Restriction Map of FRQ1/YDR373W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

FRQ1/YDR373W on chromosome IV from coordinates 1222759 to 1223331.


AcyI MaeII |ZraI SetI || SetI | FatI || TaiI | AflIII || AatII | BspLU11I* || | HindIII | |CviAII || | | AluI | || NspI NlaIV || | | CviJI | || NlaIII |CviJI || | | | SetI | || |CspCI \\ \\ \ \ \ \ \ \\ \\ ATGGGAGCCAAGACGTCAAAGCTTTCCAAAGATGACCTGACATGTTTGAAACAATCCACC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCTCGGTTCTGCAGTTTCGAAAGGTTTCTACTGGACTGTACAAACTTTGTTAGGTGG // / // / / / / / // / || | || | | HindIII SetI | |BspLU11I* SetI || | || | CviJI | |AflIII || | || | AluI | |FatI || | || SetI | CviAII || | |MaeII | CspCI || | |AcyI NlaIII || | ZraI NspI || AatII || TaiI || SetI |CviJI NlaIV M G A K T S K L S K D D L T C L K Q S T W E P R R Q S F P K M T * H V * N N P P G S Q D V K A F Q R * P D M F E T I H L ----:----|----:----|----:----|----:----|----:----|----:----| X P A L V D F S E L S S R V H K F C D V X P L W S T L A K W L H G S M N S V I W H S G L R * L K G F I V Q C T Q F L G G MaeI | BglI CspCI | MwoI SetI Ksp632I* | MboII BsrDI MnlI | |CfrI \ \ \ \ \ \ \ \\ TATTTTGATAGAAGAGAAATCCAGCAATGGCATAAAGGATTTTTGAGGGATTGCCCTAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAACTATCTTCTCTTTAGGTCGTTACCGTATTTCCTAAAAACTCCCTAACGGGATCA / / / / / / / Ksp632I* | MboII BsrDI MnlI | MaeI CspCI MwoI BglI Y F D R R E I Q Q W H K G F L R D C P S I L I E E K S S N G I K D F * G I A L V F * * K R N P A M A * R I F E G L P * W ----:----|----:----|----:----|----:----|----:----|----:----| * K S L L S I W C H C L P N K L S Q G L R N Q Y F L F G A I A Y L I K S P N G * I K I S S F D L L P M F S K Q P I A R T BalI CviJI HaeIII | MaeI | | AluI | | CviJI | | |MaeI MseI | | ||SetI | MboII Tsp4CI* \ \ \\\ \ \ \ GGCCAACTAGCTAGGGAAGATTTTGTTAAGATATACAAACAGTTTTTTCCATTTGGTTCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTGATCGATCCCTTCTAAAACAATTCTATATGTTTGTCAAAAAAGGTAAACCAAGA / / /// / // / | | ||| MaeI |MseI Tsp4CI* | | ||CviJI MboII | | ||AluI | | |MaeI | | SetI | CfrI HaeIII CviJI BalI G Q L A R E D F V K I Y K Q F F P F G S A N * L G K I L L R Y T N S F F H L V L P T S * G R F C * D I Q T V F S I W F S ----:----|----:----|----:----|----:----|----:----|----:----| P W S A L S S K T L I Y L C N K G N P E H G V L * P L N Q * S I C V T K E M Q N A L * S P F I K N L Y V F L K K W K T R SetI Eco57I Hpy178III* Eco57MI TfiI | HphI MboII | Tsp4CI* TspDTI HinfI \ \ \ \ \ \ \ CCTGAAGATTTTGCTAATCACCTTTTTACAGTTTTTGATAAAGACAACAATGGATTCATA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTCTAAAACGATTAGTGGAAAAATGTCAAAAACTATTTCTGTTGTTACCTAAGTAT / / / / / / / / | HphI | | Eco57MI Tsp4CI* TspDTI HinfI Hpy178III* | | Eco57I TfiI | SetI MboII P E D F A N H L F T V F D K D N N G F I L K I L L I T F L Q F L I K T T M D S Y * R F C * S P F Y S F * * R Q Q W I H T ----:----|----:----|----:----|----:----|----:----|----:----| G S S K A L * R K V T K S L S L L P N M E Q L N Q * D G K * L K Q Y L C C H I * R F I K S I V K K C N K I F V V I S E Y MboII | Tsp4CI* | | TatI | | |Csp6I | | ||RsaI | | ||| MnlI | | ||| MaeII | | ||| | SetI | | ||| | TaiI | | ||| | |Hpy178III* | | ||| | || MnlI BseMII Ksp632I* | | ||| | || XcmI |BspCNI \ \ \ \\\ \ \\ \ \\ CATTTTGAAGAGTTTATCACAGTTTTGAGTACAACGTCCAGAGGAACTTTGGAGGAAAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAACTTCTCAAATAGTGTCAAAACTCATGTTGCAGGTCTCCTTGAAACCTCCTTTTT / / / //// / / / // Ksp632I* | Tsp4CI* |||| | | XcmI |BspCNI MboII |||| | | MnlI BseMII |||| | Hpy178III* |||| MaeII |||TaiI |||SetI |||MnlI ||TatI |Csp6I RsaI H F E E F I T V L S T T S R G T L E E K I L K S L S Q F * V Q R P E E L W R K N F * R V Y H S F E Y N V Q R N F G G K T ----:----|----:----|----:----|----:----|----:----|----:----| C K S S N I V T K L V V D L P V K S S F V N Q L T * * L K S Y L T W L F K P P F M K F L K D C N Q T C R G S S S Q L F F DdeI | AluI | BseYI | CviJI | | SetI | | | GsaI BccI | | | |CviJI | FatI | | | || TaqI | |CviAII | | | || AsuII | || NlaIII \ \ \ \\ \ \ \\ \ CTGAGCTGGGCTTTCGAACTTTATGATTTGAACCATGATGGATATATTACATTTGATGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCGACCCGAAAGCTTGAAATACTAAACTTGGTACTACCTATATAATGTAAACTACTT /// // / // // ||| |CviJI AsuII || |FatI ||| BseYI TaqI || CviAII ||CviJI |NlaIII ||AluI BccI ||GsaI |DdeI SetI L S W A F E L Y D L N H D G Y I T F D E * A G L S N F M I * T M M D I L H L M K E L G F R T L * F E P * W I Y Y I * * N ----:----|----:----|----:----|----:----|----:----|----:----| S L Q A K S S * S K F W S P Y I V N S S V S S P K R V K H N S G H H I Y * M Q H Q A P S E F K I I Q V M I S I N C K I F MaeIII | MnlI PsiI | | MseI TspDTI TsoI |BccI TsoI | | | MnlI \ \ \\ \ \ \ \ \ ATGCTAACCATTGTGGCGAGTGTTTATAAAATGATGGGGTCTATGGTTACACTTAATGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TACGATTGGTAACACCGCTCACAAATATTTTACTACCCCAGATACCAATGTGAATTACTC / / / / / / // TspDTI TsoI | | TsoI | |MnlI | BccI | MseI PsiI MaeIII MnlI M L T I V A S V Y K M M G S M V T L N E C * P L W R V F I K * W G L W L H L M R A N H C G E C L * N D G V Y G Y T * * G ----:----|----:----|----:----|----:----|----:----|----:----| I S V M T A L T * L I I P D I T V S L S F A L W Q P S H K Y F S P T * P * V * H H * G N H R T N I F H H P R H N C K I L MboII | MboI | BglII | XhoII | | DpnI | | XmnI FalI FalI | | |BstKTI FalI FokI FalI | | || BccI | TsoI BseGI |MnlI |BsiYI* | | || | MboII | | BccI \ \\ \\ \ \ \\ \ \ \ \ \ GATGAGGCAACGCCCGAAATGAGGGTAAAGAAGATCTTCAAGTTGATGGATAAGAACGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCCGTTGCGGGCTTTACTCCCATTTCTTCTAGAAGTTCAACTACCTATTCTTGCTT / // / / // / // / / / BseGI || BsiYI* MboII || | || FalI TsoI BccI || FokI || | || FalI |FalI || | |MboII |FalI || | BccI MnlI || XhoII || BglII || MboI |XmnI |DpnI BstKTI D E A T P E M R V K K I F K L M D K N E M R Q R P K * G * R R S S S * W I R T K * G N A R N E G K E D L Q V D G * E R R ----:----|----:----|----:----|----:----|----:----|----:----| S S A V G S I L T F F I K L N I S L F S P H P L A R F S P L S S R * T S P Y S R I L C R G F H P Y L L D E L Q H I L V F SetI ApoI | BinI* TspEI | | TaqI EcoRI | | |MboI MaeIII | Hin4II* | | || DpnI | MboII | | Hpy188I | | || |BstKTI MnlI \ \ \ \ \ \ \ \\ \\ \ GATGGTTACATTACGCTGGACGAATTCAGAGAAGGTTCTAAAGTCGATCCCTCTATTATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCAATGTAATGCGACCTGCTTAAGTCTCTTCCAAGATTTCAGCTAGGGAGATAATAA / / // / / // / / MaeIII | || SetI | || MboI MnlI MboII | |Hpy188I | |DpnI | EcoRI | BstKTI | TspEI | TaqI | ApoI BinI* Hin4II* D G Y I T L D E F R E G S K V D P S I I M V T L R W T N S E K V L K S I P L L L W L H Y A G R I Q R R F * S R S L Y Y W ----:----|----:----|----:----|----:----|----:----|----:----| S P * M V S S S N L S P E L T S G E I I L H N C * A P R I * L L N * L R D R * * I T V N R Q V F E S F T R F D I G R N N HgiCI* | NlaIV BccI CviJI | | MseI |SetI | MseI \ \ \ \\ \ \ GGTGCCTTAAACCTTTACGATGGCTTAATATGA 550 560 570 ----:----|----:----|----:----|--- CCACGGAATTTGGAAATGCTACCGAATTATACT / / // / / / | | || BccI | MseI | | |SetI CviJI | | MseI | HgiCI* NlaIV G A L N L Y D G L I * V P * T F T M A * Y X C L K P L R W L N M X ----:----|----:----|----:----|--- P A K F R * S P K I H Q H R L G K R H S L I T G * V K V I A * Y S # Enzymes that cut Frequency Isoschizomers AatII 1 AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 3 AluBI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BccI 5 BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BseGI 1 BstF5I,BtsCI BseMII 1 BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BspCNI 1 BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BstKTI 2 CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 7 CviKI-1 DdeI 1 BstDEI,HpyF3I DpnI 2 MalI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 FalI 2 FatI 2 FokI 1 GsaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4II* 1 HpyAV HindIII 1 HinfI 1 HphI 1 AsuHPI Hpy178III* 2 Hpy188III Hpy188I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MnlI 7 MseI 4 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PsiI 1 AanI RsaI 1 AfaI SetI 10 TaiI 2 TaqI 2 TatI 1 TfiI 1 PfeI TsoI 3 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 1 TasI,Tsp509I,Sse9I XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AciI AclI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CviRI* DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsuI HaeII HgaI HgiAI* HgiJII* HhaI Hin4I Hin6I HindII HinP1I HpaI HpaII Hpy166II Hpy8I Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqII TauI TseI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769