Restriction Map of APT2/YDR441C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

APT2/YDR441C on chromosome IV from coordinates 1345062 to 1344517.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.2038

EMBOSS_001 Hpy188I |TfiI CviRI* Hpy166II |HinfI | TstI | TspRI \\ \ \ \ \ ATGTCTATTTCTGAATCTTACGCAAAGGAAATAAAAACTGCATTTAGGCAGTTCACTGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATAAAGACTTAGAATGCGTTTCCTTTATTTTTGACGTAAATCCGTCAAGTGACTG / / / / / | HinfI CviRI* | Hpy166II | TfiI TstI TspRI Hpy188I M S I S E S Y A K E I K T A F R Q F T D C L F L N L T Q R K * K L H L G S S L T V Y F * I L R K G N K N C I * A V H * L ----:----|----:----|----:----|----:----|----:----|----:----| X D I E S D * A F S I F V A N L C N V S X T * K Q I K R L P F L F Q M * A T * Q H R N R F R V C L F Y F S C K P L E S V TstI |MnlI SetI MnlI BsiYI* ||TspEI HphI | BsiYI* \ \ \\\ \ \ \ TTTCCCATAGAGGGTGAGCAATTTGAGGATTTTTTACCTATTATTGGCAACCCCACGCTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGGTATCTCCCACTCGTTAAACTCCTAAAAAATGGATAATAACCGTTGGGGTGCGAT / / / / // / / / MnlI | TstI MnlI |HphI SetI BsiYI* BaeI BsiYI* TspEI F P I E G E Q F E D F L P I I G N P T L F P * R V S N L R I F Y L L L A T P R Y S H R G * A I * G F F T Y Y W Q P H A I ----:----|----:----|----:----|----:----|----:----|----:----| K G M S P S C N S S K K G I I P L G V S S E W L P H A I Q P N K V * * Q C G W A K G Y L T L L K L I K * R N N A V G R * PflMI BsiYI* | Csp6I | |RsaI | ||Hpy166II | ||| AflIII | ||| | MaeII FalI | ||| | | SetI FalI | ||| | | TaiI HgaI MboII BaeI | ||| | | | Hpy178III* |BaeI | BcgI MboI \ \ \\\ \ \ \ \ \\ \ \ \ TTCCAAAAGTTGGTACACACGTTCAAGACGCATTTAGAAGAAAAGTTCGGCAAAGAAAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTTTCAACCATGTGTGCAAGTTCTGCGTAAATCTTCTTTTCAAGCCGTTTCTTTTC / // / / / / / / / / / BsiYI* || | | | BaeI | | | BcgI BstKTI PflMI || | | Hpy178III* | | MboII || | AflIII | FalI || | MaeII | FalI || TaiI HgaI || SetI |Hpy166II |Csp6I RsaI F Q K L V H T F K T H L E E K F G K E K S K S W Y T R S R R I * K K S S A K K R P K V G T H V Q D A F R R K V R Q R K D ----:----|----:----|----:----|----:----|----:----|----:----| N W F N T C V N L V C K S S F N P L S F I G F T P V C T * S A N L L F T R C L F E L L Q Y V R E L R M * F F L E A F F L CviRI* AsuI* | SetI Hin4II* | | FalI |BmgT120I | | FalI ||CviJI | | |MnlI ||HaeIII | | || AluI |||BseGI DpnI | | || CviJI StuI |||| MmeI |TaqI | | || |MaeI CviJI |||| |MaeI |BstKTI | | || |BcgI HaeIII |||| || BccI || BspMI | | || ||SetI |FokI |||| || | BsiYI* \\ \ \ \ \\ \\\ \\ \\\\ \\ \ \ ATCGACTTTATTGCAGGTATAGAAGCTAGAGGCCTTCTATTTGGGCCATCCCTAGCACTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTGAAATAACGTCCATATCTTCGATCTCCGGAAGATAAACCCGGTAGGGATCGTGAC / // / // / / /// / / / / /// / /// / | || | || FalI | ||| | | FokI | ||| | ||BccI BsrI | || | || FalI | ||| | HaeIII | ||| | |BsiYI* | || | |SetI | ||| | CviJI | ||| | |MaeI | || | CviRI* | ||| | StuI | ||| | TspRI | || BspMI | ||| MaeI | ||| MmeI | |TaqI | ||CviJI | ||AsuI* | MboI | ||AluI | |BmgT120I DpnI | |BcgI | |HaeIII | SetI | |CviJI MnlI | BseGI Hin4II* I D F I A G I E A R G L L F G P S L A L S T L L Q V * K L E A F Y L G H P * H W R L Y C R Y R S * R P S I W A I P S T G ----:----|----:----|----:----|----:----|----:----|----:----| I S K I A P I S A L P R R N P G D R A S S R S * Q L Y L L * L G E I Q A M G L V D V K N C T Y F S S A K * K P W G * C Q TspEI | BssKI | |HpaII BsrI | ||ScrFI TspRI MmeI | ||CauII* \ \ \ \\\ GCATTGGGAGTTGGATTTGTTCCAATAAGGAGAGTTGGAAAATTGCCGGGTGAGTGTGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAACCCTCAACCTAAACAAGGTTATTCCTCTCAACCTTTTAACGGCCCACTCACACGA / / / / / MmeI | | BssKI HphI | CauII* | HpaII | ScrFI TspEI A L G V G F V P I R R V G K L P G E C A H W E L D L F Q * G E L E N C R V S V L I G S W I C S N K E S W K I A G * V C F ----:----|----:----|----:----|----:----|----:----|----:----| A N P T P N T G I L L T P F N G P S H A P M P L Q I Q E L L S L Q F I A P H T H C Q S N S K N W Y P S N S F Q R T L T S FatI |CviAII || NlaIII || | ApoI || | TspEI || | | BspMI || | | | MboII || | | | |TspDTI || | | | || CviRI* CviJI HphI TspEI || | | | || | SetI |XmnI \ \ \\ \ \ \ \\ \ \ \\ TCTATAACATTCACAAAATTAGACCATGAAGAAATTTTTGAAATGCAGGTTGAAGCCATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGATATTGTAAGTGTTTTAATCTGGTACTTCTTTAAAAACTTTACGTCCAACTTCGGTAA / / // / // // // | | |FatI | || |SetI |XmnI | | CviAII | || CviRI* CviJI | NlaIII | |BspMI TspEI | TspDTI | MboII TspEI ApoI S I T F T K L D H E E I F E M Q V E A I L * H S Q N * T M K K F L K C R L K P F Y N I H K I R P * R N F * N A G * S H S ----:----|----:----|----:----|----:----|----:----|----:----| E I V N V F N S W S S I K S I C T S A M K * L M * L I L G H L F K Q F A P Q L W R Y C E C F * V M F F N K F H L N F G N FokI | AgeI | BetI* | SgrAI MaeII | Cfr10I TfiI | SetI BseGI | |HpaII FauI HinfI | TaiI | MmeI | || BbvI NdeI \ \ \ \ \ \ \\ \ \ CCCTTTGATTCCAACGTGGTTGTCGTGGATGATGTTCTCGCCACCGGTGGAACGGCATAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGGAAACTAAGGTTGCACCAACAGCACCTACTACAAGAGCGGTGGCCACCTTGCCGTATA / / / / / / // / // | | MaeII | MmeI | || BbvI |NdeI | TaiI BseGI | |Cfr10I |FauI | SetI | |SgrAI BstAPI HinfI | |BetI* MwoI TfiI | |AgeI | HpaII FokI P F D S N V V V V D D V L A T G G T A Y P L I P T W L S W M M F S P P V E R H M L * F Q R G C R G * C S R H R W N G I C ----:----|----:----|----:----|----:----|----:----|----:----| G K S E L T T T T S S T R A V P P V A Y E R Q N W R P Q R P H H E R W R H F P M G K I G V H N D H I I N E G G T S R C I TseI MwoI BstAPI |BisI ||BlsI |||AciI SetI |||| Cac8I | TaqII SduI |||| | BceAI | | Hpy188I HgiAI* Hpy178III* MaeI \\\\ \ \ \ \ \ \ \ \ GCTGCGGGCGACCTTATCAGACAAGTGGGTGCTCATATTCTGGAATATGACTTTGTGCTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGCCCGCTGGAATAGTCTGTTCACCCACGAGTATAAGACCTTATACTGAAACACGAT /// / / / / / / / ||| | | | Hpy188I HgiAI* Hpy178III* MaeI ||| | | TaqII SduI ||| | BceAI ||| | SetI ||| Cac8I ||| AciI ||TseI |BisI BlsI A A G D L I R Q V G A H I L E Y D F V L L R A T L S D K W V L I F W N M T L C * C G R P Y Q T S G C S Y S G I * L C A S ----:----|----:----|----:----|----:----|----:----|----:----| A A P S R I L C T P A * I R S Y S K T S H Q P R G * * V L P H E Y E P I H S Q A S R A V K D S L H T S M N Q F I V K H * AccI |Hpy166II || MnlI || FatI || |Hin4I || |CviAII TspEI || || NlaIII | HphI BseRI Hin4I CviRI* \\ \\ \ \ \ \ \ \ GTGTTAGATAGTCTACATGGTGAGGAGAAATTATCTGCTCCTATTTTTTCCATATTGCAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CACAATCTATCAGATGTACCACTCCTCTTTAATAGACGAGGATAAAAAAGGTATAACGTG / /// // / / / / / | ||| |FatI | | BseRI Hin4I CviRI* | ||| CviAII | TspEI | ||NlaIII HphI | |AccI | |MnlI | Hpy166II Hin4I V L D S L H G E E K L S A P I F S I L H C * I V Y M V R R N Y L L L F F P Y C T V R * S T W * G E I I C S Y F F H I A L ----:----|----:----|----:----|----:----|----:----|----:----| T N S L R C P S S F N D A G I K E M N C L T L Y D V H H P S I I Q E * K K W I A H * I T * M T L L F * R S R N K G Y Q V Hpy178III* \ TCCTGA ----:- AGGACT / Hpy178III* S * P X L X ----:- E Q S R G S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 1 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BaeI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 1 BceAI 1 BcgI 1 BetI* 1 BsaWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BseGI 2 BstF5I,BtsCI BseRI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BspMI 2 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 4 CviKI-1 CviRI* 4 HpyCH4V DpnI 1 MalI FalI 2 FatI 2 FauI 1 SmuI FokI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 1 Hin4II* 1 HpyAV HinfI 2 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MmeI 3 MnlI 4 MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI PflMI 1 BasI,AccB7I,Van91I RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 7 SgrAI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 2 TaqI 1 TaqII 1 TfiI 2 PfeI TseI 1 ApeKI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I TspRI 2 TscAI TstI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BalI BamHI BarI BbvCI BbvII* Bce83I* BciVI BclI BdaI BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsI Cfr9I CfrI ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI Ksp632I* MaeIII MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MseI MslI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StyI SwaI TatI TauI TsoI Tsp45I Tsp4CI* TspGWI TspMI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769