | FokI Bce83I* ||| | | SetI |BseGI ||| | | |BbvI SspI || BsrI \\\ \ \ \\ \ \\ \ CATAGAACAAATAGTTCAAAACCAAGAGCAGCAAAAGCTCACAATATTGCTACATCCAGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCTTGTTTATCAAGTTTTGGTTCTCGTCGTTTTCGAGTGTTATAACGATGTAGGTCA /// / / /// // / ||| | CviJI ||| || BsrI ||| | AluI ||| |BseGI ||| SetI ||| Bce83I* ||MwoI ||SspI ||TseI |BbvI |BisI FokI BlsI H R T N S S K P R A A K A H N I A T S S I E Q I V Q N Q E Q Q K L T I L L H P V * N K * F K T K S S K S S Q Y C Y I Q * ----:----|----:----|----:----|----:----|----:----|----:----| * L V F L E F G L A A F A * L I A V D L D Y F L Y N L V L L L L L E C Y Q * M W M S C I T * F W S C C F S V I N S C G T Hpy166II | Tsp4CI* | | MboI | | BclI | | | DpnI | | | |HphI | | | |TspRI | | | |BstKTI ApoI | | | || MseI TfiI SmlI TspEI | | | || VspI HinfI Tsp4CI* AflII | SmlI | | | || MslI |TspDTI | TspDTI |MseI \ \ \ \ \ \\ \ \\ \ \ \\ AAATTCTCAAGGGTGAACAGTGATCACATTAATGAATCAACCGTTTCATCACAATACTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGAGTTCCCACTTGTCACTAGTGTAATTACTTAGTTGGCAAAGTAGTGTTATGAAT / / / / // / / / / / / / / | SmlI | | || | | | | | | TspDTI MseI TspEI | | || | | | | | Tsp4CI* ApoI | | || | | | | HinfI | | || | | | | TfiI | | || | | | TspDTI | | || | | VspI | | || | | MseI | | || | MslI | | || BclI | | || MboI | | |HphI | | |DpnI | | BstKTI | Tsp4CI* Hpy166II TspRI K F S R V N S D H I N E S T V S S Q Y L N S Q G * T V I T L M N Q P F H H N T * I L K G E Q * S H * * I N R F I T I L K ----:----|----:----|----:----|----:----|----:----|----:----| L N E L T F L S * M L S D V T E D C Y K Y I R L P S C H D C * H I L R K M V I S F E * P H V T I V N I F * G N * * L V * TfiI DdeI CviJI HinfI |BtgZI HaeIII | DdeI MlyI || DdeI | Cac8I | | CviJI PleI \\ \ \ \ \ \ \ \ AGCGATGACAACGAACTTAGTCTTAGGCCAGCAACAGAAAGAATCTAAGCCAACACGCAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTACTGTTGCTTGAATCAGAATCCGGTCGTTGTCTTTCTTAGATTCGGTTGTGCGTG / / / / / / / // // AflII | | | | Cac8I | |CviJI |PleI SmlI | | | HaeIII | DdeI MlyI | | | CviJI HinfI | | DdeI TfiI | BtgZI DdeI S D D N E L S L R P A T E R I * A N T H A M T T N L V L G Q Q Q K E S K P T R T R * Q R T * S * A S N R K N L S Q H A Q ----:----|----:----|----:----|----:----|----:----|----:----| L S S L S S L R L G A V S L I * A L V C L R H C R V * D * A L L L F F R L W C A A I V V F K T K P W C C F S D L G V R V TfiI MboI HinfI BclI Hin4II* SetI | Hpy178III* | DpnI | | AluI HinfI | |BstKTI | | CviJI | TaqI HphI | || SetI | | | SetI \ \ \ \ \\ \ \ \ \ \ AATAGACTCGAATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTGAGCTTACTGCTTGATGGACTAGTGGAAGAATAACTAAGTCCTCGAAGCGTTTG / / / / // / / / // / | TaqI | SetI || BclI | | || CviJI HinfI HphI || MboI | | || AluI || SetI | | |SetI |DpnI | | Hpy178III* BstKTI | HinfI | TfiI Hin4II* N R L E * R T T * S P S Y * F R S F A N I D S N D E L P D H L L I D S G A S Q T * T R M T N Y L I T F L L I Q E L R K R ----:----|----:----|----:----|----:----|----:----|----:----| L L S S H R V V Q D G E * Q N L L K A F C Y V R I V F * R I V K K N I * S S R L I S E F S S S G S * R R I S E P A E C V MboI Hpy188I FatI | DpnI |CviAII Hpy188I | |BstKTI || CviRI* | SfaNI | || CviJI || NlaIII TspEI | TaqII TaqI \ \\ \ \\ \ \ \ \ \ GCTTGTCAGATCAGCCCATTATTTACACCATGCAACACCCAATTCTGAAATAAACATAGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CGAACAGTCTAGTCGGGTAATAAATGTGGTACGTTGTGGGTTAAGACTTTATTTGTATCA / // / / / // // / / | || | CviJI | |CviRI* || TaqII SfaNI | || MboI | |FatI |Hpy188I | |DpnI | CviAII TspEI | BstKTI NlaIII Hpy188I A C Q I S P L F T P C N T Q F * N K H S L V R S A H Y L H H A T P N S E I N I V L S D Q P I I Y T M Q H P I L K * T * S ----:----|----:----|----:----|----:----|----:----|----:----| A Q * I L G N N V G H L V W N Q F L C L R K D S * G M I * V M C C G I R F Y V Y S T L D A W * K C W A V G L E S I F M T MboII Hpy188I \ \ CGATGCTCAAAAACAAGACATTCCTATAAATGCCATTGGTAATCTTCACTTCAACTTTCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GCTACGAGTTTTTGTTCTGTAAGGATATTTACGGTAACCATTAGAAGTGAAGTTGAAAGT / / / TaqI MboII Hpy188I R C S K T R H S Y K C H W * S S L Q L S D A Q K Q D I P I N A I G N L H F N F Q M L K N K T F L * M P L V I F T S T F R ----:----|----:----|----:----|----:----|----:----|----:----| R H E F V L C E * L H W Q Y D E S * S E D I S L F L V N R Y I G N T I K V E V K S A * F C S M G I F A M P L R * K L K * CviJI | MboI | | DpnI HgiCI* | | |BstKTI | NlaIV BceAI | | || MseI \ \ \ \ \ \\ \ GAACGGCACCAAAACATCAATAAAAGCACTACACACACCAAACATAGCCTATGATCTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCCGTGGTTTTGTAGTTATTTTCGTGATGTGTGTGGTTTGTATCGGATACTAGATAA / / / / // / | HgiCI* BceAI CviJI || MboI NlaIV |DpnI BstKTI E R H Q N I N K S T T H T K H S L * S I N G T K T S I K A L H T P N I A Y D L L T A P K H Q * K H Y T H Q T * P M I Y * ----:----|----:----|----:----|----:----|----:----|----:----| S R C W F M L L L V V C V L C L R H D I L V A G F C * Y F C * V C W V Y G I I * F P V L V D I F A S C V G F M A * S R N AluI CviJI | SetI | Cac8I TsoI TsoI | | CviJI SspI | Cac8I \ \ \ \ \ \ \ AAGTTTGAGTGAGCTGGCTAACCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAACTCACTCGACCGATTGGTTTTATAATGACGGACGAAATGGTCTTTGTGAAATCT / / / / / / / / / | TsoI | | | CviJI SspI | Cac8I MseI | | Cac8I TsoI | CviJI | AluI SetI K F E * A G * P K Y Y C L L Y Q K H F R S L S E L A N Q N I T A C F T R N T L E V * V S W L T K I L L P A L P E T L * K ----:----|----:----|----:----|----:----|----:----|----:----| L N S H A P * G F Y * Q R S * W F C K L * T Q T L Q S V L I N S G A K G S V S * L K L S S A L W F I V A Q K V L F V K S BccI MboI | DpnI | |BstKTI | || Hpy188I | || | Csp6I | || | |RsaI | || | |BseGI | || | || TatI | || | || Tsp4CI* | || | || |Csp6I | || | || ||RsaI | || | || ||ScaI | || | || ||| MaeI BsmAI | || | || ||| FokI |FatI | || | || ||| | AluI ||CviAII | || | || ||| | CviJI ||| NlaIII | || | || ||| | | SetI ||| | TsoI BsrI \ \\ \ \\ \\\ \ \ \ \\\ \ \ \ AAGATCGGATGGTACAGTACTAGCTCCCATAGTCAAACATGGAGACTTTTACTGGTTATC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGCCTACCATGTCATGATCGAGGGTATCAGTTTGTACCTCTGAAAATGACCAATAG // / / /// /////// / // / || | | ||| ||||||FokI | |FatI BsrI || | | ||| |||||CviJI | |TsoI || | | ||| |||||AluI | CviAII || | | ||| ||||MaeI | BsmAI || | | ||| |||SetI NlaIII || | | ||| ||TatI || | | ||| |Csp6I || | | ||| ScaI || | | ||| RsaI || | | ||Tsp4CI* || | | |Csp6I || | | RsaI || | BseGI || Hpy188I || MboI |DpnI BstKTI BccI K I G W Y S T S S H S Q T W R L L L V I R S D G T V L A P I V K H G D F Y W L S D R M V Q Y * L P * S N M E T F T G Y L ----:----|----:----|----:----|----:----|----:----|----:----| F I P H Y L V L E W L * V H L S K S T I F S R I T C Y * S G Y D F M S V K V P * L D S P V T S A G M T L C P S K * Q N D MaeII Hin4II* | SetI | AluI | TaiI SetI | CviJI | |HindII TspEI | | SetI | |Hpy166II \ \ \ \ \ \\ TAAAAAATACCTAATTCCTTCGCACATTTCAAAGCTAACAATAAACAACGTCAACAAAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTTTTATGGATTAAGGAAGCGTGTAAAGTTTCGATTGTTATTTGTTGCAGTTGTTTTC / / / / / / / / SetI TspEI | | CviJI | | Hpy166II | | AluI | | HindII | SetI | MaeII Hin4II* TaiI SetI * K I P N S F A H F K A N N K Q R Q Q K K K Y L I P S H I S K L T I N N V N K S K N T * F L R T F Q S * Q * T T S T K A ----:----|----:----|----:----|----:----|----:----|----:----| * F I G L E K A C K L A L L L C R * C F R F F V * N R R V N * L * C Y V V D V F L F Y R I G E C M E F S V I F L T L L L BsmI | FatI | |CviAII | || NspI TspGWI MseI TaqI | || NlaIII \ \ \ \ \\ \ CAAAAGCGTAAATAAATATCCATATCCGTTAATACATCGAATGCTTGGACATGCTAACTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCGCATTTATTTATAGGTATAGGCAATTATGTAGCTTACGAACCTGTACGATTGAA / / / / / // TspGWI MseI | BsmI | |FatI TaqI | CviAII NlaIII NspI Q K R K * I S I S V N T S N A W T C * L K S V N K Y P Y P L I H R M L G H A N F K A * I N I H I R * Y I E C L D M L T S ----:----|----:----|----:----|----:----|----:----|----:----| C F R L Y I D M D T L V D F A Q V H * S A F A Y I F I W I R * Y M S H K S M S V L L T F L Y G Y G N I C R I S P C A L K SmlI CviRI* AflII | BsmI TfiI |MseI | MaeIII HinfI Hpy188I Hpy188I |BsmAI | | MboII | Hpy188I \ \ \\ \ \ \ \ \ CCGAAGTATTCAGAAGTCTCTTAAGAAGAATGCAGTTACATATTTGAAAGAATCGGATAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTCATAAGTCTTCAGAGAATTCTTCTTACGTCAATGTATAAACTTTCTTAGCCTATA / / /// / / / // Hpy188I Hpy188I ||BsmAI | | MaeIII |Hpy188I |AflII | MboII HinfI |SmlI CviRI* TfiI MseI BsmI P K Y S E V S * E E C S Y I F E R I G Y R S I Q K S L K K N A V T Y L K E S D I E V F R S L L R R M Q L H I * K N R I L ----:----|----:----|----:----|----:----|----:----|----:----| G F Y E S T E * S S H L * M N S L I P Y E S T N L L R K L L I C N C I Q F F R I R L I * F D R L F F A T V Y K F S D S I NheI |MaeI ||Cac8I Hpy178III* ||| BmtI MslI | Tsp4CI* \\\ \ \ \ \ TGAATGGTCTAACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTACCAGATTGCGATCGTGTATAGTTACAGGACTGACAGATTAGCCGTTTTCGTGCTT / /// / / / | ||NheI MslI | Tsp4CI* | |MaeI Hpy178III* | Cac8I BmtI * M V * R * H I S M S * L S N R Q K H E E W S N A S T Y Q C P D C L I G K S T K N G L T L A H I N V L T V * S A K A R N ----:----|----:----|----:----|----:----|----:----|----:----| Q I T * R * C M D I D Q S D L R C F C S N F P R V S A C I L T R V T * D A F A R S H D L A L V Y * H G S Q R I P L L V F MslI |FatI ||CviAII ||| NspI ||| NlaIII ||| | BaeI ||| | | MboI ||| | | | DpnI ||| | | | |BstKTI ||| | | | ||Hpy178III* ||| | | | ||| Csp6I ||| | | | ||| |RsaI ||| | | | ||| || BdaI ||| | | | ||| || BdaI ||| | | | ||| || | TfiI ||| | | | ||| || | HinfI TatI ||| | | | ||| || | | NdeI |Csp6I ||| | | | ||| || | | | BaeI ||RsaI ||| | | | ||| BinI* || | | | | CviJI ||ScaI \\\ \ \ \ \\\ \ \\ \ \ \ \ \ \\\ ACATAGGCATGTCAAAGGATCACGACTAAAGTACCAAGAATCATATGAGCCTTTTCAGTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATCCGTACAGTTTCCTAGTGCTGATTTCATGGTTCTTAGTATACTCGGAAAAGTCAT // /// // / / / // // / / // || ||FatI || | | BinI* |Csp6I || | CviJI |Csp6I || |CviAII || | | |BdaI || NdeI ScaI || BaeI || | | |BdaI |BaeI RsaI |NlaIII || | | RsaI HinfI |NspI || | Hpy178III* TfiI MslI || MboI |DpnI BstKTI T * A C Q R I T T K V P R I I * A F S V H R H V K G S R L K Y Q E S Y E P F Q Y I G M S K D H D * S T K N H M S L F S T ----:----|----:----|----:----|----:----|----:----|----:----| V Y A H * L I V V L T G L I M H A K E T F M P M D F S * S * L V L F * I L R K L C L C T L P D R S F Y W S D Y S G K * Y AsuI* ApaLI AvaII | CviRI* |BmgT120I | Hpy166II || TatI | | SduI CviRI* || Bsp1407I | | BseSI | BdaI || |Csp6I FalI | | HgiAI* | BdaI || ||RsaI FalI | | | SetI Hin4II* \ \ \\ \\\ \ \ \ \ \ \ CTTGCATACCGATATATTTGGTCCTGTACATCACTTACCGAAAAGTGCACCTTCTTACTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTATGGCTATATAAACCAGGACATGTAGTGAATGGCTTTTCACGTGGAAGAATGAA / / / // /// / /// / | | BdaI || ||Bsp1407I | ||ApaLI Hin4II* | | BdaI || ||TatI | |SetI | CviRI* || ||FalI | Hpy166II TatI || ||FalI | CviRI* || |Csp6I HgiAI* || RsaI BseSI |AvaII SduI |AsuI* BmgT120I L A Y R Y I W S C T S L T E K C T F L L L H T D I F G P V H H L P K S A P S Y F C I P I Y L V L Y I T Y R K V H L L T L ----:----|----:----|----:----|----:----|----:----|----:----| S A Y R Y I Q D Q V D S V S F H V K K S V Q M G I Y K T R Y M V * R F T C R R V K C V S I N P G T C * K G F L A G E * K McrI* FalI TaqII Csp6I |Tsp4CI* FalI | TfiI Hpy166II || Hpy178III* | Hpy166II | HinfI |RsaI || |Hpy99I \ \ \ \ \\ \\ \\ TATATCGTTTACAGATGAGAAAACCAGATTCCAATGGGTGTACCCATTACACGACCGTCG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAGCAAATGTCTACTCTTTTGGTCTAAGGTTACCCACATGGGTAATGTGCTGGCAGC / / / / /// / / FalI Hpy166II TaqII HinfI ||Csp6I | Tsp4CI* FalI TfiI |RsaI | Hpy99I Hpy166II McrI* Y I V Y R * E N Q I P M G V P I T R P S I S F T D E K T R F Q W V Y P L H D R R Y R L Q M R K P D S N G C T H Y T T V V ----:----|----:----|----:----|----:----|----:----|----:----| * I T * L H S F W I G I P T G M V R G D K Y R K C I L F G S E L P H V W * V V T I D N V S S F V L N W H T Y G N C S R R TfiI TaqI XmnI HinfI MboII MnlI ClaI MseI TspEI \ \ \ \ \ \ TGAAGAATCTATCCTCAATGTTTTTACATCGATATTAGCATTTATTAAGAACCAATTCAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTCTTAGATAGGAGTTACAAAAATGTAGCTATAATCGTAAATAATTCTTGGTTAAGTT / / / / / / / / | | MboII MnlI ClaI MseI | TspEI | HinfI TaqI XmnI | TfiI Hpy178III* * R I Y P Q C F Y I D I S I Y * E P I Q E E S I L N V F T S I L A F I K N Q F N K N L S S M F L H R Y * H L L R T N S M ----:----|----:----|----:----|----:----|----:----|----:----| H L I * G * H K * M S I L M * * S G I * T F F R D E I N K C R Y * C K N L V L E S S D I R L T K V D I N A N I L F W N L BccI |Hin4I || Hpy178III* || | MboI || | |XcmI || | ||DpnI || | |||BstKTI || | |||| CviJI || | |||| BinI* || | |||| |NlaIV || | |||| || Hpy188I || | |||| || | TatI || | |||| || | |Csp6I || | |||| || | ||RsaI || | |||| || | |||Hpy166II Cac8I || | |||| || | |||| MboII | FnuDII* || | |||| || | |||| TspDTI | | MaeI || | |||| || | |||| | Hin4I Ksp632I* \ \ \ \\ \ \\\\ \\ \ \\\\ \ \ \ TGCTCGCGTTCTAGTTATCCAGATGGATCGTGGCTCCGAGTACACTAACAAAACTCTTCA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAGCGCAAGATCAATAGGTCTACCTAGCACCGAGGCTCATGTGATTGTTTTGAGAAGT / / // / / /// / // / ////// | | || | | ||| | || | |||||MboII | | || | | ||| | || | ||||TspDTI | | || | | ||| | || | |||Hin4I | | || | | ||| | || | ||TatI | | || | | ||| | || | |Hpy166II | | || | | ||| | || | |Csp6I | | || | | ||| | || | RsaI | | || | | ||| | || Hpy188I | | || | | ||| | |BinI* | | || | | ||| | |NlaIV | | || | | ||| | CviJI | | || | | ||| MboI | | || | | ||DpnI | | || | | |BstKTI | | || | | XcmI | | || | Hpy178III* | | || BccI | | |MaeI | | Hin4I | FnuDII* Cac8I C S R S S Y P D G S W L R V H * Q N S S A R V L V I Q M D R G S E Y T N K T L H L A F * L S R W I V A P S T L T K L F I ----:----|----:----|----:----|----:----|----:----|----:----| H E R E L * G S P D H S R T C * C F E E I S A N * N D L H I T A G L V S V F S K A R T R T I W I S R P E S Y V L L V R * FatI CviRI* TfiI |CviAII HinfI ||Cac8I | XbaI ||| SphI | |MaeI ||| NspI SecI* | |Hpy178III* MnlI SetI ||| NlaIII DsaI* | || BceAI \ \ \\\ \ \ \ \\ \ TAAGTTCTTTACGAACAGAGGTATTACTGCATGCTATACAACCACGGCAGATTCTAGAGC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ATTCAAGAAATGCTTGTCTCCATAATGACGTACGATATGTTGGTGCCGTCTAAGATCTCG / / / / /// / / // | MnlI SetI | ||FatI DsaI* | |HgiAI* Ksp632I* | |CviAII SecI* | |XbaI | Cac8I | |SduI CviRI* | Hpy178III* NlaIII | MaeI NspI HinfI SphI TfiI * V L Y E Q R Y Y C M L Y N H G R F * S K F F T N R G I T A C Y T T T A D S R A S S L R T E V L L H A I Q P R Q I L E H ----:----|----:----|----:----|----:----|----:----|----:----| Y T R * S C L Y * Q M S Y L W P L N * L M L E K R V S T N S C A I C G R C I R S L N K V F L P I V A H * V V V A S E L A SduI HgiAI* | DraIII Csp6I TspDTI TspRI | Tsp4CI* MseI |RsaI MseI | BtsI |BsrDI \ \ \ \\ \ \ \ \\ ACACGGTGTCGCTGAACGATTAAATCGTACTTTATTAAACGATTGTCGCACACTGCTTCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGCCACAGCGACTTGCTAATTTAGCATGAAATAATTTGCTAACAGCGTGTGACGAAGT / / / // / / / / | Tsp4CI* MseI |Csp6I MseI | TspRI BsrDI DraIII RsaI | BtsI BceAI TspDTI T R C R * T I K S Y F I K R L S H T A S H G V A E R L N R T L L N D C R T L L H T V S L N D * I V L Y * T I V A H C F I ----:----|----:----|----:----|----:----|----:----|----:----| V R H R Q V I L D Y K I L R N D C V A E C V T D S F S * I T S * * V I T A C Q K C P T A S R N F R V K N F S Q R V S S * TaqI AccI | ApoI BtsI | TspEI MslI TspRI | | BspCNI TspDTI CviRI* |Hpy166II XcmI DdeI | | |BseMII | Hpy188I \ \\ \ \ \ \ \\ \ \ TTGCAGTGGTCTACCAAATCATCTATGGTTCTCAGCAGTCGAATTTTCTACTATAATCAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTCACCAGATGGTTTAGTAGATACCAAGAGTCGTCAGCTTAAAAGATGATATTAGTC / / / // / / /// / / / | | | |AccI XcmI DdeI ||| TspEI | Hpy188I | | | Hpy166II ||| ApoI TspDTI | | BtsI ||BseMII | CviRI* |BspCNI | MslI TaqI TspRI L Q W S T K S S M V L S S R I F Y Y N Q C S G L P N H L W F S A V E F S T I I R A V V Y Q I I Y G S Q Q S N F L L * S E ----:----|----:----|----:----|----:----|----:----|----:----| N C H D V L D D I T R L L R I K * * L * M A T T * W I M * P E * C D F K R S Y D Q L P R G F * R H N E A T S N E V I I L BspMI | FatI | |CviAII | || NspI | || CviRI* | || NlaIII | || |BcgI | || || SetI ApoI | || || |MwoI TspEI | || || || AluI | EcoP15I BcgI | || || || CviJI | | HphI | BsmAI | || || || | SetI \ \ \ \ \ \ \\ \\ \\ \ \ AAATTCATTAGTCTCACCAAAAAACGATAAATCTGCCAGACAACATGCAGGTTTAGCTGG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGTAATCAGAGTGGTTTTTTGCTATTTAGACGGTCTGTTGTACGTCCAAATCGACC / / / // /// / / / | BcgI BsmAI || ||| | | CviJI EcoP15I || ||| | | AluI TspEI || ||| | SetI ApoI || ||| MwoI HphI || ||SetI || |CviRI* || |FatI || CviAII || BcgI |NlaIII |NspI BspMI K F I S L T K K R * I C Q T T C R F S W N S L V S P K N D K S A R Q H A G L A G I H * S H Q K T I N L P D N M Q V * L D ----:----|----:----|----:----|----:----|----:----|----:----| F N M L R V L F R Y I Q W V V H L N L Q S I * * D * W F V I F R G S L M C T * S F E N T E G F F S L D A L C C A P K A P HindII Hpy166II | AgeI MseI MlyI | BetI* |HpaI PleI | Cfr10I |HindII | Hpy178III* BsrI TaqII SetI | |HpaII |Hpy166II | |FokI \ \ \ \ \\ \\ \ \\ ACTGGACATTACTACTATACTACCTTTCGGTCAACCGGTTATAGTTAACAACCATAATCC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCTGTAATGATGATATGATGGAAAGCCAGTTGGCCAATATCAATTGTTGGTATTAGG / / / / // // // BsrI TaqII SetI | |Cfr10I |MseI |PleI | |BetI* Hpy166II MlyI | |AgeI HindII | HpaII HpaI Hpy166II HindII T G H Y Y Y T T F R S T G Y S * Q P * S L D I T T I L P F G Q P V I V N N H N P W T L L L Y Y L S V N R L * L T T I I P ----:----|----:----|----:----|----:----|----:----|----:----| V P C * * * V V K R D V P * L * C G Y D S Q V N S S Y * R E T L R N Y N V V M I S S M V V I S G K P * G T I T L L W L G BsmI | MnlI | |BssKI | |EcoRII | || FokI | || ScrFI BseGI | || BseBI | MaeIII BseGI | || | MaeIII | Tsp45I HinfI | MslI | || | | SetI | | Hpy178III* | TaqI | BsiI* | || | | | TspGWI | | | TsoI \ \ \ \ \ \\ \ \ \ \ \ \ \ \ CGACTCGAAAATACATCCTCGTGGCATTCCAGGTTACGCCTTACATCCGTCACGAAACTC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GCTGAGCTTTTATGTAGGAGCACCGTAAGGTCCAATGCGGAATGTAGGCAGTGCTTTGAG / // / / / / / // // / / // | || | BseGI | | | || || | BseGI |Hpy178III* | || TaqI | | | || || MaeIII |Tsp45I | |HinfI | | | || |TspGWI |MaeIII | FokI | | | || |FokI TsoI Hpy178III* | | | || EcoRII | | | || BssKI | | | |BseBI | | | |ScrFI | | | SetI | | MnlI | BsiI* | BsmI MslI R L E N T S S W H S R L R L T S V T K L D S K I H P R G I P G Y A L H P S R N S T R K Y I L V A F Q V T P Y I R H E T L ----:----|----:----|----:----|----:----|----:----|----:----| R S S F V D E H C E L N R R V D T V F S G V R F Y M R T A N W T V G * M R * S V S E F I C G R P M G P * A K C G D R F E TspEI CviJI | MaeII | FokI MseI | | SetI | |MboII BseGI | BccI Tsp4CI* | | TaiI \ \\ \ \ \ \ \ \ \ TTATGGCTATATTATCTATCTTCCATCCTTAAAAAAGACAGTAGATACTACCAATTACGT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AATACCGATATAATAGATAGAAGGTAGGAATTTTTTCTGTCATCTATGATGGTTAATGCA / / / / // / / / | | FokI BseGI |BccI Tsp4CI* | MaeII | MboII MseI TspEI CviJI TaiI SetI L W L Y Y L S S I L K K D S R Y Y Q L R Y G Y I I Y L P S L K K T V D T T N Y V M A I L S I F H P * K R Q * I L P I T L ----:----|----:----|----:----|----:----|----:----|----:----| K H S Y * R D E M R L F S L L Y * W N R R I A I N D I K W G * F L C Y I S G I V * P * I I * R G D K F F V T S V V L * T TspEI | AsuI* | AvaII | |BmgT120I | || BsrI TaqI \ \\ \ \ TATATTACAAAACAATCAAACGAAATTGGACCAGTTCGACTACGATACACTCACTTTTGA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAATGTTTTGTTAGTTTGCTTTAACCTGGTCAAGCTGATGCTATGTGAGTGAAAACT / /// / | ||AvaII TaqI | ||AsuI* | |BmgT120I | BsrI TspEI Y I T K Q S N E I G P V R L R Y T H F * I L Q N N Q T K L D Q F D Y D T L T F D Y Y K T I K R N W T S S T T I H S L L M ----:----|----:----|----:----|----:----|----:----|----:----| * I V F C D F S I P G T R S R Y V * K Q N Y * L V I L R F Q V L E V V I C E S K I N C F L * V F N S W N S * S V S V K S BsaBI |MboI || DpnI || |BstKTI || || BsaBI MseI CviJI TsoI \\ \\ \ \ \ \ TGATGATCTCAATCGTTTAACAGCCCATAACCAATCTTTTATTGAACAAAATGAAACGGA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| ACTACTAGAGTTAGCAAATTGTCGGGTATTGGTTAGAAAATAACTTGTTTTACTTTGCCT / // // / / / | || |BsaBI | CviJI TsoI | || MboI MseI | |DpnI | BstKTI BsaBI * * S Q S F N S P * P I F Y * T K * N G D D L N R L T A H N Q S F I E Q N E T E M I S I V * Q P I T N L L L N K M K R S ----:----|----:----|----:----|----:----|----:----|----:----| H H D * D N L L G Y G I K * Q V F H F P I I I E I T * C G M V L R K N F L I F R S S R L R K V A W L W D K I S C F S V S TfiI HinfI | Hin4I | Hin4I | AlwNI | | MboI | | BclI | | Hpy188I TspDTI | | | DpnI |NdeI | | | |FatI || MboI | | | |BspHI || BclI | | | |BstKTI || |TspGWI | | | ||CviAII Hin4I || ||DpnI | | | ||Hpy178III* Hin4I || |||BstKTI | | | ||| NlaIII Hpy188I |BinI* \\ \\\\ \ \ \ \\\ \ \ \\ GCAGTCATATGATCAAAATACAGAATCTGATCATGACTATCAATCGGAGATTGAAATAAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCAGTATACTAGTTTTATGTCTTAGACTAGTACTGATAGTTAGCCTCTAACTTTATTT / / // / / / // //// // / / / | | || BclI | | || |||| |BspHI Hpy188I Hin4I BinI* | | || MboI | | || |||| |FatI Hin4I | | |DpnI | | || |||| Hpy178III* | | BstKTI | | || |||| CviAII | TspGWI | | || |||BclI | NdeI | | || |||MboI TspDTI | | || ||NlaIII | | || |DpnI | | || BstKTI | | |Hpy188I | | HinfI | | TfiI | AlwNI Hin4I Hin4I A V I * S K Y R I * S * L S I G D * N K Q S Y D Q N T E S D H D Y Q S E I E I N S H M I K I Q N L I M T I N R R L K * T ----:----|----:----|----:----|----:----|----:----|----:----| A T M H D F Y L I Q D H S D I P S Q F L L L * I I L I C F R I M V I L R L N F Y C D Y S * F V S D S * S * * D S I S I F MboI Hpy188I | DpnI | |BstKTI | ||PpiI | ||| MaeI | ||| Hin4I | ||| Hin4I | ||| | BslFI | ||| | | Hpy166II PpiI | ||| | | | MnlI | Hin4I | ||| | | | | XmnI | Hin4I TspEI \ \\\ \ \ \ \ \ \ \ \ CTCTGATCCTCTAGTGAACGATTTCTCGTCCCAATCATTGAACCCTTTACAATTAGACAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GAGACTAGGAGATCACTTGCTAAAGAGCAGGGTTAGTAACTTGGGAAATGTTAATCTGTT / // / / // / / / / | || MboI | || XmnI | Hin4I TspEI | |Hin4I | |BslFI | Hin4I | |Hin4I | |MnlI PpiI | |DpnI | Hpy166II | BstKTI MaeI Hpy188I PpiI L * S S S E R F L V P I I E P F T I R Q S D P L V N D F S S Q S L N P L Q L D K L I L * * T I S R P N H * T L Y N * T R ----:----|----:----|----:----|----:----|----:----|----:----| S Q D E L S R N R T G I M S G K V I L C V R I R * H V I E R G L * Q V R * L * V E S G R T F S K E D W D N F G K C N S L Csp6I |RsaI |SetI ||MaeII |||BsaAI ||||ApaLI |||||SetI |||||TaiI ||||||CviRI* ||||||Hpy166II ||||||| SduI ||||||| BseSI NlaIV ||||||| HgiAI* Hpy188I | BsrI ||||||| | SfaNI | MboII \ \ \\\\\\\ \ \ \ \ GGAACCAGTCCAAAAGGTACGTGCACCAAAAGAAGTTGATGCCGACATATCTGAATACAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTGGTCAGGTTTTCCATGCACGTGGTTTTCTTCAACTACGGCTGTATAGACTTATGTT / / //// / / / / / NlaIV | |||| | ApaLI SfaNI | MboII BsrI | |||| Hpy166II Hpy188I | |||| CviRI* | |||HgiAI* | |||MaeII | |||BseSI | |||SduI | ||BsaAI | |Csp6I | RsaI | TaiI | SetI SetI G T S P K G T C T K R S * C R H I * I Q E P V Q K V R A P K E V D A D I S E Y N N Q S K R Y V H Q K K L M P T Y L N T I ----:----|----:----|----:----|----:----|----:----|----:----| P V L G F P V H V L L L Q H R C I Q I C L F W D L L Y T C W F F N I G V Y R F V S G T W F T R A G F S T S A S M D S Y L BccI | MboI | | DpnI | | |BstKTI | | || Csp6I TaqII | | || |RsaI MseI |Csp6I SspI | | || ||Hpy166II VspI ||RsaI \ \ \ \\ \\\ \ \\\ TATTCTTCCATCTACTATACGATCTCGTACACCCCATATCATTAATAAAGAGAGTACCGA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGAAGGTAGATGATATGCTAGAGCATGTGGGGTATAGTAATTATTTCTCTCATGGCT / / // / // / / // SspI | || | |Hpy166II VspI | |Csp6I | || | |Csp6I MseI | RsaI | || | RsaI TaqII | || MboI | |DpnI | BstKTI BccI Y S S I Y Y T I S Y T P Y H * * R E Y R I L P S T I R S R T P H I I N K E S T E F F H L L Y D L V H P I S L I K R V P K ----:----|----:----|----:----|----:----|----:----|----:----| Y E E M * * V I E Y V G Y * * Y L S Y R I N K W R S Y S R T C G M D N I F L T G I R G D V I R D R V G W I M L L S L V S Acc65I BsgI HgiCI* |PshAI |Csp6I TfiI || AccI ||RsaI HinfI || |Hpy166II ||NlaIV | Hpy188I MaeI || || SetI ||| KpnI | | HphI |SetI || || |BtsI CviRI* \\\ \ \ \ \ \\ \\ \\ \\ \ AATGGGTGGTACCATTGAATCAGATACTACTTCACCTAGACACTCGTCTACCTTCACTGC 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCCACCATGGTAACTTAGTCTATGATGAAGTGGATCTGTGAGCAGATGGAAGTGACG / /// // / / / / / // / // | ||HgiCI* || HphI SetI | | | || TspRI |Hin4II* | ||Acc65I |Hpy188I | | | || BtsI CviRI* | |Csp6I HinfI | | | |AccI | NlaIV TfiI | | | |SetI | RsaI | | | Hpy166II KpnI | | PshAI | BsgI MaeI N G W Y H * I R Y Y F T * T L V Y L H C M G G T I E S D T T S P R H S S T F T A W V V P L N Q I L L H L D T R L P S L H ----:----|----:----|----:----|----:----|----:----|----:----| F P H Y W Q I L Y * K V * V S T * R * Q F H T T G N F * I S S * R S V R R G E S I P P V M S D S V V E G L C E D V K V A BslFI | XcmI | | BssKI | | SexAI | | EcoRII | | | ScrFI | | | BseBI TspRI | | | |SetI Hin4II* | | | || DrdI Hin4I SetI MnlI \ \ \ \ \\ \ \ \ \ ACGAAACCAAAAGCGACCTGGTAGTCCCAATGATATGATTGATTTGACCTCACAGGATAG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTTTGGTTTTCGCTGGACCATCAGGGTTACTATACTAACTAAACTGGAGTGTCCTATC / / / / / / / / | | | | Hin4I SetI | Hin4I | | | EcoRII MnlI | | | SexAI | | | BssKI | | BseBI | | ScrFI | | DrdI | SetI BslFI XcmI T K P K A T W * S Q * Y D * F D L T G * R N Q K R P G S P N D M I D L T S Q D R E T K S D L V V P M I * L I * P H R I E ----:----|----:----|----:----|----:----|----:----|----:----| V F G F A V Q Y D W H Y S Q N S R V P Y C S V L L S R T T G I I H N I Q G * L I R F W F R G P L G L S I I S K V E C S L TaqII | AflIII MseI | | MaeII MnlI |TspEI | | | SetI | Csp6I |Hin4I | | | TaiI | |RsaI NlaIV \\ \ \ \ \ \ \\ \ AGTTAATTATGGACTTGAAAACATCAAAACTACACGTTTGGGTGGTACGGAGGAACCATA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TCAATTAATACCTGAACTTTTGTAGTTTTGATGTGCAAACCCACCATGCCTCCTTGGTAT / / / / / / // / / | TspEI TaqII | | | |Csp6I NlaIV TspGWI MseI | | | RsaI | | MnlI | AflIII | MaeII TaiI SetI S * L W T * K H Q N Y T F G W Y G G T I V N Y G L E N I K T T R L G G T E E P Y L I M D L K T S K L H V W V V R R N H I ----:----|----:----|----:----|----:----|----:----|----:----| L * N H V Q F C * F * V N P H Y P P V M S N I I S K F V D F S C T Q T T R L F W T L * P S S F M L V V R K P P V S S G Y Csp6I Hin4I TspGWI |RsaI Hin4I \ \\ \ TATTCAACGAAATAGTGATACAAATATCAAATACAGGACTACAAATAGTACGCCCTCAAT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGTTGCTTTATCACTATGTTTATAGTTTATGTCCTGATGTTTATCATGCGGGAGTTA /// ||Hin4I ||Hin4I |Csp6I RsaI Y S T K * * Y K Y Q I Q D Y K * Y A L N I Q R N S D T N I K Y R T T N S T P S I F N E I V I Q I S N T G L Q I V R P Q * ----:----|----:----|----:----|----:----|----:----|----:----| Y E V F Y H Y L Y * I C S * L Y Y A R L I N L S I T I C I D F V P S C I T R G * I * R F L S V F I L Y L V V F L V G E I Tsp4CI* | TfiI | HinfI MnlI | | TspRI | Tsp4CI* | | | Hin4I | | Eam1105I | | | Hin4I MmeI BccI CviJI \ \ \ \ \ \ \ \ \ \ AGATGACCGTTCGTCCAACAGTGAATCCACTACTCCCATCATCTCCATAGAAACAAAGGC 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTACTGGCAAGCAGGTTGTCACTTAGGTGATGAGGGTAGTAGAGGTATCTTTGTTTCCG / / / / / / / / / / | | | | | | HinfI MmeI BccI CviJI | | | | | | TfiI | | | | | Hin4I | | | | | Hin4I | | | | Tsp4CI* | | | TspRI | | Eam1105I | Tsp4CI* MnlI R * P F V Q Q * I H Y S H H L H R N K G D D R S S N S E S T T P I I S I E T K A M T V R P T V N P L L P S S P * K Q R L ----:----|----:----|----:----|----:----|----:----|----:----| L H G N T W C H I W * E W * R W L F L P Y I V T R G V T F G S S G D D G Y F C L S S R E D L L S D V V G M M E M S V F A EciI | BinI* | | MnlI | | | BsaBI | | | |MboI | | | |BamHI | | | |XhoII | | | || DpnI | | | || NlaIV | | | || |BstKTI | | | || ||AciI | | | || ||| BinI* | | | || ||| | MboII | | | || ||| | | TspGWI | | | || ||| | | | TaqI | | | || ||| | | | ClaI | | | || ||| | | | |MboI | | | || ||| | | | || DpnI | | | || ||| | | | || |BstKTI | | | || ||| | | | || || Hpy188I | | | || ||| | | | || || | MlyI | | | || ||| | | | || || | PleI | | | || ||| | | | || || | FatI | | | || ||| | | | || || | |CviAII \ \ \ \\ \\\ \ \ \ \\ \\ \ \\ TGTATGTGATAATACACCCTCCATTGATACGGATCCGCCAGAATATCGATCTTCTGACCA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| ACATACACTATTATGTGGGAGGTAACTATGCCTAGGCGGTCTTATAGCTAGAAGACTGGT / / / // / / /// // / / // EciI | | || | | ||| || | | |PleI | | || | | ||| || | | NlaIII | | || | | ||| || | | MlyI | | || | | ||| || | Hpy188I | | || | | ||| || MboI | | || | | ||| |DpnI | | || | | ||| BstKTI | | || | | ||| ClaI | | || | | ||| TaqI | | || | | ||TspGWI | | || | | |MboII | | || | | BinI* | | || | AciI | | || XhoII | | || BamHI | | || MboI | | |NlaIV | | |DpnI | | BstKTI | BsaBI BinI* MnlI C M * * Y T L H * Y G S A R I S I F * P V C D N T P S I D T D P P E Y R S S D H Y V I I H P P L I R I R Q N I D L L T M ----:----|----:----|----:----|----:----|----:----|----:----| Q I H Y Y V R W Q Y P D A L I D I K Q G S Y T I I C G G N I R I R W F I S R R V T H S L V G E M S V S G G S Y R D E S W MnlI MaeIII | Hin4I | |CviJI NlaIII | || TfiI Hpy178III* | HinfI Hin4I | || HinfI |BceAI \ \ \ \ \\ \ \\ TGCGACTCCTAATATAATGCCTGACAAATCCTCAAAAAATGTTACGGCTGATTCTATTCT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCTGAGGATTATATTACGGACTGTTTAGGAGTTTTTTACAATGCCGACTAAGATAAGA // / / / / / / / |FatI | Hin4I | | | CviJI HinfI | HinfI | | MaeIII TfiI CviAII | Hin4I MnlI C D S * Y N A * Q I L K K C Y G * F Y S A T P N I M P D K S S K N V T A D S I L R L L I * C L T N P Q K M L R L I L F L ----:----|----:----|----:----|----:----|----:----|----:----| H S E * Y L A Q C I R L F H * P Q N * E M R S R I Y H R V F G * F I N R S I R N A V G L I I G S L D E F F T V A S E I R MnlI Hpy188I Hpy178III* | TspGWI SetI | MseI | | CviRI* \ \ \ \ \ \ TGACGACCTCCCACTTCCTGACTTAACCCATAAATCTCCTACGGACACTTCTGATGTTGC 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| ACTGCTGGAGGGTGAAGGACTGAATTGGGTATTTAGAGGATGCCTGTGAAGACTACAACG // / / / / / / / || SetI | | MseI | | CviRI* |BceAI | Hpy178III* | TspGWI Hpy178III* MnlI Hpy188I * R P P T S * L N P * I S Y G H F * C C D D L P L P D L T H K S P T D T S D V A T T S H F L T * P I N L L R T L L M L Q ----:----|----:----|----:----|----:----|----:----|----:----| Q R G G V E Q S L G Y I E * P C K Q H Q K V V E W K R V * G M F R R R V S R I N S S R G S G S K V W L D G V S V E S T A Hpy188I | TspEI | |TaqII TfiI | || BsrI HinfI \ \\ \ \ AAAAGATATTCCACACATACACTCTCGTCAGACTAATTCCAGTTTGGGTGGTATGGATGA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTATAAGGTGTGTATGTGAGAGCAGTCTGATTAAGGTCAAACCCACCATACCTACT / / // / | | |TspEI BseGI | | BsrI | TaqII Hpy188I K R Y S T H T L S S D * F Q F G W Y G * K D I P H I H S R Q T N S S L G G M D D K I F H T Y T L V R L I P V W V V W M I ----:----|----:----|----:----|----:----|----:----|----:----| L L Y E V C V S E D S * N W N P H Y P H C F I N W V Y V R T L S I G T Q T T H I F S I G C M C E R * V L E L K P P I S S MboI MboII FokI | DpnI | MnlI BseGI | Hpy188I | |BstKTI | | TspEI \ \ \ \ \\ \ \ \ TTCTAATGTTCTGACTACTACCAAAAGTAAGAAAAGATCATTAGAAGATAATGAAACTGA 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATTACAAGACTGATGATGGTTTTCATTCTTTTCTAGTAATCTTCTATTACTTTGACT / // // / / / HinfI |FokI || MboI | MnlI TfiI Hpy188I |DpnI MboII BstKTI F * C S D Y Y Q K * E K I I R R * * N * S N V L T T T K S K K R S L E D N E T E L M F * L L P K V R K D H * K I M K L K ----:----|----:----|----:----|----:----|----:----|----:----| N * H E S * * W F Y S F I M L L Y H F Q I R I N Q S S G F T L F S * * F I I F S E L T R V V V L L L F L D N S S L S V S TspDTI | SetI | BsmAI | | AvaI | | Hpy178III* | | |BmeT110I | | || BciVI | | || |FatI | | || ||CviAII Hpy178III* | | || ||| NlaIII | NlaIV MboI \ \ \\ \\\ \ \ \ \ AATTGAGGTATCCCGAGACACATGGAATAATAAGAATATGAGAAGTCTGGAACCACCAAG 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACTCCATAGGGCTCTGTGTACCTTATTATTCTTATACTCTTCAGACCTTGGTGGTTC // //// / / // / / / |SetI |||| | | |FatI | NlaIV BstKTI TspDTI |||| | | CviAII Hpy178III* TspEI |||| | NlaIII |||| BciVI |||AvaI ||BmeT110I |Hpy178III* BsmAI N * G I P R H M E * * E Y E K S G T T K I E V S R D T W N N K N M R S L E P P R L R Y P E T H G I I R I * E V W N H Q D ----:----|----:----|----:----|----:----|----:----|----:----| F Q P I G L C M S Y Y S Y S F D P V V L F N L Y G S V C P I I L I H S T Q F W W I S T D R S V H F L L F I L L R S G G L ApoI TspEI MboII | MseI | |TspEI | || TseI TaqI | || CviRI* ClaI | || |BisI |MboI DpnI | || ||BlsI || DpnI |TaqI | || ||| BdaI || |BstKTI |BstKTI | || ||| BdaI BbvI || || BsrI \\ \ \\ \\\ \ \ \\ \\ \ ATCGAAGAAACGCATAAATTTAATTGCAGCAATAAAAGGAGTGAAATCGATCAAACCAGT 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTCTTTGCGTATTTAAATTAACGTCGTTATTTTCCTCACTTTAGCTAGTTTGGTCA / // / / / ///// / // / / | |TaqI | | | ||||TseI BbvI || | BsrI | MboI | | | ||||BdaI || MboI DpnI | | | ||||BdaI |DpnI | | | |||BisI BstKTI | | | ||BlsI ClaI | | | |CviRI* TaqI | | | TspEI | | MseI | TspEI | ApoI MboII I E E T H K F N C S N K R S E I D Q T S S K K R I N L I A A I K G V K S I K P V R R N A * I * L Q Q * K E * N R S N Q F ----:----|----:----|----:----|----:----|----:----|----:----| I S S V C L N L Q L L L L L S I S * V L S R L F A Y I * N C C Y F S H F R D F W D F F R M F K I A A I F P T F D I L G T TaqI SmlI AsuII AflII | BdaI |MseI BdaI | BdaI |SetI TspEI TspDTI BdaI \ \ \\ \ \ \ TCGAACGACCTTAAGATATGATGAAGCAATTACATATAATAAAGACAACAAAGAAAAAGA 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTGCTGGAATTCTATACTACTTCGTTAATGTATATTATTTCTGTTGTTTCTTTTTCT / / // / / / | SetI |AflII | TspDTI BdaI AsuII |SmlI TspEI BdaI BdaI MseI BdaI TaqI S N D L K I * * S N Y I * * R Q Q R K R R T T L R Y D E A I T Y N K D N K E K D E R P * D M M K Q L H I I K T T K K K T ----:----|----:----|----:----|----:----|----:----|----:----| E F S R L I H H L L * M Y Y L C C L F L N S R G * S I I F C N C I I F V V F F F R V V K L Y S S A I V Y L L S L L S F S HindIII | AluI BdaI | CviJI BdaI | | SetI TspEI CviJI TsoI BciVI \ \ \ \ \ \ \ CAGATATGTTGAAGCTTATCATAAAGAAATTAGCCAACTATTGAAAATGAACACTTGGGA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTATACAACTTCGAATAGTATTTCTTTAATCGGTTGATAACTTTTACTTGTGAACCCT / / / / / / / / | | HindIII | CviJI TsoI BciVI TspDTI | CviJI TspEI | AluI BdaI SetI BdaI Q I C * S L S * R N * P T I E N E H L G R Y V E A Y H K E I S Q L L K M N T W D D M L K L I I K K L A N Y * K * T L G I ----:----|----:----|----:----|----:----|----:----|----:----| C I H Q L K D Y L F * G V I S F S C K P V S I N F S I M F F N A L * Q F H V S P L Y T S A * * L S I L W S N F I F V Q S BinI* | MboI | XhoII | | DpnI TspDTI SspI | | |BstKTI \ \ \ \ \\ TACAAACAAATATTATGATAGAAATGACATAGATCCTAAAAAAGTAATAAACTCAATGTT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTGTTTATAATACTATCTTTACTGTATCTAGGATTTTTTCATTATTTGAGTTACAA / / // / SspI | || XhoII | || MboI | |DpnI | BstKTI BinI* Y K Q I L * * K * H R S * K S N K L N V T N K Y Y D R N D I D P K K V I N S M F Q T N I M I E M T * I L K K * * T Q C L ----:----|----:----|----:----|----:----|----:----|----:----| Y L C I N H Y F H C L D * F L L L S L T I C V F I I I S I V Y I R F F Y Y V * H V F L Y * S L F S M S G L F T I F E I N BccI AluI | MaeII Csp6I CviJI | | SetI |RsaI |MaeI MnlI MseI | | TaiI ||Hpy166II ||SetI | CviRI* \ \ \ \ \\\ \\\ \ \ TATATTTAACAAGAAACGTGATGGTACACACAAAGCTAGATTTGTTGCAAGAGGCGACAT 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAAATTGTTCTTTGCACTACCATGTGTGTTTCGATCTAAACAACGTTCTCCGCTGTA / / / // / / / / / MseI | MaeII || | | MaeI | CviRI* TaiI || | CviJI MnlI SetI || | AluI BccI || SetI |Hpy166II |Csp6I RsaI Y I * Q E T * W Y T Q S * I C C K R R H I F N K K R D G T H K A R F V A R G D I Y L T R N V M V H T K L D L L Q E A T F ----:----|----:----|----:----|----:----|----:----|----:----| * I * C S V H H Y V C L * I Q Q L L R C K Y K V L F T I T C V F S S K N C S A V I N L L F R S P V C L A L N T A L P S M NdeI |Hin4I Tsp4CI* |Hin4I |Csp6I || TfiI ||RsaI || HinfI ||| Hin4I || | Hpy188I ||| Hin4I || | | CviRI* ||| | MslI CviRI* \\ \ \ \ \\\ \ \ \ TCAACACCCCGATACATATGATTCTGATATGCAATCCAATACCGTACATCACTATGCACT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGTGGGGCTATGTATACTAAGACTATACGTTAGGTTATGGCATGTAGTGATACGTGA / / // / / /// / / / Hin4I NdeI || CviRI* | ||| | | CviRI* Hin4I |Hpy188I | ||| | TspRI HinfI | ||| MslI TfiI | ||Csp6I | |RsaI | Hin4I | Hin4I Tsp4CI* S T P R Y I * F * Y A I Q Y R T S L C T Q H P D T Y D S D M Q S N T V H H Y A L N T P I H M I L I C N P I P Y I T M H * ----:----|----:----|----:----|----:----|----:----|----:----| E V G R Y M H N Q Y A I W Y R V D S H V N L V G I C I I R I H L G I G Y M V I C * C G S V Y S E S I C D L V T C * * A S TspRI | AcyI | MaeII Hin4I | |ZraI | AluI | || SetI | CviJI | || TaiI | PvuII | || AatII | NspBII* | || | DrdI | | SetI \ \\ \ \ \ \ \ GATGACGTCATTGTCAATCGCATTAGACAATGACTATTATATCACACAGCTGGACATATC 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCAGTAACAGTTAGCGTAATCTGTTACTGATAATATAGTGTGTCGACCTGTATAG / /// / / / | ||DrdI Hin4I | NspBII* | |MaeII | PvuII | |AcyI | CviJI | ZraI | AluI AatII SetI TaiI SetI D D V I V N R I R Q * L L Y H T A G H I M T S L S I A L D N D Y Y I T Q L D I S * R H C Q S H * T M T I I S H S W T Y P ----:----|----:----|----:----|----:----|----:----|----:----| S S T M T L R M L C H S N Y * V A P C I Q H R * Q * D C * V I V I I D C L Q V Y I V D N D I A N S L S * * I V C S S M D MnlI MnlI Hin4I EcoRV TspEI MboII SetI | BsiYI* \ \ \ \ \ \ \ \ CTCTGCTTACTTATATGCTGATATCAAAGAAGAATTATACATAAGACCTCCACCACATTT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| GAGACGAATGAATATACGACTATAGTTTCTTCTTAATATGTATTCTGGAGGTGGTGTAAA / / / / / / / / | Hin4I EcoRV | | SetI | SetI MnlI | MboII BsiYI* TspEI MnlI L C L L I C * Y Q R R I I H K T S T T F S A Y L Y A D I K E E L Y I R P P P H L L L T Y M L I S K K N Y T * D L H H I * ----:----|----:----|----:----|----:----|----:----|----:----| R Q K S I H Q Y * L L I I C L V E V V N G R S V * I S I D F F F * V Y S R W W M E A * K Y A S I L S S N Y M L G G G C K MaeII | SetI SetI MaeIII | TaiI \ \ \ \ AGGTTTGAATGATAAGTTACTACGTTTGAGAAAATCACTCTATGGTTTGAAACAAAGTGG 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAACTTACTATTCAATGATGCAAACTCTTTTAGTGAGATACCAAACTTTGTTTCACC // / || MaeII |TaiI |SetI MaeIII R F E * * V T T F E K I T L W F E T K W G L N D K L L R L R K S L Y G L K Q S G V * M I S Y Y V * E N H S M V * N K V V ----:----|----:----|----:----|----:----|----:----|----:----| L N S H Y T V V N S F I V R H N S V F H * T Q I I L * * T Q S F * E I T Q F L T P K F S L N S R K L F D S * P K F C L P FatI |CviAII || NspI TspDTI TspEI || CviRI* CviRI* BsrI MseI | MseI | BcgI || NlaIII BccI \ \ \ \ \ \ \ \\ \ \ TGCAAACTGGTATGAAACCATTAAATCATATTTAATAAATTGTTGCGACATGCAAGAAGT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTTTGACCATACTTTGGTAATTTAGTATAAATTATTTAACAACGCTGTACGTTCTTCA / / / / / / / / // CviRI* BsrI | TspDTI MseI | TspEI | |CviRI* MseI BcgI | |FatI | CviAII NlaIII NspI C K L V * N H * I I F N K L L R H A R S A N W Y E T I K S Y L I N C C D M Q E V Q T G M K P L N H I * * I V A T C K K F ----:----|----:----|----:----|----:----|----:----|----:----| H L S T H F W * I M N L L N N R C A L L T C V P I F G N F * I * Y I T A V H L F A F Q Y S V M L D Y K I F Q Q S M C S T FatI BseGI |CviAII || BcgI || NlaIII HindII AciI || | FokI MaeIII Hpy166II FnuDII* || | | MseI | TspEI | FatI \ \\ \ \ \ \ \ \ \ TCGCGGATGGTCATGCGTATTTAAGAATAGTCAAGTAACAATTTGCTTATTCGTTGACGA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGCCTACCAGTACGCATAAATTCTTATCAGTTCATTGTTAAACGAATAAGCAACTGCT / / / / / /// // / / / / | | | | | ||FatI |MseI | TspEI | NlaIII | | | | | |CviAII FokI MaeIII Hpy166II | | | | | BcgI HindII | | | | NlaIII | | | BseGI | | AciI | FnuDII* BccI S R M V M R I * E * S S N N L L I R * R R G W S C V F K N S Q V T I C L F V D D A D G H A Y L R I V K * Q F A Y S L T T ----:----|----:----|----:----|----:----|----:----|----:----| E R I T M R I * S Y D L L L K S I R Q R N A S P * A Y K L I T L Y C N A * E N V R P H D H T N L F L * T V I Q K N T S S CviAII SmlI | NlaIII MseI CviRI* Bce83I* | Hpy178III* \ \ \ \ \ \ \ CATGATTTTATTTAGCAAAGACTTAAATGCAAATAAGAAAATCATAACAACACTCAAGAA 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTAAAATAAATCGTTTCTGAATTTACGTTTATTCTTTTAGTATTGTTGTGAGTTCTT // / / / / |FatI | CviRI* Bce83I* Hpy178III* CviAII MseI SmlI H D F I * Q R L K C K * E N H N N T Q E M I L F S K D L N A N K K I I T T L K K * F Y L A K T * M Q I R K S * Q H S R N ----:----|----:----|----:----|----:----|----:----|----:----| C S K I * C L S L H L Y S F * L L V * S V H N * K A F V * I C I L F D Y C C E L M I K N L L S K F A F L F I M V V S L F SetI | Hin4I | Hin4I | | HphI Csp6I | | | ApoI |RsaI Hin4I | | | TspEI || Hin4I Hin4I TaqII Hin4II* | | | | HphI || Hin4I \ \ \ \ \ \ \ \ \\ \ ACAATACGATACAAAGATAATAAATCTGGGTGAAGGTGATAACGAAATTCAGTACGACAT 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTATGCTATGTTTCTATTATTTAGACCCACTTCCACTATTGCTTTAAGTCATGCTGTA / / / // / / / /// / Hin4I TaqII Hin4II* |Hin4I HphI | | ||| Hin4I Hin4I |Hin4I | | ||| Hin4I SetI | | ||Csp6I | | |RsaI | | Hin4I | | Hin4I | TspEI | ApoI HphI T I R Y K D N K S G * R * * R N S V R H Q Y D T K I I N L G E G D N E I Q Y D I N T I Q R * * I W V K V I T K F S T T Y ----:----|----:----|----:----|----:----|----:----|----:----| V I R Y L S L L D P H L H Y R F E T R C F L V I C L Y Y I Q T F T I V F N L V V C Y S V F I I F R P S P S L S I * Y S M Hin4I Hin4I | TatI | |Csp6I | ||RsaI | |||FatI | |||Hin4I | |||Hin4I MboI | ||||CviAII Hin4I | DpnI | ||||| NlaIII SetI Hin4I | |BstKTI | ||||| |TspEI | TspDTI \ \ \\ \ \\\\\ \\ \ \ ACTTGGATTAGAGATCAAATATCAAAGAAGCAAGTACATGAAATTAGGTATGGAAAAATC 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACCTAATCTCTAGTTTATAGTTTCTTCGTTCATGTACTTTAATCCATACCTTTTTAG // / / / /// // / / || MboI Hin4I | ||| |FatI TspEI TspDTI |DpnI Hin4I | ||| | SetI BstKTI | ||| CviAII | ||TatI | |NlaIII | |Csp6I | RsaI Hin4I Hin4I T W I R D Q I S K K Q V H E I R Y G K I L G L E I K Y Q R S K Y M K L G M E K S L D * R S N I K E A S T * N * V W K N P ----:----|----:----|----:----|----:----|----:----|----:----| V Q I L S * I D F F C T C S I L Y P F I Y K S * L D F I L S A L V H F * T H F F S P N S I L Y * L L L Y M F N P I S F D MaeII | Csp6I | |RsaI | |SetI | |TaiI GsuI TspEI | || SetI Eco57MI DdeI \ \ \\ \ \ \ CTTGACAGAAAAATTACCCAAACTAAACGTACCTTTGAACCCAAAAGGAAAGAAACTTAG 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTGTCTTTTTAATGGGTTTGATTTGCATGGAAACTTGGGTTTTCCTTTCTTTGAATC / / /// / // TspEI | ||Csp6I Eco57MI |HgiJII* | |RsaI GsuI |HgiAI* | |SetI |SacI | MaeII |SduI TaiI |SetI SetI DdeI L D R K I T Q T K R T F E P K R K E T * L T E K L P K L N V P L N P K G K K L R * Q K N Y P N * T Y L * T Q K E R N L E ----:----|----:----|----:----|----:----|----:----|----:----| R S L F I V W V L R V K S G L L F S V * G Q C F F * G F * V Y R Q V W F S L F K K V S F N G L S F T G K F G F P F F S L AluI CviJI Ecl136II | SetI | SduI | SacI | BssKI | EcoRII | HgiAI* | HgiJII* | | ScrFI | | BseBI | | | SetI | | | |HindII | | | |Hpy166II | | | || BssKI | | | || SexAI | | | || EcoRII BssKI | | | || | ScrFI EcoRII | | | || | BseBI | ScrFI BseGI FokI | | | || | | SetI | BseBI |MaeI | TspDTI \ \ \ \\ \ \ \ \ \ \\ \ \ AGCTCCAGGTCAACCAGGTCATTATATAGACCAGGATGAACTAGAAATAGATGAAGATGA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGGTCCAGTTGGTCCAGTAATATATCTGGTCCTACTTGATCTTTATCTACTTCTACT / // / / // / / / / / / / | || | | || EcoRII | | | MaeI | FokI | || | | || SexAI | | BseGI TspDTI | || | | || BssKI | EcoRII | || | | |BseBI | BssKI | || | | |ScrFI BseBI | || | | SetI ScrFI | || | Hpy166II | || | HindII | || EcoRII | || BssKI | |BseBI | |ScrFI | SetI Ecl136II CviJI AluI S S R S T R S L Y R P G * T R N R * R * A P G Q P G H Y I D Q D E L E I D E D E L Q V N Q V I I * T R M N * K * M K M N ----:----|----:----|----:----|----:----|----:----|----:----| L E L D V L D N Y L G P H V L F L H L H S S W T L W T M I Y V L I F * F Y I F I A G P * G P * * I S W S S S S I S S S S MboII |TspDTI || TspDTI TspDTI || | FatI |MmeI || | CviRI* || TspDTI || | |CviAII || | MaeI || | || NlaIII || | | AluI || | || | MwoI || | | CviJI || | || | BstAPI || | | | SetI || | || | | CviRI* || | | | | NdeI \\ \ \\ \ \ \ \\ \ \ \ \ \ ATACAAAGAGAAAGTGCATGAAATGCAAAAGTTGATTGGTCTAGCTTCATATGTTGGATA 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTTTCTCTTTCACGTACTTTACGTTTTCAACTAACCAGATCGAAGTATACAACCTAT / / / // / // / /// / | | | |FatI | || TspDTI ||CviJI NdeI | | | | | |MmeI ||AluI | | | | | TspDTI |MaeI | | | | CviRI* SetI | | | BstAPI | | | CviAII | | | MwoI | | CviRI* | | NlaIII | TspDTI TspDTI MboII I Q R E S A * N A K V D W S S F I C W I Y K E K V H E M Q K L I G L A S Y V G Y T K R K C M K C K S * L V * L H M L D I ----:----|----:----|----:----|----:----|----:----|----:----| I C L S L A H F A F T S Q D L K M H Q I F V F L F H M F H L L Q N T * S * I N S Y L S F T C S I C F N I P R A E Y T P Y ApoI TspEI \ TAAATTTAGATTTGACTTACTATACTACATCAACACACTTGCTCAACATATACTATTCCC 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTAAATCTAAACTGAATGATATGATGTAGTTGTGTGAACGAGTTGTATATGATAAGGG / TspEI ApoI * I * I * L T I L H Q H T C S T Y T I P K F R F D L L Y Y I N T L A Q H I L F P N L D L T Y Y T T S T H L L N I Y Y S P ----:----|----:----|----:----|----:----|----:----|----:----| Y I * I Q S V I S C * C V Q E V Y V I G I F K S K V * * V V D V C K S L M Y * E L N L N S K S Y * M L V S A * C I S N G FatI |CviAII || NlaIII || | NdeI TspEI || | |CspCI | FatI || | || TspDTI | |CviAII MaeI MnlI || | || |MseI | || NlaIII MaeI \ \ \\ \ \\ \\ \ \\ \ \ CTCTAGGCAAGTTTTAGACATGACATATGAGTTAATACAATTCATGTGGGACACTAGAGA 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| GAGATCCGTTCAAAATCTGTACTGTATACTCAATTATGTTAAGTACACCCTGTGATCTCT / / / // / / / / / // / / | MnlI | || | | | MseI | |FatI | CspCI MaeI | || | | TspDTI | CviAII MaeI | || | NdeI NlaIII | || CspCI TspEI | |FatI | CviAII NlaIII L * A S F R H D I * V N T I H V G H * R S R Q V L D M T Y E L I Q F M W D T R D L G K F * T * H M S * Y N S C G T L E I ----:----|----:----|----:----|----:----|----:----|----:----| R * A L K L C S M H T L V I * T P C * L G R P L N * V H C I L * Y L E H P V S S E L C T K S M V Y S N I C N M H S V L S SpeI CspCI |MaeI |BslFI || FalI || TspEI || FalI || | MseI || | SfaNI || | VspI SetI CviJI || | | TspDTI \\ \ \ \ \ \\ \ \ \ TAAACAATTAATATGGCACAAAAACAAACCTACCAAGCCAGATAATAAACTAGTCGCAAT 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTGTTAATTATACCGTGTTTTTGTTTGGATGGTTCGGTCTATTATTTGATCAGCGTTA / // / / / // // | |VspI SetI CviJI FalI |SpeI |SfaNI | |MseI FalI MaeI TspDTI | TspEI BslFI * T I N M A Q K Q T Y Q A R * * T S R N K Q L I W H K N K P T K P D N K L V A I N N * Y G T K T N L P S Q I I N * S Q * ----:----|----:----|----:----|----:----|----:----|----:----| Y V I L I A C F C V * W A L Y Y V L R L I F L * Y P V F V F R G L W I I F * D C L C N I H C L F L G V L G S L L S T A I TsoI NdeI |MaeIII | MaeIII |Tsp45I | BstEII FalI || TspEI | |BtgZI FalI || | MaeIII \ \\ \ \\ \ \ AAGCGATGCTTCATATGGTAACCAACCATATTACAAGTCACAAATTGGTAACATTTTCCT 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCTACGAAGTATACCATTGGTTGGTATAATGTTCAGTGTTTAACCATTGTAAAAGGA / / / / / / / | | BstEII TsoI | TspEI MaeIII | | MaeIII Tsp45I | | BtgZI MaeIII | FalI | FalI NdeI K R C F I W * P T I L Q V T N W * H F P S D A S Y G N Q P Y Y K S Q I G N I F L A M L H M V T N H I T S H K L V T F S Y ----:----|----:----|----:----|----:----|----:----|----:----| L R H K M H Y G V M N C T V F Q Y C K G Y A I S * I T V L W I V L * L N T V N E L S A E Y P L W G Y * L D C I P L M K R MseI |HpaI |HindII |Hpy166II || FatI SalI || |CviAII |TaqI || || NspI |AccI || || CviRI* ||HindII || || NlaIII ||Hpy166II || || | BarI MnlI TspGWI ||| CviJI || || | | SfeI* \ \ \\\ \ \\ \\ \ \ \ ACTCAACGGAAAAGTGATTGGAGGAAAGTCGACAAAGGCTTCGTTAACATGCACTTCAAC 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTGCCTTTTCACTAACCTCCTTTCAGCTGTTTCCGAAGCAATTGTACGTGAAGTTG / / /// / /// /// MnlI TspGWI ||SalI CviJI ||| ||BarI |AccI ||| |CviRI* |TaqI ||| |FatI Hpy166II ||| CviAII HindII ||NlaIII ||NspI |MseI Hpy166II HindII HpaI T Q R K S D W R K V D K G F V N M H F N L N G K V I G G K S T K A S L T C T S T S T E K * L E E S R Q R L R * H A L Q L ----:----|----:----|----:----|----:----|----:----|----:----| V * R F L S Q L F T S L P K T L M C K L * E V S F H N S S L R C L S R * C A S * S L P F T I P P F D V F A E N V H V E V BarI | TspRI | |AluI | |CviJI HphI | || BdaI | DdeI | || BdaI | |SetI | || SetI | || MaeIII | || | AciI | || Tsp45I \ \\ \ \ \ \\ \ TACAGAAGCAGAAATACACGCAGTCAGTGAAGCTATACCGCTATTGAATAACCTCAGTCA 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCTTCGTCTTTATGTGCGTCAGTCACTTCGATATGGCGATAACTTATTGGAGTCAGT / / / / / / // / / SfeI* | BarI | CviJI AciI |SetI | SetI TspRI | AluI HphI DdeI | BdaI | BdaI SetI Y R S R N T R S Q * S Y T A I E * P Q S T E A E I H A V S E A I P L L N N L S H Q K Q K Y T Q S V K L Y R Y * I T S V T ----:----|----:----|----:----|----:----|----:----|----:----| * L L L F V R L * H L * V A I S Y G * D S C F C F Y V C D T F S Y R * Q I V E T V S A S I C A T L S A I G S N F L R L * MnlI |SetI ||DraIII ||| BspCNI MboI ||| |CviRI* | DpnI ||| |BseMII FalI CviJI | |FalI ||| ||BdaI FalI | Hin4I Hin4I | |FalI ||| ||BdaI MseI TspEI MseI | Hin4I Hin4I | |BstKTI \\\ \\\ \ \ \ \ \ \ \ \\ CCTTGTGCAAGAACTTAACAAGAAACCAATTATTAAAGGCTTACTTACTGATAGTAGATC 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| GGAACACGTTCTTGAATTGTTCTTTGGTTAATAATTTCCGAATGAATGACTATCATCTAG / //// / / / // / / / // / | |||CviRI* MseI FalI | || | Hin4I | || MboI | ||BdaI FalI | || | Hin4I | |DpnI | ||BdaI | || CviJI | BstKTI | |BseMII | |Hin4I FalI | BspCNI | |Hin4I FalI Tsp45I | MseI MaeIII TspEI DraIII MnlI P C A R T * Q E T N Y * R L T Y * * * I L V Q E L N K K P I I K G L L T D S R S L C K N L T R N Q L L K A Y L L I V D Q ----:----|----:----|----:----|----:----|----:----|----:----| G Q A L V * C S V L * * L S V * Q Y Y I V K H L F K V L F W N N F A * K S I T S R T C S S L L F G I I L P K S V S L L D MboI | DpnI | |BstKTI AccI | || TspEI Hin4I | || |Hin4I Hin4I | || |Hin4I |Hpy166II ApoI MboII | || || MseI || Ksp632I* TspEI |TspDTI \ \\ \\ \ \\ \ \ \\ AACGATCAGTATAATTAAGTCTACAAATGAAGAGAAATTTAGAAACAGATTTTTTGGCAC 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTAGTCATATTAATTCAGATGTTTACTTCTCTTTAAATCTTTGTCTAAAAAACCGTG // // /// // / // || |Hin4I ||| |AccI Ksp632I* |TspDTI || |Hin4I ||| Hpy166II |MboII || MboI ||MseI TspEI |DpnI |TspEI ApoI BstKTI Hin4I Hin4I N D Q Y N * V Y K * R E I * K Q I F W H T I S I I K S T N E E K F R N R F F G T R S V * L S L Q M K R N L E T D F L A Q ----:----|----:----|----:----|----:----|----:----|----:----| L S * Y L * T * L H L S I * F C I K Q C * R D T Y N L R C I F L F K S V S K K A V I L I I L D V F S S F N L F L N K P V Hin4I Hin4I | MaeII | |BsaAI | |SnaBI | || AccI | || SetI | || TaiI | || |BssNAI | || |Hpy166II Hin4I | || || BsmAI Hin4I SetI | || || Eco31I |BsrDI | TspDTI | || || | TaqI BsmAI || DdeI | |TspEI | || || | |Hpy178III* \ \\ \ \ \\ \ \\ \\ \ \\ AAAGGCAATGAGACTTAGAGATGAAGTATCAGGTAATAATTTATACGTATACTACATCGA 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCGTTACTCTGAATCTCTACTTCATAGTCCATTATTAAATATGCATATGATGTAGCT / / / / / / / / / // // / // | | BsrDI DdeI | | | | | || |AccI | |Hpy178III* | BsmAI | | | | | || | | TaqI Hin4I | | | | | || | Eco31I Hin4I | | | | | || | BsmAI | | | | | || Hpy166II | | | | | || BssNAI | | | | | |MaeII | | | | | SnaBI | | | | | BsaAI | | | | TaiI | | | | SetI | | | TspEI | | Hin4I | | Hin4I | TspDTI SetI K G N E T * R * S I R * * F I R I L H R K A M R L R D E V S G N N L Y V Y Y I E R Q * D L E M K Y Q V I I Y T Y T T S R ----:----|----:----|----:----|----:----|----:----|----:----| L P L S V * L H L I L Y Y N I R I S C R C L C H S K S I F Y * T I I * V Y V V D F A I L S L S S T D P L L K Y T Y * M S Hpy188I Hin4I Hin4I Ksp632I* | MseI BsrDI MboII MboII SetI | MnlI | |AhaIII* \ \ \ \ \ \ \ \\ GACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCTTCCGATAAAAACATTTAAACT 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTTCTTCTTGTAACGACTACACTACTGTTTTGGAGAAGGCTATTTTTGTAAATTTGA / / / / / / /// // | | MboII | SetI | ||Hin4I |MseI | Hin4I MboII | |Ksp632I* AhaIII* BsrDI | MnlI Hpy188I D Q E E H C * C D D K T S S D K N I * T T K K N I A D V M T K P L P I K T F K L P R R T L L M * * Q N L F R * K H L N Y ----:----|----:----|----:----|----:----|----:----|----:----| S W S S C Q Q H S S L V E E S L F M * V L G L L V N S I H H C F R K R Y F C K F V L F F M A S T I V F G R G I F V N L S MboI BglII XhoII | DpnI | |BstKTI TfiI | || TaqII MseI TspDTI HinfI | || |MmeI \ \ \ \ \\ \\ ATTAACTAACAAATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGGAATAAAA 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTGATTGTTTACCTAAGTAATCTAGATAATGTAATACCCACCATACAACCTTATTTT / / / //// | TspDTI HinfI |||XhoII MseI TfiI |||BglII |||MboI |||MmeI ||TaqII |DpnI BstKTI I N * Q M D S L D L L H Y G W Y V G I K L T N K W I H * I Y Y I M G G M L E * K * L T N G F I R S I T L W V V C W N K N ----:----|----:----|----:----|----:----|----:----|----:----| I L * C I S E N S R N C * P H Y T P I F * * S V F P N M L D I V N H T T H Q F L N V L L H I * * I * * M I P P I N S Y F MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI Tsp4CI* \\ \\ \ \\ \ ATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTA 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATATAATAGTATATGCCACAAT // / / / // / |SpeI | | | |SpeI Tsp4CI* MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI I N Y H L L T S I Y V T S I L S Y T V L S T I I Y * L V F T L L V Y Y H I R C * Q L S S T N * Y L R Y * Y I I I Y G V R ----:----|----:----|----:----|----:----|----:----|----:----| I L * * R S V L I * T V L I N D Y V T N F * S D D V L * Y K R * * Y I I M Y P T D V I M * * S T N V N S T Y * * I R H * Hin4I Hin4I | AluI | MboII | CviJI | | HgaI TspEI | | SetI \ \ \ \ \ \ \ GAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGA 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCACCTTCGACTTTGCGTTCCT / / / // / / Hin4I MboII HgaI |TspEI | CviJI Hin4I | AluI SetI E D D A N D E K * S S K L V E A E T Q G K M T Q M M R N S H L N * W K L K R K D R * R K * * E I V I * I S G S * N A R I ----:----|----:----|----:----|----:----|----:----|----:----| S S S A F S S F Y D D L N T S A S V C P L L H R L H H S I T M * I L P L Q F A L F I V C I I L F L * R F * H F S F R L S MboI | DpnI | |BstKTI | || BinI* | || | SspI | || | | MseI TspDTI SspI \ \\ \ \ \ \ \ TTGATAATGTAATAGGATCAATGAATATTAACATATAAAACGATGATAATAATATTTATA 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| AACTATTACATTATCCTAGTTACTTATAATTGTATATTTTGCTACTATTATTATAAATAT // / / / / / / || MboI | | | TspDTI SspI |DpnI | | MseI BstKTI | SspI BinI* L I M * * D Q * I L T Y K T M I I I F I * * C N R I N E Y * H I K R * * * Y L * D N V I G S M N I N I * N D D N N I Y R ----:----|----:----|----:----|----:----|----:----|----:----| N I I Y Y S * H I N V Y L V I I I I N I I S L T I P D I F I L M Y F S S L L I * Q Y H L L I L S Y * C I F R H Y Y Y K Y TspEI | CviRI* BsiYI* | | TfiI | TfiI MnlI TspEI | | HinfI | HinfI | SmlI MaeI \ \ \ \ \ \ \ \ \ GAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTTGAGGAGAACTTCT 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAACTCCTCTTGAAGA / // / / / / / TspEI || | BsiYI* | MnlI SmlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI E L C R I A D S L L W I P K S L R R T S N C V E L Q I P F Y G F L N P * G E L L I V * N C R F P F M D S * I L E E N F * ----:----|----:----|----:----|----:----|----:----|----:----| S N H L I A S E R K H I G L D K L L V E L I T Y F Q L N G K I S E * I R S S F K F Q T S N C I G K * P N R F G Q P S S R BseRI SetI CviJI TfiI | Bce83I* | SspI | MseI HinfI TspEI \ \ \ \ \ \ \ \ AGTATATCTACATACCTAATATTATAGCCTTAATCACAATGGAATCCCAACAATTACATC 5890 5900 5910 5920 5930 5940 ----:----|----:----|----:----|----:----|----:----|----:----| TCATATAGATGTATGGATTATAATATCGGAATTAGTGTTACCTTAGGGTTGTTAATGTAG / / / / / / / / | Bce83I* SetI SspI | MseI HinfI TspEI BseRI CviJI TfiI MaeI S I S T Y L I L * P * S Q W N P N N Y I V Y L H T * Y Y S L N H N G I P T I T S Y I Y I P N I I A L I T M E S Q Q L H Q ----:----|----:----|----:----|----:----|----:----|----:----| L I D V Y R I N Y G * D C H F G L L * M * Y I * M G L I I A K I V I S D W C N C T Y R C V * Y * L R L * L P I G V I V D AAAATCCACATTCTCTACA 5950 ----:----|----:---- TTTTAGGTGTAAGAGATGT K I H I L Y X K S T F S T N P H S L X ----:----|----:---- L I W M R * * F G C E R C F D V N E V # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 Acc65I 1 Asp718I AccI 5 FblI,XmiI AciI 5 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 3 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 19 AluBI AlwNI 1 CaiI ApaLI 2 Alw44I,VneI ApoI 11 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BarI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BccI 10 Bce83I* 7 BpuEI BceAI 5 BcgI 2 BciVI 2 BfuI BclI 4 FbaI,Ksp22I BdaI 10 BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 11 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 3 BmtI 1 BspOI BsaAI 3 BstBAI,Ppu21I BsaBI 3 Bse8I,BseJI BseBI 7 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseMII 3 BseRI 3 BseSI 3 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 6 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspHI 2 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 28 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 3 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 4 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 26 CviQI,RsaNI CspCI 1 CviAII 25 CviJI 40 CviKI-1 CviRI* 24 HpyCH4V DdeI 11 BstDEI,HpyF3I DpnI 28 MalI DraIII 2 AdeI DrdI 2 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoP15I 2 EcoRII 7 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 6 FatI 25 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 GlaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 28 Hin4II* 7 HpyAV Hin6I 1 HinP1I,HspAI HindII 8 HincII HindIII 1 HinfI 27 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 13 AsuHPI Hpy166II 22 Hpy8I Hpy178III* 20 Hpy188III Hpy188I 24 Hpy99I 1 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 18 FspBI,BfaI,XspI MaeII 14 HpyCH4IV MaeIII 16 MboI 28 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 20 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 3 SchI MmeI 3 MnlI 25 MseI 40 Tru1I,Tru9I MslI 7 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NdeI 6 FauNDI NheI 1 AsuNHI NlaIII 25 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 4 MspA1I NspI 7 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI PpiI 1 PshAI 1 BstPAI,BoxI PvuII 2 RsaI 26 AfaI SacI 1 Psp124BI,SstI SalI 1 ScaI 3 BmcAI,AssI,ZrmI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 76 SexAI 2 MabI SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 10 SmoI SnaBI 2 Eco105I,BstSNI SpeI 5 BcuI,AhlI SphI 1 PaeI,BbuI SspI 10 TaiI 14 TaqI 14 TaqII 8 TatI 8 TfiI 24 PfeI TseI 3 ApeKI TsoI 7 Tsp45I 5 NmuCI Tsp4CI* 17 HpyCH4III,TaaI,Bst4CI TspDTI 27 TspEI 51 TasI,Tsp509I,Sse9I TspGWI 9 TspRI 7 TscAI TstI 1 VspI 5 PshBI,AseI XbaI 1 XcmI 3 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AbsI AclI AjuI AlfI AloI ApaI AscI AvrII BalI BbvCI BbvII* BglI BplI Bpu10I BsaXI BsePI BseYI Bsp120I BspLU11I* BspMII* BsrBI BstXI CauII* Cfr9I CfrI DinI DraII Eco47III EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI KasI MauBI MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TauI TspMI Tth111I XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769