Restriction Map of YDR371C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YDR371C-A on chromosome IV from coordinates 1219613 to 1219509.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.22567

EMBOSS_001 NlaIV | FatI EciI | |CviAII BsrI MseI | || NlaIII | TaqI | AloI | || | BstXI AloI | |BfiI AciI | |FokI \ \\ \ \ \ \ \\ \ \ \\ ATGGGTTCCATGATTTTGGACATTACTGGGAACTCGATGTCCGCCATTGTTAAAGTTGTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCAAGGTACTAAAACCTGTAATGACCCTTGAGCTACAGGCGGTAACAATTTCAACAG / / // / / / / / / / / | | |FatI AloI BsrI | TaqI AciI | MseI FokI | | CviAII EciI BfiI AloI | | BstXI | NlaIII NlaIV M G S M I L D I T G N S M S A I V K V V W V P * F W T L L G T R C P P L L K L S G F H D F G H Y W E L D V R H C * S C L ----:----|----:----|----:----|----:----|----:----|----:----| X P E M I K S M V P F E I D A M T L T T X P N W S K P C * Q S S S T R W Q * L Q H T G H N Q V N S P V R H G G N N F N D BsmAI | BseGI | | Hpy188I MseI | | | SetI | ApoI | | | BsiYI* | TspEI MmeI \ \ \ \ \ \ \ TCTAATATCATCCGACCTTTGGTTCTTAAAAATTTTATTATATAA 70 80 90 100 ----:----|----:----|----:----|----:----|----: AGATTATAGTAGGCTGGAAACCAAGAATTTTTAAAATAATATATT // / // / / || | |BsiYI* MseI TspEI || | SetI MmeI || Hpy188I ApoI |BsmAI BseGI S N I I R P L V L K N F I I * L I S S D L W F L K I L L Y X * Y H P T F G S * K F Y Y I X ----:----|----:----|----:----|----:----|----: E L I M R G K T R L F K I I Y R * Y * G V K P E * F N * * I R I D D S R Q N K F I K N Y L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AloI 1 ApoI 1 AcsI,XapI BfiI 1 BmrI,BmuI BseGI 1 BstF5I,BtsCI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsrI 1 BseNI,Bse1I,BsrSI BstXI 1 CviAII 1 EciI 1 FatI 1 FokI 1 Hpy188I 1 MmeI 1 MseI 2 Tru1I,Tru9I NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I SetI 1 TaqI 1 TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviJI CviQI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy178III*Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI MboII McrI* MfeI MluI MlyI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769