Restriction Map of YDR365W-A

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YDR365W-A on chromosome IV from coordinates 1206997 to 1208319.


FatI |CviAII || NlaIII || | TaqII || | | Hin6I || | | |GlaI TfiI || | | ||HhaI HinfI TspEI HphI || | | |||HaeII MaeIII \ \ \ \\ \ \ \\\\ \ ATGGAATCCCAACAATTATCTCAACATTCACCCATTTCTCATGGTAGCGCCTGTGCTTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAGGGTTGTTAATAGAGTTGTAAGTGGGTAAAGAGTACCATCGCGGACACGAAGC / / / / // //// HinfI | HphI | || |||Hin6I TfiI TspEI | || ||GlaI | || |HhaI | || HaeII | |TaqII | |FatI | CviAII NlaIII M E S Q Q L S Q H S P I S H G S A C A S W N P N N Y L N I H P F L M V A P V L R G I P T I I S T F T H F S W * R L C F G ----:----|----:----|----:----|----:----|----:----|----:----| X S D W C N D * C E G M E * P L A Q A E X P I G V I I E V N V W K E H Y R R H K H F G L L * R L M * G N R M T A G T S R Hpy166II | TspGWI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeII AluI | | | | | DpnI | SetI CviJI DdeI | | | | | |BstKTI | TaiI | SetI \ \ \ \ \ \ \\ \ \ \ \ GTTACTTCTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTCAGCTTCCAAAACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGAAGATTCCTTCAGGTGTGTTTAGTTCTAGGCAATCTGCAAAGTCGAAGGTTTTGT / / / / / /// / / / / / | DdeI | | | ||| XhoII | | | CviJI MaeIII | | | ||| MboI | | | AluI | | | ||DpnI | | SetI | | | |BstKTI | MaeII | | | | TaiI | | | | SetI | | | Hpy178III* | | BinI* | TspGWI Hpy166II V T S K E V H T N Q D P L D V S A S K T L L L R K S T Q I K I R * T F Q L P K Q Y F * G S P H K S R S V R R F S F Q N R ----:----|----:----|----:----|----:----|----:----|----:----| T V E L S T W V F * S G N S T E A E L V P * K * P L G C L D L D T L R K L K W F N S R L F D V C I L I R * V N * S G F C Hin4II* | MboII AarI | | CviJI DdeI CviJI TspDTI SetI BspMI \ \ \ \ \ \ \ \ GAAGAATGTGAGAAGGCTTCCACTAAGGCTAACTCTCAACAGACAACAACACCTGCTTCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTACACTCTTCCGAAGGTGATTCCGATTGAGAGTTGTCTGTTGTTGTGGACGAAGT / / / / / / / / | | CviJI | CviJI | SetI MwoI | MboII DdeI TspDTI Hin4II* E E C E K A S T K A N S Q Q T T T P A S K N V R R L P L R L T L N R Q Q H L L H R M * E G F H * G * L S T D N N T C F I ----:----|----:----|----:----|----:----|----:----|----:----| S S H S F A E V L A L E * C V V V G A E L L I H S P K W * P * S E V S L L V Q K F F T L L S G S L S V R L L C C C R S * MnlI MwoI BseRI | SetI | AluI |FatI | | MnlI | CviJI ||CviAII | | | BspMI | PvuII ||| NlaIII | | | |Csp6I | NspBII* ||| |BccI | | | ||RsaI | | SetI ||| |Eco57I | | | ||| BceAI | | | Hpy178III* ||| |Eco57MI | | | ||| | SetI \ \ \ \ \\\ \\ \ \ \ \\\ \ \ TCAGCTGTTCCAGAGAACCCCCATCATGCCTCTCCTCAACCTGCTTCAGTACCACCTCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGACAAGGTCTCTTGGGGGTAGTACGGAGAGGAGTTGGACGAAGTCATGGTGGAGGT / / / / / // / / / //// / | NspBII* | | | || BccI MnlI MnlI |||| BceAI | BspMI | | | |FatI SetI |||SetI | PvuII | | | Eco57MI ||BspMI | CviJI | | | CviAII |Csp6I | AarI | | | Eco57I RsaI | AluI | | NlaIII SetI | BseRI Hpy178III* S A V P E N P H H A S P Q P A S V P P P Q L F Q R T P I M P L L N L L Q Y H L H S C S R E P P S C L S S T C F S T T S T ----:----|----:----|----:----|----:----|----:----|----:----| D A T G S F G W * A E G * G A E T G G G M L Q E L S G G D H R E E V Q K L V V E * S N W L V G M M G R R L R S * Y W R W PflMI BsiYI* |MnlI || AsuI* FatI || |BmgT120I CviRI* || ||CviJI |CviAII || ||HaeIII ||BtsI || ||| Csp6I OliI ||TspRI CviJI BstXI || ||| |RsaI MslI ||| NlaIII | EcoP15I |BccI \\ \\\ \\ \ \\\ \ \ \ \\ CAGAATGGGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGCCAATCCATCTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTACCCGGCATGGGTGTCGTCACGTACTACTGGGTTTTGGTTCGGTTAGGTAGACCA / / // // / / / // / / / | MnlI || || | MslI | |FatI | | BstXI BsiYI* || || | OliI | CviAII | EcoP15I PflMI || || TspRI CviRI* CviJI || |Csp6I NlaIII || RsaI BtsI |AsuI* BmgT120I HaeIII CviJI Q N G P Y P Q Q C M M T Q N Q A N P S G R M G R T H S S A * * P K T K P I H L V E W A V P T A V H D D P K P S Q S I W L ----:----|----:----|----:----|----:----|----:----|----:----| C F P G Y G C C H M I V W F W A L G D P V S H A T G V A T C S S G F G L W D M Q L I P R V W L L A H H G L V L G I W R T TspGWI | TspGWI | |TfiI | |BccI | |HinfI | || TaqII | || | AccI | || | |BssNAI | || | |Hpy166II TatI | || | || SetI |Csp6I \ \\ \ \\ \ \\ TGGTCATTTTACGGACACCCATCTATGATTCCGTATACACCTTATCAAATGTCGCCTATG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGTAAAATGCCTGTGGGTAGATACTAAGGCATATGTGGAATAGTTTACAGCGGATAC / / / / / // / BccI | | | | || SetI | | | | |AccI | | | | Hpy166II | | | | BssNAI | | | TaqII | | | HinfI | | | TfiI | | BccI | TspGWI TspGWI W S F Y G H P S M I P Y T P Y Q M S P M G H F T D T H L * F R I H L I K C R L C V I L R T P I Y D S V Y T L S N V A Y V ----:----|----:----|----:----|----:----|----:----|----:----| Q D N * P C G D I I G Y V G * * I D G I N T M K R V G M * S E T Y V K D F T A * P * K V S V W R H N R I C R I L H R R H BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI ||||AsuI* BciVI |||||BmgT120I Tsp4CI* |BccI ||||||CviJI | MmeI || BseMII RsaI ||||||HaeIII | |AciI || |BspCNI \ \\\\\\\ \ \\ \\ \\ TACTTTCCACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATCAGTTGGAACGCCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAAAGGTGGACCCGGTGTTAGTGTCAAAGGCGTCATAGGTAGTAGTCAACCTTGCGGA /// / / /// / / / / /// ||TatI | | ||AsuI* | MmeI AciI | ||BspCNI |Csp6I | | |BmgT120I Tsp4CI* | |BseMII RsaI | | |HaeIII | BccI | | |CviJI BciVI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI SetI Y F P P G P Q S Q F P Q Y P S S V G T P T F H L G H N H S F R S I H H Q L E R L L S T W A T I T V S A V S I I S W N A S ----:----|----:----|----:----|----:----|----:----|----:----| Y K G G P G C D C N G C Y G D D T P V G T S E V Q A V I V T E A T D M M L Q F A V K W R P W L * L K R L I W * * N S R R TfiI HinfI | BseGI | | DdeI DdeI | | BbvCI |SetI | | Bpu10I |BccI | | |MlyI ||HinfI | | |PleI DdeI |||EcoNI | | || AciI |Hpy188I |||| BsiYI* | | || Hin4I || HphI |||| | SetI | | || Hin4I || | SduI |||| | PleI | | || NspBII* || | HgiAI* |||| | |MlyI | | || | FokI || | |MnlI |||| | || FokI | | || | |HinfI || | |BseMII |||| | || |Hin4I | | || | || MnlI || | ||BspCNI |||| | || ||TspDTI | | || | || | Hpy188I \\ \ \\\ \\\\ \ \\ \\\ \ \ \\ \ \\ \ \ CTGAGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATCCTCAGCGGACTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCGTGAGGTAGTGGACTCAGTCCATTATGTAAATGACTAAGTAGGAGTCGCCTGAGA / // // / ///// / / / / / / / //// / / /// | || |BspCNI SetI ||||| | | | FokI | | | |||| | | ||BseMII | || |MnlI ||||| | | TspDTI | | | |||| | | |Hpy188I | || BseMII ||||| | PleI | | | |||| | | |BspCNI | |DdeI ||||| | MlyI | | | |||| | | Hin4I | |HphI ||||| Hin4I | | | |||| | | HinfI | HgiAI* ||||SetI | | | |||| | | FokI | SduI |||HinfI | | | |||| | MnlI Hpy188I ||EcoNI | | | |||| AciI |DdeI | | | |||NspBII* BsiYI* | | | ||Bpu10I BccI | | | ||BbvCI | | | ||DdeI | | | |PleI | | | MlyI | | Hin4I | | Hin4I | HinfI | TfiI BseGI L S T P S P E S G N T F T D S S S A D S * A L H H L S Q V I H L L I H P Q R T L E H S I T * V R * Y I Y * F I L S G L * ----:----|----:----|----:----|----:----|----:----|----:----| R L V G D G S D P L V N V S E D E A S E E S C E M V Q T L Y Y M * Q N M R L P S Q A S W * R L * T I C K S I * G * R V R HphI | MseI BspCNI | |HpaI |BseMII Hin4I | |HindII ||Hin4I Hin4I | |Hpy166II SetI ||| BseGI | Hpy188I | || SetI | MnlI \\\ \ \ \ \ \\ \ \ \ GATATGACATCCACTAAAAAATATGTCAGACCACCACCAATGTTAACCTCACCTAATGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTATACTGTAGGTGATTTTTTATACAGTCTGGTGGTGGTTACAATTGGAGTGGATTACTG / / / / // / / BseGI Hin4I Hpy188I | |MseI SetI MnlI Hin4I | |SetI | Hpy166II | HindII | HpaI HphI D M T S T K K Y V R P P P M L T S P N D I * H P L K N M S D H H Q C * P H L M T Y D I H * K I C Q T T T N V N L T * * L ----:----|----:----|----:----|----:----|----:----|----:----| S I V D V L F Y T L G G G I N V E G L S Q Y S M W * F I H * V V V L T L R V * H I H C G S F F I D S W W W H * G * R I V TaqI ApoI | TfiI TspEI MseI TspEI | HinfI \ \ \ \ \ TTTCCAAATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAATCTCGGTGGTATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTTTAACCCAATTTTGTATGTAGTTTAAAAATGTTTTGAGCTTAGAGCCACCATAA / / / / / TspEI MseI TspEI | HinfI ApoI | TfiI TaqI F P N W V K T Y I K F L Q N S N L G G I F Q I G L K H T S N F Y K T R I S V V L S K L G * N I H Q I F T K L E S R W Y Y ----:----|----:----|----:----|----:----|----:----|----:----| K G F Q T L V Y M L N K C F E F R P P I S E L N P * F M C * I K V F S S D R H Y K W I P N F C V D F K * L V R I E T T N SplI* |Csp6I ||RsaI |||MaeII ||||MmeI |||||TspGWI ||||||SetI ||||||TaiI ||||||| MboI Hpy188I ||||||| Hpy188I | Tsp4CI* ||||||| | DpnI HphI SetI | | Hpy166II ||||||| | |BstKTI TspRI | TspDTI \ \ \ \\\\\\\ \ \\ \ \ \ ATTCCGACAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGAACTCACCTTCTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGCTGTCATTTGCCTTTTGGGCATGCAGTCTAGTGACTACTACTTGAGTGGAAGAAC / / / //// / // / / / / | | Hpy166II |||| | || MboI HphI SetI TspDTI | Tsp4CI* |||| | |DpnI Hpy188I |||| | BstKTI |||| | TspRI |||| Hpy188I |||MaeII ||SplI* |TspGWI |Csp6I MmeI RsaI TaiI SetI I P T V N G K P V R Q I T D D E L T F L F R Q * T E N P Y V R S L M M N S P S C S D S K R K T R T S D H * * * T H L L V ----:----|----:----|----:----|----:----|----:----|----:----| I G V T F P F G T R * I V S S S S V K K * E S L L R F V R V D S * Q H H V * R R N R C Y V S F G Y T L D S I I F E G E Q SetI |FokI |BssKI |EcoRII ||SecI* |||ScrFI |||BseBI ||||SetI TspEI ||||Hin4I TspGWI Hin4II* SspI | MnlI ||||Hin4I | BseGI \ \ \ \ \\\\\ \ \ TATAACACTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTGGGTCAAAGACATC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTGTGAAAAGTTTATAAACGAGGGAGAGTTAAGGATGGATGGACCCAGTTTCTGTAG / / / / // /// / / Hin4II* SspI | | || ||| | BseGI | | || ||| TspGWI | | || ||EcoRII | | || ||BssKI | | || ||SecI* | | || |FokI | | || BseBI | | || ScrFI | | |SetI | | Hin4I | | Hin4I | SetI TspEI MnlI Y N T F Q I F A P S Q F L P T W V K D I I T L F K Y L L P L N S Y L P G S K T S * H F S N I C S L S I P T Y L G Q R H P ----:----|----:----|----:----|----:----|----:----|----:----| Y L V K * I N A G E * N R G V Q T L S M T Y C K E F I Q E R E I G V * R P * L C I V S K L Y K S G R L E * R G P D F V D Hin4I Hin4I | EcoRV | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || NlaIII | | || | ApoI | | || | TspEI | | || | | TspGWI TspDTI CviRI* \ \ \\ \ \ \ \ \ CTATCCGTTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTATTGAAAAAATGCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGGCAACTAATATGCCTATAGTACTTTTAAGAAAGGTTTTCATAACTTTTTTACGTT / / / // / / / / Hin4I | | || | | TspDTI CviRI* Hin4I | | || | TspEI | | || | ApoI | | || TspGWI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII EcoRV L S V D Y T D I M K I L S K S I E K M Q Y P L I I R I S * K F F P K V L K K C N I R * L Y G Y H E N S F Q K Y * K N A I ----:----|----:----|----:----|----:----|----:----|----:----| R D T S * V S I M F I R E L L I S F I C G I R Q N Y P Y * S F E K W F Y Q F F A * G N I I R I D H F N K G F T N F F H L MaeIII Tsp45I | BssKI | SecI* | EcoRII | | ScrFI TatI | | BseBI |Csp6I Hpy188I | | | ApoI ||RsaI | MnlI | | | TspEI CviRI* ||SfaNI \ \ \ \ \ \ \ \\\ TCTGATACCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCAATATAATGGCAGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTATGGGTTCTCCGTTTGCTGTAACACTGGGACCGTTTAAACGTTATATTACCGTCA / / / /// / / / | MnlI | ||| | CviRI* RsaI Hpy188I | ||| TspEI | ||| ApoI | ||EcoRII | ||BssKI | |SecI* | BseBI | ScrFI Tsp45I MaeIII S D T Q E A N D I V T L A N L Q Y N G S L I P K R Q T T L * P W Q I C N I M A V * Y P R G K R H C D P G K F A I * W Q Y ----:----|----:----|----:----|----:----|----:----|----:----| D S V W S A F S M T V R A F K C Y L P L I Q Y G L P L R C Q S G P L N A I Y H C R I G L L C V V N H G Q C I Q L I I A T Hpy166II | SfeI* | |SetI | ||CviRI* | ||| PstI | ||| | AarI | ||| | BspMI | ||| | |CviRI* MaeIII | ||| | || EcoT22I Tsp45I TaqI TspDTI \ \\\ \ \\ \ \ \ \ ACACCTGCAGATGCATTTGAAACAAAAGTCACAAACATTATCGACAGACTGAACAATAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGACGTCTACGTAAACTTTGTTTTCAGTGTTTGTAATAGCTGTCTGACTTGTTATTA // // / / / / / / / / / || || | | | | BspMI Tsp45I TaqI TspDTI BsmI || || | | | | AarI MaeIII || || | | | CviRI* || || | | EcoT22I || || | SfeI* || || CviRI* || |PstI || SfaNI |TatI |SetI Hpy166II Csp6I T P A D A F E T K V T N I I D R L N N N H L Q M H L K Q K S Q T L S T D * T I M T C R C I * N K S H K H Y R Q T E Q * W ----:----|----:----|----:----|----:----|----:----|----:----| V G A S A N S V F T V F M I S L S F L L Y V Q L H M Q F L L * L C * R C V S C Y C R C I C K F C F D C V N D V S Q V I I SetI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| NlaIII | ||| | TspEI | ||| | | MseI | ||| | | VspI | ||| | | |TspEI BsmI | ||| | | || MnlI SetI \ \ \\\ \ \ \\ \ \ GGCATTCATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGGTCTATCTGGCGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTAAGTATAGTTATTGTTCCAGCGTACGGTTAATTAATACTCTCCAGATAGACCGCTT / / /// // / / SetI | ||FatI || | SetI | |CviAII || TspEI | Cac8I |VspI NlaIII |MseI NspI |MnlI SphI TspEI G I H I N N K V A C Q L I M R G L S G E A F I S I T R S H A N * L * E V Y L A N H S Y Q * Q G R M P I N Y E R S I W R I ----:----|----:----|----:----|----:----|----:----|----:----| P M * I L L L T A H W N I I L P R D P S H C E Y * Y C P R M G I L * S L D I Q R A N M D I V L D C A L * N H S T * R A F AflIII | MaeII | |BtrI | || SetI ApoI | || TaiI Tsp4CI* Tsp4CI* TspEI | || | TaqI | AlwNI | DdeI \ \ \\ \ \ \ \ \ \ TATAAATTTTTACGCTACACACGTCATCGACATCTAAATATGACAGTCGCTGAACTGTTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTAAAAATGCGATGTGTGCAGTAGCTGTAGATTTATACTGTCAGCGACTTGACAAG / / // / / / / TspEI | || TaqI | AlwNI Tsp4CI* ApoI | |AflIII Tsp4CI* | |MaeII | BtrI TaiI SetI Y K F L R Y T R H R H L N M T V A E L F I N F Y A T H V I D I * I * Q S L N C S * I F T L H T S S T S K Y D S R * T V L ----:----|----:----|----:----|----:----|----:----|----:----| Y L N K R * V R * R C R F I V T A S S N I Y I K V S C V D D V D L Y S L R Q V T I F K * A V C T M S M * I H C D S F Q E MboI MboII |TspDTI ||DpnI EcoRV |||TaqI | FatI |||BstKTI | |CviAII ||||Hpy178III* SetI | || NlaIII ||||| BinI* TspEI \ \\ \ \\\\\ \ \ TTAGATATCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAGCAAACCTAATTAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTATAGGTACGATAAATACTTCTTGTTGTCCCTAGCTCTTTGTCGTTTGGATTAATG / / / // / // /// / / /// | | | |FatI | || ||| BinI* SetI ||BspCNI | | | CviAII | || ||Hpy178III* |BseMII | | NlaIII | || |TaqI TspEI | EcoRV | || MboI DdeI | |DpnI | BstKTI TspDTI MboII L D I H A I Y E E Q Q G S R N S K P N Y * I S M L F M K N N R D R E T A N L I T R Y P C Y L * R T T G I E K Q Q T * L Q ----:----|----:----|----:----|----:----|----:----|----:----| K S I W A I * S S C C P D L F L L G L * R L Y G H * K H L V V P I S F C C V * N * I D M S N I F F L L S R S V A F R I V TfiI HinfI | MboII | | TseI | | |BisI | | ||BlsI | | |||AluI BseMII DdeI | | |||CviJI |BspCNI |Hpy188I | | |||| SetI BbvI \\ \\ \ \ \\\\ \ \ AGGAGAAATCTGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAATACAACCAAACCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTTTAGACTCACTACTCTTCTTACTAAGAGCGTCGATATGCTTATGTTGGTTTGGG / / // /// / | DdeI || ||CviJI BbvI Hpy188I || ||TseI || ||AluI || |BisI || BlsI || SetI |MboII HinfI TfiI R R N L S D E K N D S R S Y T N T T K P G E I * V M R R M I L A A I R I Q P N P E K S E * * E E * F S Q L Y E Y N Q T Q ----:----|----:----|----:----|----:----|----:----|----:----| L L F R L S S F F S E R L * V F V V L G C S F D S H H S S H N E C S Y S Y L W V P S I Q T I L L I I R A A I R I C G F G TstI BssKI CviJI EcoRII AluI |SecI* CviJI ||ScrFI | SetI MnlI ||BseBI | | Hpy188I | TspEI ||| CviJI | | |TfiI | | TaqI ||| | SduI | | |HinfI | | AsuII TaqI ||| | HgiJII* \ \ \\ \ \ \ \ \\\ \ \ AAAGTTATAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAAAACAGCCAGGGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAATATCGAGCCTTAGGAGTTTTTTGTTTATTAAGCTTTAGCTTTTGTCGGTCCCGA / / / / / / / / / / //// | | | HinfI MnlI | AsuII | TstI | |||CviJI | | | TfiI | TaqI TaqI | ||EcoRII | | Hpy188I TspEI | ||BssKI | CviJI | ||SecI* | AluI | |HgiJII* SetI | |SduI | BseBI | ScrFI CviJI K V I A R N P Q K T N N S K S K T A R A K L * L G I L K K Q I I R N R K Q P G L S Y S S E S S K N K * F E I E N S Q G S ----:----|----:----|----:----|----:----|----:----|----:----| L T I A R F G * F V F L E F D F V A L A W L * L E S D E F F L Y N S I S F L W P F N Y S P I R L F C I I R F R F C G P S TspGWI TstI | BdaI | BseYI TfiI | BdaI BciVI | | GsaI HinfI | BccI \ \ \ \ \ \ \ CACAATGTATCCACATCTAATAACTCTCCCAGCACGGACAACGATTCCATCAGTAAATCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTACATAGGTGTAGATTATTGAGAGGGTCGTGCCTGTTGCTAAGGTAGTCATTTAGT / / / / // / / | TstI | BseYI || | BccI BciVI GsaI || BdaI || BdaI |TspGWI HinfI TfiI H N V S T S N N S P S T D N D S I S K S T M Y P H L I T L P A R T T I P S V N Q Q C I H I * * L S Q H G Q R F H Q * I N ----:----|----:----|----:----|----:----|----:----|----:----| * L T D V D L L E G L V S L S E M L L D E C H I W M * Y S E W C P C R N W * Y I V I Y G C R I V R G A R V V I G D T F * DdeI SauI* |SetI || Hin4II* || | BssKI XmnI || | CviJI |TfiI || | EcoRII |HinfI BdaI || | HaeIII || MfeI BdaI || | | ScrFI || TspEI | HphI SetI || | | BseBI \\ \ \ \ \ \\ \ \ \ ACTACTGAACCGATTCAATTGAACAATAAGCACGACCTTCACCTTAGGCCAGGAACTTAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGACTTGGCTAAGTTAACTTGTTATTCGTGCTGGAAGTGGAATCCGGTCCTTGAATG / / / / / / / // / / / | | TspEI | | SetI SetI || | | EcoRII | | MfeI | HphI || | | BssKI | HinfI BdaI || | BseBI | TfiI BdaI || | ScrFI XmnI || HaeIII || CviJI |SauI* |DdeI Hin4II* T T E P I Q L N N K H D L H L R P G T Y L L N R F N * T I S T T F T L G Q E L T Y * T D S I E Q * A R P S P * A R N L L ----:----|----:----|----:----|----:----|----:----|----:----| V V S G I * N F L L C S R * R L G P V * L * Q V S E I S C Y A R G E G * A L F K S S F R N L Q V I L V V K V K P W S S V TGA --- ACT * X X --- Q S S # Enzymes that cut Frequency Isoschizomers AarI 2 AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AflIII 1 AluI 4 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvCI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 6 BceAI 1 BciVI 2 BfuI BdaI 2 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 Bpu10I 1 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 4 BseRI 1 BseYI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspMI 3 BfuAI,Acc36I,BveI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 3 BstXI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 1 BstC8I Csp6I 5 CviQI,RsaNI CviAII 6 CviJI 12 CviKI-1 CviRI* 5 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 3 MalI Eco57I 1 AcuI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 5 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 6 FokI 3 GlaI 1 GsaI 1 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 10 HpaI 1 KspAI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 8 MaeII 3 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 10 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 6 Hin1II,Hsp92II,FaeI NspBII* 2 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PstI 1 PvuII 1 RsaI 5 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 25 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 1 TaiI 3 TaqI 6 TaqII 2 TatI 2 TfiI 8 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 12 TasI,Tsp509I,Sse9I TspGWI 7 TspRI 2 TscAI TstI 1 VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BaeI BalI BamHI BarI BbvII* Bce83I* BcgI BclI BetI* BfiI BglI BglII BmeT110I BmtI BplI BsaAI BsaBI BsaXI BsePI BseSI BsgI BsiI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BstAPI BstEII BtgZI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoRI EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsuI HgaI HgiCI* HindIII HpaII Hpy99I KasI KpnI Ksp632I* MaeI MauBI McrI* MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SrfI Sse232I* Sse8387I StuI StyI SwaI TauI TsoI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769