Restriction Map of SNF1/YDR477W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SNF1/YDR477W on chromosome IV from coordinates 1412373 to 1414274.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19362

AarI BspMI |CviRI* || ApoI || TspEI AlwNI || | MaeI MaeIII | SetI || | | CviJI HphI \ \ \ \\ \ \ \ \ ATGAGCAGTAACAACAACACAAACACAGCACCTGCCAATGCAAATTCTAGCCACCACCAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGTCATTGTTGTTGTGTTTGTGTCGTGGACGGTTACGTTTAAGATCGGTGGTGGTG / // / / / // / MaeIII |SetI | | | |CviJI HphI AlwNI | | | MaeI | | TspEI | | ApoI | BspMI | AarI CviRI* M S S N N N T N T A P A N A N S S H H H * A V T T T Q T Q H L P M Q I L A T T T E Q * Q Q H K H S T C Q C K F * P P P P ----:----|----:----|----:----|----:----|----:----|----:----| X L L L L L V F V A G A L A F E L W W W X S C Y C C C L C L V Q W H L N * G G G H A T V V V C V C C R G I C I R A V V V XcmI Tsp4CI* |MslI TaqI |BccI | EciI ||FatI | |Hpy99I TsoI |||CviAII | || FalI | HphI |||| NlaIII | || FalI | | BccI BccI |||| |AciI | || | HgaI \ \ \ \ \\\\ \\ \ \\ \ \ CACCATCACCACCATCACCACCACCATCACGGTCATGGCGGAAGCAACTCGACGCTAAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTAGTGGTGGTAGTGGTGGTGGTAGTGCCAGTACCGCCTTCGTTGAGCTGCGATTTG / / / / / // // / / / / | HphI BccI BccI | || || AciI | | FalI TsoI | || |FatI | | FalI | || CviAII | EciI | |NlaIII | TaqI | |BccI Hpy99I | MslI Tsp4CI* XcmI H H H H H H H H H H G H G G S N S T L N T I T T I T T T I T V M A E A T R R * T P S P P S P P P S R S W R K Q L D A K Q ----:----|----:----|----:----|----:----|----:----|----:----| W W * W W * W W W * P * P P L L E V S F G G D G G D G G G D R D H R F C S S A L V M V V M V V V M V T M A S A V R R * V MwoI |ApaLI ||BseGI |||CviRI* |||Hpy166II |||| SduI |||| FalI |||| FalI DdeI |||| BseSI Bpu10I |||| HgiAI* |BccI |||| | FokI MnlI || AciI |||| | | Hpy178III* BseYI \\ \ \\\\ \ \ \ \ AATCCCAAGTCGTCCTTAGCGGATGGTGCACATATCGGGAACTACCAAATCGTCAAAACG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGGTTCAGCAGGAATCGCCTACCACGTGTATAGCCCTTGATGGTTTAGCAGTTTTGC / // // // / / / // HgaI || || || | ApaLI Hpy178III* |GsaI || || || Hpy166II FokI MnlI || || || CviRI* || || |HgiAI* || || |BseSI || || |SduI || || BseGI || || FalI || || FalI || |MwoI || AciI |Bpu10I |DdeI BccI N P K S S L A D G A H I G N Y Q I V K T I P S R P * R M V H I S G T T K S S K R S Q V V L S G W C T Y R E L P N R Q N A ----:----|----:----|----:----|----:----|----:----|----:----| L G L D D K A S P A C I P F * W I T L V C D W T T R L P H H V Y R S S G F R * F I G L R G * R I T C M D P V V L D D F R AsuI* AvaII DraII AsuI* PpuMI |BmgT120I |NlaIV MseI ||CviJI GsaI |BmgT120I | TspEI ||HaeIII \ \\ \ \ \\\ CTGGGAGAGGGGTCCTTTGGTAAAGTTAAATTGGCATATCATACCACTACGGGCCAAAAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GACCCTCTCCCCAGGAAACCATTTCAATTTAACCGTATAGTATGGTGATGCCCGGTTTTT / /// / / // BseYI ||PpuMI | TspEI |AsuI* ||DraII MseI BmgT120I ||AvaII HaeIII ||AsuI* CviJI |BmgT120I NlaIV L G E G S F G K V K L A Y H T T T G Q K W E R G P L V K L N W H I I P L R A K K G R G V L W * S * I G I S Y H Y G P K S ----:----|----:----|----:----|----:----|----:----|----:----| S P S P D K P L T L N A Y * V V V P W F A P L P T R Q Y L * I P M D Y W * P G F Q S L P G K T F N F Q C I M G S R A L F MseI VspI |Hin4II* SetI CviRI* TspEI \\ \ \ \ GTTGCTCTAAAAATCATTAATAAGAAGGTTTTGGCAAAGAGTGATATGCAGGGCAGAATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGAGATTTTTAGTAATTATTCTTCCAAAACCGTTTCTCACTATACGTCCCGTCTTAA / / / / / | VspI SetI CviRI* TspEI | MseI Hin4II* V A L K I I N K K V L A K S D M Q G R I L L * K S L I R R F W Q R V I C R A E L C S K N H * * E G F G K E * Y A G Q N * ----:----|----:----|----:----|----:----|----:----|----:----| T A R F I M L L F T K A F L S I C P L I L Q E L F * * Y S P K P L S H Y A P C F N S * F D N I L L N Q C L T I H L A S N BseMII |BspCNI || BsmAI || | MlyI || | PleI || | | DdeI || | | |Hpy188I || | | || HinfI || | | || | SmlI || | | || | AflII || | | || | |MseI Tsp4CI* \\ \ \ \\ \ \\ \ GAAAGAGAAATATCTTATCTGAGACTCTTAAGACACCCCCACATCATCAAACTGTATGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTCTTTATAGAATAGACTCTGAGAATTCTGTGGGGGTGTAGTAGTTTGACATACTA // /// / / // / |BspCNI ||| | | |AflII Tsp4CI* BseMII ||| | | |SmlI ||| | | MseI ||| | HinfI ||| DdeI ||Hpy188I ||BsmAI |PleI MlyI E R E I S Y L R L L R H P H I I K L Y D K E K Y L I * D S * D T P T S S N C M M K R N I L S E T L K T P P H H Q T V * C ----:----|----:----|----:----|----:----|----:----|----:----| S L S I D * R L S K L C G W M M L S Y S Q F L F I K D S V R L V G G C * * V T H F S F Y R I Q S E * S V G V D D F Q I I Csp6I |RsaI || BssKI || |HpaII || ||ScrFI TsoI TspDTI || ||CauII* TspEI \ \ \\ \\\ \ GTTATCAAATCCAAAGATGAAATCATTATGGTTATAGAGTACGCCGGGAACGAATTGTTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAATAGTTTAGGTTTCTACTTTAGTAATACCAATATCTCATGCGGCCCTTGCTTAACAAA / / // / / / TsoI TspDTI || | BssKI TspEI || CauII* || HpaII || ScrFI |Csp6I RsaI V I K S K D E I I M V I E Y A G N E L F L S N P K M K S L W L * S T P G T N C L Y Q I Q R * N H Y G Y R V R R E R I V * ----:----|----:----|----:----|----:----|----:----|----:----| T I L D L S S I M I T I S Y A P F S N N H * * I W L H F * * P * L T R R S R I T N D F G F I F D N H N Y L V G P V F Q K BceAI BsmAI MnlI |MboII | Hpy188I |Cac8I || MboI \ \ \\ \\ \ GACTATATTGTTCAGAGAGACAAAATGAGCGAGCAAGAGGCAAGAAGATTTTTCCAGCAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATATAACAAGTCTCTCTGTTTTACTCGCTCGTTCTCCGTTCTTCTAAAAAGGTCGTC / / / / / / / | BsmAI | Cac8I | | BstKTI Hpy188I MnlI | BceAI MboII D Y I V Q R D K M S E Q E A R R F F Q Q T I L F R E T K * A S K R Q E D F S S R L Y C S E R Q N E R A R G K K I F P A D ----:----|----:----|----:----|----:----|----:----|----:----| S * I T * L S L I L S C S A L L N K W C Q S Y Q E S L C F S R A L P L F I K G A V I N N L S V F H A L L L C S S K E L L TspRI MboI | TaqI BglII | | Hpy99I XhoII | | |TatI | DpnI | | ||Csp6I | |BstKTI DpnI | | |||RsaI | || Hpy188I |BstKTI | | |||ScaI EcoP15I TspEI | || | CviJI \\ \ \ \\\\ \ \ \ \\ \ \ ATCATCAGTGCCGTCGAGTACTGCCATAGGCACAAAATTGTCCATAGAGATCTGAAGCCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAGTCACGGCAGCTCATGACGGTATCCGTGTTTTAACAGGTATCTCTAGACTTCGGA / / / / /// / / // / / | TspRI | | ||TatI EcoP15I TspEI || | CviJI | MboI | | |Csp6I || Hpy188I DpnI | | ScaI || XhoII | | RsaI || BglII | TaqI || MboI Hpy99I |DpnI BstKTI I I S A V E Y C H R H K I V H R D L K P S S V P S S T A I G T K L S I E I * S L H Q C R R V L P * A Q N C P * R S E A * ----:----|----:----|----:----|----:----|----:----|----:----| I M L A T S Y Q W L C L I T W L S R F G S * * H R R T S G Y A C F Q G Y L D S A D D T G D L V A M P V F N D M S I Q L R MaeI Eco57I MslI Eco57MI Hpy188I | BsaBI | SfaNI \ \ \ \ GAAAACTTACTACTAGATGAGCATCTGAATGTAAAGATTGCCGATTTTGGTTTGTCAAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGAATGATGATCTACTCGTAGACTTACATTTCTAACGGCTAAAACCAAACAGTTTG / / / // / | MaeI | |MslI SfaNI Eco57MI | Hpy188I Eco57I BsaBI E N L L L D E H L N V K I A D F G L S N K T Y Y * M S I * M * R L P I L V C Q T K L T T R * A S E C K D C R F W F V K H ----:----|----:----|----:----|----:----|----:----|----:----| S F K S S S S C R F T F I A S K P K D F Q F S V V L H A D S H L S Q R N Q N T L F V * * * I L M Q I Y L N G I K T Q * V AciI FatI |BisI BspHI ||BlsI |CviAII |||TauI |Hpy178III* |||CviJI ||BccI ||||NlaIV ||| NlaIII TspEI MseI TspEI ||||| Hpy178III* \\\ \ \ \ \ \\\\\ \ ATCATGACTGATGGTAATTTCTTAAAGACTTCTTGTGGTTCTCCCAATTATGCGGCTCCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTACTGACTACCATTAAAGAATTTCTGAAGAACACCAAGAGGGTTAATACGCCGAGGA / // / / / ///// / | |BspHI | MseI | ||||| Hpy178III* | |FatI TspEI | ||||NlaIV | Hpy178III* | |||CviJI | CviAII | ||BisI | BccI | ||AciI NlaIII | |BlsI | TauI TspEI I M T D G N F L K T S C G S P N Y A A P S * L M V I S * R L L V V L P I M R L L H D * W * F L K D F L W F S Q L C G S * ----:----|----:----|----:----|----:----|----:----|----:----| M M V S P L K K F V E Q P E G L * A A G C * S Q H Y N R L S K K H N E W N H P E D H S I T I E * L S R T T R G I I R S R AciI NspBII* | AluI | CviJI | | SetI | | Eco57I | | Eco57MI | | | Cac8I | | | |AsuI* | | | ||CviJI | | | ||HaeIII | | | ||BmgT120I | | | ||| Hin4I | | | ||| Hin4I | | | ||| | BsiYI* | | | ||| | | Hpy166II | | | ||| | | | MaeII | | | ||| | | | AflIII | | | ||| | | | |BtrI | | | ||| | | | || SetI | | | ||| | | | || TaiI | | | ||| | | | || |Eam1105I | | | ||| | | | || || FatI | | |Csp6I ||| | | | || || |CviAII | | ||RsaI ||| | | | || || || NlaIII \ \ \\\ \\\ \ \ \ \\ \\ \\ \ GAAGTTATCAGCGGTAAGCTGTACGCAGGCCCAGAAGTGGACGTGTGGTCATGTGGGGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAATAGTCGCCATTCGACATGCGTCCGGGTCTTCACCTGCACACCAGTACACCCCAA / / / / // // /// / // //// / // / | | | | || || ||| | || |||| | |FatI Hin4I | | | | || || ||| | || |||| | | Hin4I | | | | || || ||| | || |||| | CviAII | | | | || || ||| | || |||| NlaIII | | | | || || ||| | || |||AflIII | | | | || || ||| | || ||Eam1105I | | | | || || ||| | || |MaeII | | | | || || ||| | || BtrI | | | | || || ||| | |TaiI | | | | || || ||| | |SetI | | | | || || ||| | Hpy166II | | | | || || ||| BsiYI* | | | | || || ||AsuI* | | | | || || |BmgT120I | | | | || || HaeIII | | | | || || CviJI | | | | || |Cac8I | | | | || Hin4I | | | | || Hin4I | | | | |Csp6I | | | | RsaI | | | Eco57MI | | | Eco57I | | | CviJI | | | AluI | | SetI | AciI NspBII* E V I S G K L Y A G P E V D V W S C G V K L S A V S C T Q A Q K W T C G H V G L S Y Q R * A V R R P R S G R V V M W G Y ----:----|----:----|----:----|----:----|----:----|----:----| S T I L P L S Y A P G S T S T H D H P T Q L * * R Y A T R L G L L P R T T M H P F N D A T L Q V C A W F H V H P * T P N Hpy99I BfiI |AccI |BseGI ||Hpy166II || BsrI ||| Tsp4CI* || MslI ||| | FokI || | SfaNI Hin4I ||| | | AlfI || | TspDTI Hin4I ||| | | AlfI || | | TspRI \ \\\ \ \ \ \\ \ \ \ ATCCTTTATGTTATGCTTTGTCGTCGTCTACCGTTTGACGATGAAAGCATCCCAGTGCTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAAATACAATACGAAACAGCAGCAGATGGCAAACTGCTACTTTCGTAGGGTCACGAA / // / / / / / / / / Hpy99I || | | FokI | | | | SfaNI || | AlfI | | | TspDTI || | AlfI | | MslI || Tsp4CI* | TspRI |AccI | BsrI Hpy166II BseGI BfiI I L Y V M L C R R L P F D D E S I P V L S F M L C F V V V Y R L T M K A S Q C F P L C Y A L S S S T V * R * K H P S A F ----:----|----:----|----:----|----:----|----:----|----:----| I R * T I S Q R R R G N S S S L M G T S * G K H * A K D D D V T Q R H F C G L A D K I N H K T T T * R K V I F A D W H K PfoI BssKI EcoRII | ScrFI | BseBI | | TseI | | AluI | | CviJI Tsp4CI* | | |BisI Hpy178III* | Hpy166II ApoI | | ||BlsI | AlfI | | EcoP15I TspEI | | ||SetI | AlfI | | | SetI | BbvI | | |||BseYI \ \ \ \ \ \ \ \ \ \ \\\\ TTCAAGAATATCAGCAACGGTGTTTACACCTTGCCTAAATTTTTATCTCCTGGAGCTGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTTATAGTCGTTGCCACAAATGTGGAACGGATTTAAAAATAGAGGACCTCGACGA / / / / / / / / / / //// | AlfI | | | EcoP15I | BbvI | | |||TseI | AlfI | | SetI TspEI | | |||GsaI Hpy178III* | Hpy166II ApoI | | ||BisI Tsp4CI* | | |BlsI | | CviJI | | AluI | EcoRII | BssKI | PfoI | SetI BseBI ScrFI F K N I S N G V Y T L P K F L S P G A A S R I S A T V F T P C L N F Y L L E L L Q E Y Q Q R C L H L A * I F I S W S C W ----:----|----:----|----:----|----:----|----:----|----:----| K L F I L L P T * V K G L N K D G P A A K * S Y * C R H K C R A * I K I E Q L Q E L I D A V T N V G Q R F K * R R S S S BsmI | FatI | BspHI | |CviAII | |Hpy178III* GsaI GsuI | || NlaIII |CviJI Eco57MI MseI MseI TspDTI | || |TspEI \\ \ \ \ \ \ \\ \\ GGGCTAATCAAAAGAATGTTAATCGTTAATCCATTGAACAGAATAAGCATTCATGAAATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGATTAGTTTTCTTACAATTAGCAATTAGGTAACTTGTCTTATTCGTAAGTACTTTAA // / / / / / / // / |CviJI Eco57MI MseI MseI TspDTI BsmI | || TspEI BseYI GsuI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII G L I K R M L I V N P L N R I S I H E I G * S K E C * S L I H * T E * A F M K L A N Q K N V N R * S I E Q N K H S * N Y ----:----|----:----|----:----|----:----|----:----|----:----| P S I L L I N I T L G N F L I L M * S I Q A L * F F T L R * D M S C F L C E H F P * D F S H * D N I W Q V S Y A N M F N HindII CviRI* Hpy166II CspCI | TspDTI | SetI BspMI \ \ \ \ \ ATGCAAGACGATTGGTTCAAAGTTGACCTGCCAGAATATCTACTTCCACCAGATTTGAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTCTGCTAACCAAGTTTCAACTGGACGGTCTTATAGATGAAGGTGGTCTAAACTTT / / // / / | TspDTI |SetI CspCI BspMI CviRI* Hpy166II HindII M Q D D W F K V D L P E Y L L P P D L K C K T I G S K L T C Q N I Y F H Q I * N A R R L V Q S * P A R I S T S T R F E T ----:----|----:----|----:----|----:----|----:----|----:----| I C S S Q N L T S R G S Y R S G G S K F * A L R N T * L Q G A L I D V E V L N S H L V I P E F N V Q W F I * K W W I Q F TseI |BisI |BseGI ||BlsI |||TseI TaqII ||||BisI | MboII |||||BlsI | | MlyI HinfI ||||||CviJI Ksp632I* | | PleI | TspDTI ||||||| FokI | CspCI | | MboII | | BccI ||||||| | BbvI \ \ \ \ \ \ \ \ \\\\\\\ \ \ CCACACCCAGAAGAAGAGAATGAAAATAATGACTCAAAAAAGGATGGCAGCAGCCCAGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTGGGTCTTCTTCTCTTACTTTTATTACTGAGTTTTTTCCTACCGTCGTCGGGTCTA / / / / /// // / / ////// / | | | | ||PleI || BccI | |||||CviJI FokI | | | | |MlyI |HinfI | |||||TseI | | | | MboII TspDTI | ||||BisI | | | MboII | |||BlsI | | TaqII | ||TseI | Ksp632I* | |BisI CspCI | BlsI BseGI P H P E E E N E N N D S K K D G S S P D H T Q K K R M K I M T Q K R M A A A Q I T P R R R E * K * * L K K G W Q Q P R * ----:----|----:----|----:----|----:----|----:----|----:----| G C G S S S F S F L S E F F S P L L G S V V G L L L S H F Y H S L F P H C C G L W V W F F L I F I I V * F L I A A A W I TaqI | FatI | NcoI | StyI | SecI* EcoP15I | DsaI* | TspDTI | |CviAII | | DrdI | || NlaIII BbvI TspEI | | |SetI SspI | || |MaeIII \ \ \ \ \\ \ \ \\ \\ AACGATGAAATTGATGACAACCTTGTCAATATTTTATCATCGACCATGGGTTACGAAAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTACTTTAACTACTGTTGGAACAGTTATAAAATAGTAGCTGGTACCCAATGCTTTTT / / / /// / / / // / | BbvI TspEI ||EcoP15I SspI | | |DsaI* MaeIII BbvI ||DrdI | | |SecI* |SetI | | |StyI TspDTI | | |NcoI | | |FatI | | CviAII | NlaIII TaqI N D E I D D N L V N I L S S T M G Y E K T M K L M T T L S I F Y H R P W V T K K R * N * * Q P C Q Y F I I D H G L R K R ----:----|----:----|----:----|----:----|----:----|----:----| L S S I S S L R T L I K D D V M P * S F Y R H F Q H C G Q * Y K I M S W P N R F V I F N I V V K D I N * * R G H T V F F HinfI | DdeI | | PleI BbvII* | | |TfiI | BsmI | | |MlyI | MboII | | |HinfI Hpy188I | CviRI* TspEI \ \ \\ \ \ \ \ GACGAGATTTATGAGTCCTTAGAATCATCAGAAGACACTCCTGCATTCAACGAAATTAGG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTCTAAATACTCAGGAATCTTAGTAGTCTTCTGTGAGGACGTAAGTTGCTTTAATCC / // / / /// / | || | Hpy188I ||CviRI* TspEI | || HinfI |BbvII* | || TfiI |MboII | |PleI BsmI | |MlyI | DdeI HinfI D E I Y E S L E S S E D T P A F N E I R T R F M S P * N H Q K T L L H S T K L G R D L * V L R I I R R H S C I Q R N * G ----:----|----:----|----:----|----:----|----:----|----:----| S S I * S D K S D D S S V G A N L S I L L R S K H T R L I M L L C E Q M * R F * V L N I L G * F * * F V S R C E V F N P MluI AflIII | FnuDII* | | Csp6I | | |RsaI | | ||FatI | | ||AflIII | | ||BspLU11I* | | |||CviAII | | ||||HgaI MboI | | ||||| NspI BclI | | ||||| NlaIII | DpnI | | ||||| |Hin4I | |BstKTI | | ||||| |BslFI | || Hin4II* | | ||||| || MseI | || | Hin4I HgaI \ \ \\\\\ \\ \ \ \\ \ \ \ GACGCGTACATGTTGATTAAGGAGAATAAATCTTTGATCAAGGATATGAAGGCAAACAAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGCATGTACAACTAATTCCTCTTATTTAGAAACTAGTTCCTATACTTCCGTTTGTTT / /// // / / / // /// / / | ||| || | | MseI || ||Hin4II* | TspDTI | ||| || | BslFI || |Hin4I HgaI | ||| || HgaI || BclI | ||| |BspLU11I* || MboI | ||| |AflIII |DpnI | ||| |FatI BstKTI | ||| CviAII | ||NlaIII | ||Csp6I | ||Hin4I | ||NspI | |RsaI | AflIII | MluI FnuDII* D A Y M L I K E N K S L I K D M K A N K T R T C * L R R I N L * S R I * R Q T K R V H V D * G E * I F D Q G Y E G K Q K ----:----|----:----|----:----|----:----|----:----|----:----| S A Y M N I L S F L D K I L S I F A F L P R T C T S * P S Y I K S * P Y S P L C V R V H Q N L L I F R Q D L I H L C V F SetI |TspDTI ||BfiI BciVI ||| HphI TspRI ||| | BsrI | BslFI ||| | | MaeIII TspDTI | | BsrI ||| | | Tsp45I SetI MnlI \ \ \ \ \\\ \ \ \ \ \ AGCGTCAGTGATGAACTGGATACCTTTCTGTCCCAGTCACCTCCAACTTTTCAACAACAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCAGTCACTACTTGACCTATGGAAAGACAGGGTCAGTGGAGGTTGAAAAGTTGTTGTT / / // / / / / / / / / TspRI BciVI || | | | | BsrI | Tsp45I MnlI || | | | HphI | MaeIII || | | BfiI SetI || | TspDTI || SetI |BslFI BsrI S V S D E L D T F L S Q S P P T F Q Q Q A S V M N W I P F C P S H L Q L F N N K R Q * * T G Y L S V P V T S N F S T T K ----:----|----:----|----:----|----:----|----:----|----:----| L T L S S S S V K R D W D G G V K * C C F R * H H V P Y R E T G T V E L K E V V A D T I F Q I G K Q G L * R W S K L L L PleI |MboI |MlyI || DpnI || |FatI || |BspHI || |BstKTI TspDTI || ||CviAII | Hin4II* BccI || ||Hpy178III* | |TstI MmeI |HinfI || ||| NlaIII | || BccI \ \\ \\ \\\ \ \ \\ \ AGCAAATCCCATCAAAAGAGTCAAGTAGATCATGAAACTGCCAAGCAACACGCAAGAAGG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTTAGGGTAGTTTTCTCAGTTCATCTAGTACTTTGACGGTTCGTTGTGCGTTCTTCC / / / ///// // // / / MmeI | HinfI ||||| |BspHI || | BccI BccI ||||| |FatI || Hin4II* ||||| Hpy178III* |TstI ||||| CviAII TspDTI ||||MboI |||NlaIII ||DpnI |BstKTI PleI MlyI S K S H Q K S Q V D H E T A K Q H A R R A N P I K R V K * I M K L P S N T Q E G Q I P S K E S S R S * N C Q A T R K K D ----:----|----:----|----:----|----:----|----:----|----:----| L L D W * F L * T S * S V A L C C A L L F C I G D F S D L L D H F Q W A V R L F A F G M L L T L Y I M F S G L L V C S P FatI |CviAII || MboI || NlaIII || | DpnI || | |BstKTI TstI HphI || | |Hin4II* BseGI FokI | HphI | TspDTI || | || BinI* \ \ \ \ \ \ \\ \ \\ \ ATGGCAAGTGCTATCACTCAACAAAGGACATATCACCAATCACCCTTCATGGATCAGTAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTTCACGATAGTGAGTTGTTTCCTGTATAGTGGTTAGTGGGAAGTACCTAGTCATA / / / / / / / //// / / BseGI | TstI HphI | TspDTI | |||| MboI BinI* FokI HphI | |||Hin4II* | |||DpnI | ||BstKTI | |FatI | CviAII NlaIII M A S A I T Q Q R T Y H Q S P F M D Q Y W Q V L S L N K G H I T N H P S W I S I G K C Y H S T K D I S P I T L H G S V * ----:----|----:----|----:----|----:----|----:----|----:----| I A L A I V * C L V Y * W D G K M S * Y S P L H * * E V F S M D G I V R * P D T H C T S D S L L P C I V L * G E H I L I BinI* | DdeI | |SetI | || MboI | || XhoII | || Hpy188I | || | DpnI | || | |BstKTI | || | || MnlI HinfI | || | || | BspCNI | SfeI* | || | || | |AluI | BbvII* | || | || | |CviJI | | MboII | || | || | |BseMII MlyI | | | Tsp4CI* | || | || | ||BcgI PleI | | | |MboII | || | || | |||SetI \ \ \ \ \\ \ \\ \ \\ \ \\\\ AAAGAAGAAGACTCTACAGTTTCCATTTTGCCTACATCTTTACCTCAGATCCACAGAGCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCTTCTGAGATGTCAAAGGTAAAACGGATGTAGAAATGGAGTCTAGGTGTCTCGA // / / // / / //// // //// |PleI | | |BbvII* | | |||| || |||CviJI MlyI | | |MboII | | |||| || |||AluI | | |SfeI* | | |||| || ||BcgI | | Tsp4CI* | | |||| || |BseMII | MboII | | |||| || |SetI HinfI | | |||| || BspCNI | | |||| |MnlI | | |||| XhoII | | |||| MboI | | |||DpnI | | ||BstKTI | | |DdeI | | Hpy188I | BinI* SetI K E E D S T V S I L P T S L P Q I H R A K K K T L Q F P F C L H L Y L R S T E L R R R L Y S F H F A Y I F T S D P Q S * ----:----|----:----|----:----|----:----|----:----|----:----| L S S S E V T E M K G V D K G * I W L A Y L L L S * L K W K A * M K V E S G C L F F F V R C N G N Q R C R * R L D V S S Cac8I | TseI | AluI | CviJI | PvuII | NspBII* | |BisI | ||BlsI BseRI MaeIII BbvI SetI | ||SetI |BcgI MnlI | MnlI \ \ \ \\\ \\ \ \ \ AATATGTTAGCACAAGGTTCGCCAGCTGCCTCTAAAATATCTCCTCTTGTAACGAAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACAATCGTGTTCCAAGCGGTCGACGGAGATTTTATAGAGGAGAACATTGCTTTTTT / / / //// // / // | BbvI | |||| |BcgI MnlI |MaeIII SetI | |||| BseRI MnlI | |||TseI | ||BisI | |BlsI | NspBII* | PvuII | CviJI | AluI Cac8I SetI N M L A Q G S P A A S K I S P L V T K K I C * H K V R Q L P L K Y L L L * R K N Y V S T R F A S C L * N I S S C N E K I ----:----|----:----|----:----|----:----|----:----|----:----| L I N A C P E G A A E L I D G R T V F F * Y T L V L N A L Q R * F I E E Q L S F I H * C L T R W S G R F Y R R K Y R F F AccI |BssNAI |Hpy166II TaqII || MboI | MaeII || | DpnI | | SetI BccI || | |BstKTI | | TaiI \ \\ \ \\ \ \ \ TCTAAAACGAGATGGCATTTTGGTATACGATCTCGCTCATATCCATTAGACGTTATGGGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTTTGCTCTACCGTAAAACCATATGCTAGAGCGAGTATAGGTAATCTGCAATACCCA / // // / / / / BccI || || MboI | | MaeII || |DpnI | TaiI || BstKTI | SetI |AccI TaqII Hpy166II BssNAI S K T R W H F G I R S R S Y P L D V M G L K R D G I L V Y D L A H I H * T L W V * N E M A F W Y T I S L I S I R R Y G * ----:----|----:----|----:----|----:----|----:----|----:----| D L V L H C K P I R D R E Y G N S T I P I * F S I A N Q Y V I E S M D M L R * P R F R S P M K T Y S R A * I W * V N H T BglI MwoI |AsuI* ||BmgT120I |||CviJI |||HaeIII |||| CviJI |||| | Ksp632I* TaqII HgiCI* |||| | |MnlI ApoI | ApoI | NlaIV |||| | || Hpy188I TspEI HphI | TspEI | MboII |||| | || | BccI \ \ \ \ \ \ \\\\ \ \\ \ \ GAAATTTATATTGCCTTGAAGAATTTGGGTGCCGAATGGGCCAAGCCATCTGAAGAGGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAATATAACGGAACTTCTTAAACCCACGGCTTACCCGGTTCGGTAGACTTCTCCTA / / / / // / / // / / / / | HphI TaqII | || | MwoI || | | | BccI TspEI | || | BglI || | | Ksp632I* ApoI | || HgiCI* || | | Hpy188I | |NlaIV || | MnlI | MboII || CviJI TspEI |AsuI* ApoI BmgT120I HaeIII CviJI E I Y I A L K N L G A E W A K P S E E D K F I L P * R I W V P N G P S H L K R I N L Y C L E E F G C R M G Q A I * R G F ----:----|----:----|----:----|----:----|----:----|----:----| S I * I A K F F K P A S H A L G D S S S H F K Y Q R S S N P H R I P W A M Q L P F N I N G Q L I Q T G F P G L W R F L I Eco57I Eco57MI | TspEI MboII | | MseI SetI \ \ \ \ \ TTATGGACTATCAAATTAAGGTGGAAATATGATATTGGAAACAAGACAAACACTAATGAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AATACCTGATAGTTTAATTCCACCTTTATACTATAACCTTTGTTCTGTTTGTGATTACTT / / // MboII Eco57MI |MseI Eco57I |SetI TspEI L W T I K L R W K Y D I G N K T N T N E Y G L S N * G G N M I L E T R Q T L M K M D Y Q I K V E I * Y W K Q D K H * * K ----:----|----:----|----:----|----:----|----:----|----:----| K H V I L N L H F Y S I P F L V F V L S N I S * * I L T S I H Y Q F C S L C * H * P S D F * P P F I I N S V L C V S I F SetI TspEI | TspDTI | TspEI TspEI | | MseI | TspDTI TspEI | XcmI \ \ \ \ \ \ \ \ AAAATACCTGATTTAATGAAAATGGTAATTCAATTATTTCAAATTGAAACCAATAATTAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATGGACTAAATTACTTTTACCATTAAGTTAATAAAGTTTAACTTTGGTTATTAATA / / / // / / / / | | MseI || TspEI TspEI | TspEI | TspDTI |TspEI XcmI SetI TspDTI K I P D L M K M V I Q L F Q I E T N N Y K Y L I * * K W * F N Y F K L K P I I I N T * F N E N G N S I I S N * N Q * L F ----:----|----:----|----:----|----:----|----:----|----:----| F I G S K I F I T I * N N * I S V L L * F F V Q N L S F P L E I I E F Q F W Y N F Y R I * H F H Y N L * K L N F G I I I BseYI ApoI CviJI BceAI TspEI | GsaI | BaeI Tsp4CI* \ \ \ \ \ \ TTGGTGGATTTCAAATTTGACGGCTGGGAAAGTAGTTATGGAGATGATACTACTGTTTCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACCTAAAGTTTAAACTGCCGACCCTTTCATCAATACCTCTACTATGATGACAAAGA / / / / / / TspEI | BseYI BaeI BceAI Tsp4CI* ApoI CviJI GsaI L V D F K F D G W E S S Y G D D T T V S W W I S N L T A G K V V M E M I L L F L G G F Q I * R L G K * L W R * Y Y C F * ----:----|----:----|----:----|----:----|----:----|----:----| K T S K L N S P Q S L L * P S S V V T E N P P N * I Q R S P F Y N H L H Y * Q K Q H I E F K V A P F T T I S I I S S N R TatI MboII TspDTI |Csp6I Eco57I Hpy188I ||RsaI Eco57MI SspI | BaeI ||ScaI | CviJI MseI \ \ \ \\\ \ \ \ AATATTTCTGAAGATGAAATGAGTACTTTTTCAGCCTACCCATTTTTACATTTAACAACA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAAGACTTCTACTTTACTCATGAAAAAGTCGGATGGGTAAAAATGTAAATTGTTGT / / / / //// / / | | Hpy188I | |||| CviJI MseI | BaeI | |||Eco57MI SspI | |||Eco57I | |||TspDTI | ||TatI | |Csp6I | ScaI | RsaI MboII N I S E D E M S T F S A Y P F L H L T T I F L K M K * V L F Q P T H F Y I * Q Q Y F * R * N E Y F F S L P I F T F N N K ----:----|----:----|----:----|----:----|----:----|----:----| L I E S S S I L V K E A * G N K C K V V * Y K Q L H F S Y K K L R G M K V N L L I N R F I F H T S K * G V W K * M * C C CviJI | MseI | |HpaI | |HindII BceAI | |Hpy166II MfeI |TspEI TspEI | || Tsp4CI* TspEI \\ \ \ \\ \ \ AAACTAATTATGGAATTAGCCGTTAACAGTCAAAGCAATTGA 1870 1880 1890 1900 ----:----|----:----|----:----|----:----|-- TTTGATTAATACCTTAATCGGCAATTGTCAGTTTCGTTAACT / / / / // / / | TspEI | | || Tsp4CI* TspEI BceAI | | |MseI MfeI | | Hpy166II | | HindII | | HpaI | CviJI TspEI K L I M E L A V N S Q S N * N * L W N * P L T V K A I X T N Y G I S R * Q S K Q L X ----:----|----:----|----:----|----:----|-- F S I I S N A T L L * L L Q L V L * P I L R * C D F C N F * N H F * G N V T L A I S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 2 FblI,XmiI AciI 4 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 3 AlfI 2 AluI 4 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 5 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 10 BceAI 3 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BfiI 2 BmrI,BmuI BglI 1 BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 4 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 3 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 3 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 7 BtrI 1 BmgBI,AjiI Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 16 CviKI-1 CviRI* 5 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 7 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Eco57I 4 AcuI Eco57MI 5 EcoP15I 3 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 8 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GsaI 3 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 3 Hin4II* 4 HpyAV HindII 2 HincII HinfI 6 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 8 Hpy99I 3 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 1 MunI MluI 1 MlyI 5 SchI MmeI 1 MnlI 7 MseI 11 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PfoI 1 PleI 5 PpsI PpuMI 1 Psp5II,PspPPI PvuII 1 RsaI 5 AfaI ScaI 2 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 17 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 3 TaqII 3 TatI 2 TauI 1 TfiI 1 PfeI TseI 4 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 22 TasI,Tsp509I,Sse9I TspRI 3 TscAI TstI 1 VspI 1 PshBI,AseI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AgeI AhaIII* AjuI AloI ApaI AscI Asp718I AsuII AvaI AvrII BalI BamHI BarI BbvCI Bce83I* BdaI BetI* BmeT110I BmtI BplI BsaAI BsaXI BsePI BsgI BsiI* Bsp120I Bsp1407I BspMII* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtsI Cfr10I Cfr9I CfrI ClaI DinI DraIII Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GlaI HaeII HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MauBI McrI* Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspGWI TspMI Tth111I XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769