Restriction Map of SPC110/YDR356W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SPC110/YDR356W on chromosome IV from coordinates 1186107 to 1188941.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28058

FatI |CviAII Hin4I || NlaIII Eam1105I | AluI || |ApoI | MaeIII | CviJI || |TspEI | Tsp45I | | SetI || || MboII SfeI* \ \ \ \ \ \\ \\ \ \ ATGGACGAAGCGTCACATCTCCCAAATGGGAGCTTGAAGAACATGGAATTTACGCCTGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGCTTCGCAGTGTAGAGGGTTTACCCTCGAACTTCTTGTACCTTAAATGCGGACAT / / / / / / // / / / | | Hin4I | CviJI | || | TspEI SfeI* | Tsp45I | AluI | || | ApoI | MaeIII SetI | || MboII Eam1105I | |FatI | CviAII NlaIII M D E A S H L P N G S L K N M E F T P V W T K R H I S Q M G A * R T W N L R L * G R S V T S P K W E L E E H G I Y A C R ----:----|----:----|----:----|----:----|----:----|----:----| X S S A D C R G F P L K F F M S N V G T X P R L T V D G L H S S S S C P I * A Q H V F R * M E W I P A Q L V H F K R R Y SetI DdeI NlaIV \ \ GGATTTATCAAATCCAAGCGAAACACCACGCAAACACAAGTTGTATCGCCTACTAAGGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAATAGTTTAGGTTCGCTTTGTGGTGCGTTTGTGTTCAACATAGCGGATGATTCCAA // / || NlaIV |DdeI SetI G F I K S K R N T T Q T Q V V S P T K V D L S N P S E T P R K H K L Y R L L R F I Y Q I Q A K H H A N T S C I A Y * G S ----:----|----:----|----:----|----:----|----:----|----:----| P N I L D L R F V V C V C T T D G V L T L I * * I W A F C W A F V L Q I A * * P S K D F G L S V G R L C L N Y R R S L N Hin4II* | HphI | | AsuI* | | DraII | | |CviJI | | |HaeIII | | |BmgT120I | | || MseI \ \ \\ \ CCAAATGCCAATAATGGTGATGAGAACGAAGGCCCTGTTAAGAAAAGGCAGAGAAGAAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTACGGTTATTACCACTACTCTTGCTTCCGGGACAATTCTTTTCCGTCTCTTCTTCG / / /// / | HphI ||DraII MseI Hin4II* ||AsuI* |BmgT120I HaeIII CviJI P N A N N G D E N E G P V K K R Q R R S Q M P I M V M R T K A L L R K G R E E A K C Q * W * * E R R P C * E K A E K K H ----:----|----:----|----:----|----:----|----:----|----:----| G F A L L P S S F S P G T L F L C L L L E L H W Y H H H S R L G Q * S F A S F F W I G I I T I L V F A R N L F P L S S A MboII HindIII | MlyI | AluI | PleI | CviJI | |MfeI | | SetI | |TspEI | | | TspEI AluI | || HinfI CviJI | | | | TaqI CviJI \ \\ \ \ \ \ \ \ \ \ ATTGATGATACAATTGACTCCACAAGGCTATTTAGTGAAGCTTCACAATTCGATGACAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACTATGTTAACTGAGGTGTTCCGATAAATCACTTCGAAGTGTTAAGCTACTGTCG / // / / / / / / / / / / MboII || | HinfI CviJI | | HindIII | TaqI | CviJI || TspEI | CviJI TspEI | AluI || MfeI | AluI SetI |PleI SetI MlyI I D D T I D S T R L F S E A S Q F D D S L M I Q L T P Q G Y L V K L H N S M T A * * Y N * L H K A I * * S F T I R * Q L ----:----|----:----|----:----|----:----|----:----|----:----| M S S V I S E V L S N L S A E C N S S L C Q H Y L Q S W L A I * H L K V I R H C N I I C N V G C P * K T F S * L E I V A SetI | Hpy178III* | | TspEI BsrDI | | | MseI HindII | | | | EciI AciI StyI SetI Hpy166II | | | | | CviJI | MaeI SecI* BsiYI* | PshAI \ \ \ \ \ \ \ \ \ \ \ \ TTTCCAGAAATTAAGGCTAACATTCCGCCTAGTCCAAGGTCAGGCAATGTTGACAAAAGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTCTTTAATTCCGATTGTAAGGCGGATCAGGTTCCAGTCCGTTACAACTGTTTTCA / // / / / /// / / / | || CviJI | MaeI ||SecI* | | PshAI | |MseI AciI ||StyI | Hpy166II | TspEI |BsiYI* | HindII | EciI SetI BsrDI Hpy178III* F P E I K A N I P P S P R S G N V D K S F Q K L R L T F R L V Q G Q A M L T K V S R N * G * H S A * S K V R Q C * Q K S ----:----|----:----|----:----|----:----|----:----|----:----| K G S I L A L M G G L G L D P L T S L L S E L F * P * C E A * D L T L C H Q C F K W F N L S V N R R T W P * A I N V F T DdeI ApoI | BsmAI TspEI MboII | |CviJI BspCNI \ \ \ \\ \ CGCAAGAGAAATTTGATTGATGATTTGAAGAAAGATGTGCCAATGTCTCAGCCCTTGAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTTCTCTTTAAACTAACTACTAAACTTCTTTCTACACGGTTACAGAGTCGGGAACTTT / / // / // TspEI MboII || | |BseMII ApoI || | BspCNI || BsmAI |CviJI DdeI R K R N L I D D L K K D V P M S Q P L K A R E I * L M I * R K M C Q C L S P * K Q E K F D * * F E E R C A N V S A L E R ----:----|----:----|----:----|----:----|----:----|----:----| R L L F K I S S K F F S T G I D * G K F D C S F N S Q H N S S L H A L T E A R S A L S I Q N I I Q L F I H W H R L G Q F MboII |TspDTI BseMII || Tsp4CI* \ \\ \ GAACAAGAAGTAAGAGAACACCAAATGAAGAAAGAGCGATTTGACCGTGCTTTAGAGAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTCTTCATTCTCTTGTGGTTTACTTCTTTCTCGCTAAACTGGCACGAAATCTCTCA / / TspDTI Tsp4CI* MboII E Q E V R E H Q M K K E R F D R A L E S N K K * E N T K * R K S D L T V L * R V T R S K R T P N E E R A I * P C F R E * ----:----|----:----|----:----|----:----|----:----|----:----| S C S T L S C W I F F S R N S R A K S L L V L L L L V G F S S L A I Q G H K L S F L F Y S F V L H L F L S K V T S * L T ApoI TspEI MaeI TspEI Hpy188I \ \ \ \ AAATTACTAGGAAAAAGACACATAACATACGCAAATTCTGATATTTCTAATAAGGAACTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAATGATCCTTTTTCTGTGTATTGTATGCGTTTAAGACTATAAAGATTATTCCTTGAA / / // | MaeI |Hpy188I TspEI TspEI ApoI K L L G K R H I T Y A N S D I S N K E L N Y * E K D T * H T Q I L I F L I R N F I T R K K T H N I R K F * Y F * * G T L ----:----|----:----|----:----|----:----|----:----|----:----| L N S P F L C M V Y A F E S I E L L S S Y I V L F F V C L M R L N Q Y K * Y P V F * * S F S V Y C V C I R I N R I L F K Hpy178III* | TspDTI | | FatI TspEI MseI | | |CviAII | MseI VspI | | || NlaIII | |TspDTI \ \ \ \\ \ \ \\ TACATTAATGAAATCAAGAGTTTGAAGCATGAAATCAAAGAATTAAGAAAGGAAAAAAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAATTACTTTAGTTCTCAAACTTCGTACTTTAGTTTCTTAATTCTTTCCTTTTTTTG / / / / // / // VspI | | | |FatI | |MseI MseI | | | CviAII | TspEI | | NlaIII TspDTI | TspDTI Hpy178III* Y I N E I K S L K H E I K E L R K E K N T L M K S R V * S M K S K N * E R K K T H * * N Q E F E A * N Q R I K K G K K R ----:----|----:----|----:----|----:----|----:----|----:----| * M L S I L L K F C S I L S N L F S F F K C * H F * S N S A H F * L I L F P F F V N I F D L T Q L M F D F F * S L F F V MboII TspEI | MboII MboII \ \ \ \ GATACTCTCAATAATTATGATACCCTTGAAGAAGAAACAGATGACTTGAAGAACAGATTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGAGAGTTATTAATACTATGGGAACTTCTTCTTTGTCTACTGAACTTCTTGTCTAAT / / / / TspEI | MboII MboII MboII D T L N N Y D T L E E E T D D L K N R L I L S I I M I P L K K K Q M T * R T D Y Y S Q * L * Y P * R R N R * L E E Q I T ----:----|----:----|----:----|----:----|----:----|----:----| S V R L L * S V R S S S V S S K F F L N R Y E * Y N H Y G Q L L F L H S S S C I I S E I I I I G K F F F C I V Q L V S * Hin6I |GlaI AluI ApoI |Eco47III CviJI TspEI ||HhaI | SetI HgaI EcoRI MboI |||HaeII | | AcyI | TspEI | Hpy178III* BclI \\\\ \ \ \ \ \ \ \ \ CAAGCGCTGGAAAAAGAGCTGGACGCCAAAAATAAAATTGTGAATTCAAGAAAAGTAGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGCGACCTTTTTCTCGACCTGCGGTTTTTATTTTAACACTTAAGTTCTTTTCATCTA //// / / / / / / / |||Hin6I | CviJI AcyI | TspEI | Hpy178III* ||Eco47III | AluI HgaI EcoRI ||GlaI SetI TspEI |HhaI ApoI HaeII Q A L E K E L D A K N K I V N S R K V D K R W K K S W T P K I K L * I Q E K * M S A G K R A G R Q K * N C E F K K S R * ----:----|----:----|----:----|----:----|----:----|----:----| C A S S F S S S A L F L I T F E L F T S V L A P F L A P R W F Y F Q S N L F L L L R Q F F L Q V G F I F N H I * S F Y I SfaNI |DpnI ||BstKTI ||| Hpy178III* ||| | CviRI* ||| | | BseGI ||| | | EcoT22I ||| | | | FokI ||| | | | |MaeII ||| | | | || SetI ||| | | | || TaiI ||| | | | || |Hpy166II CviJI ||| | | | || || MboII | TspEI \\\ \ \ \ \\ \\ \ \ \ GATCATTCTGGATGCATAGAAGAACGTGAACAAATGGAAAGAAAGTTGGCTGAATTAGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTAAGACCTACGTATCTTCTTGCACTTGTTTACCTTTCTTTCAACCGACTTAATCTT // // / / / / /// / / / || || | | CviRI* | ||| MboII CviJI TspEI || || | | BseGI | ||Hpy166II || || | EcoT22I | |FokI || || Hpy178III* | MaeII || |SfaNI TaiI || BclI SetI || MboI |DpnI BstKTI D H S G C I E E R E Q M E R K L A E L E I I L D A * K N V N K W K E S W L N * K S F W M H R R T * T N G K K V G * I R K ----:----|----:----|----:----|----:----|----:----|----:----| S * E P H M S S R S C I S L F N A S N S H D N Q I C L L V H V F P F F T P Q I L I M R S A Y F F T F L H F S L Q S F * F MaeIII Tsp45I | MaeII | | Csp6I | | |RsaI MaeI | | |SetI Tsp4CI* | TspEI | | |TaiI \ \ \ \ \ \\ AGAAAACTGAAAACTGTGAAAGACCAAGTGCTAGAATTAGAGAATAATAGTGACGTACAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTGACTTTTGACACTTTCTGGTTCACGATCTTAATCTCTTATTATCACTGCATGTT / / / / //// Tsp4CI* MaeI TspEI | |||Csp6I | ||RsaI | |MaeII | Tsp45I | MaeIII TaiI SetI R K L K T V K D Q V L E L E N N S D V Q E N * K L * K T K C * N * R I I V T Y K K T E N C E R P S A R I R E * * * R T K ----:----|----:----|----:----|----:----|----:----|----:----| L F S F V T F S W T S S N S F L L S T C F F V S F Q S L G L A L I L S Y Y H R V S F Q F S H F V L H * F * L I I T V Y L MboI BglII ApoI XhoII TspEI | MnlI |FokI SapI MseI | DpnI || MseI TspEI |AhaIII* | |BstKTI TspEI || |TspDTI TspDTI || TspEI | ||DdeI | BseGI || || MboII Ksp632I* \\ \ \ \\\ \ \ \\ \\ \ \ AGTTTAAAATTGAGATCTAAGGAGGATGAATTGAAGAATTTAATGAATGAGTTGAATGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAATTTTAACTCTAGATTCCTCCTACTTAACTTCTTAAATTACTTACTCAACTTACTT // / // / / / / //// / / |MseI | || | DdeI | TspEI |||| MboII TspDTI | | || XhoII BseGI |||MseI | | || BglII ||FokI | | || MboI |TspEI | | |DpnI |ApoI | | BstKTI TspDTI | | MnlI | TspEI AhaIII* S L K L R S K E D E L K N L M N E L N E V * N * D L R R M N * R I * * M S * M N F K I E I * G G * I E E F N E * V E * I ----:----|----:----|----:----|----:----|----:----|----:----| L K F N L D L S S S N F F K I F S N F S F N L I S I * P P H I S S N L S H T S H T * F Q S R L L I F Q L I * H I L Q I F MboII | Tsp4CI* | | ApoI TspDTI | | TspEI | CviRI* | | EcoRI | |MmeI | | | Hpy178III* | ||BsrDI | | | | BseMII | ||MboII | | | | |BspCNI | ||| BciVI | | | | || MnlI DdeI \ \\\ \ \ \ \ \ \\ \ \ TTGAAGAGCAATGCAGAAGAAAAGGATACACAGTTGGAATTCAAGAAAAATGAACTGAGG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTCGTTACGTCTTCTTTTCCTATGTGTCAACCTTAAGTTCTTTTTACTTGACTCC // / /// / / / / // / / |TspEI | ||| BciVI | Tsp4CI* | || MnlI DdeI | | ||MboII MboII | |BspCNI | | |CviRI* | Hpy178III* | | |BsrDI | BseMII | | MmeI EcoRI | TspDTI TspEI Ksp632I* ApoI SapI L K S N A E E K D T Q L E F K K N E L R * R A M Q K K R I H S W N S R K M N * G E E Q C R R K G Y T V G I Q E K * T E E ----:----|----:----|----:----|----:----|----:----|----:----| N F L L A S S F S V C N S N L F F S S L I S S C H L L F P Y V T P I * S F H V S Q L A I C F F L I C L Q F E L F I F Q P TspEI BccI TspDTI | MseI TspDTI Hpy188I \ \ \ \ \ AAACGAACAAATGAATTAAATGAGTTGAAAATCAAGTCTGATGAGATGGATTTACAACTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCTTGTTTACTTAATTTACTCAACTTTTAGTTCAGACTACTCTACCTAAATGTTGAT / // / / / TspDTI |MseI TspDTI | BccI TspEI Hpy188I K R T N E L N E L K I K S D E M D L Q L N E Q M N * M S * K S S L M R W I Y N * T N K * I K * V E N Q V * * D G F T T K ----:----|----:----|----:----|----:----|----:----|----:----| F R V F S N F S N F I L D S S I S K C S S V F L H I L H T S F * T Q H S P N V V F S C I F * I L Q F D L R I L H I * L * AluI CviJI TfiI MseI TspEI | SetI ApoI HinfI |TspDTI | MseI | TspDTI TspEI \ \\ \ \ \ \ \ AAACAAAAACAAAATGAATCAAAAAGATTAAAAGATGAATTAAATGAGCTTGAAACCAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTTTTGTTTTACTTAGTTTTTCTAATTTTCTACTTAATTTACTCGAACTTTGGTTT / / / // / / HinfI | MseI || | TspDTI TfiI TspDTI || | CviJI || | AluI || SetI |MseI TspEI K Q K Q N E S K R L K D E L N E L E T K N K N K M N Q K D * K M N * M S L K P N T K T K * I K K I K R * I K * A * N Q I ----:----|----:----|----:----|----:----|----:----|----:----| F C F C F S D F L N F S S N F S S S V L L V F V F H I L F I L L H I L H A Q F W F L F L I F * F S * F I F * I L K F G F MboII CviRI* BbvII* | BspCNI | DdeI | |BseMII TspEI TspDTI \ \ \ \\ \ \ TTCAGCGAAAATGGTTCTCAGTCTTCTGCAAAAGAAAATGAATTGAAAATGCTGAAAAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCGCTTTTACCAAGAGTCAGAAGACGTTTTCTTTTACTTAACTTTTACGACTTTTTA / / / / // / / TspEI | | DdeI |BseMII TspEI TspDTI ApoI | BbvII* BspCNI MboII CviRI* F S E N G S Q S S A K E N E L K M L K N S A K M V L S L L Q K K M N * K C * K I Q R K W F S V F C K R K * I E N A E K * ----:----|----:----|----:----|----:----|----:----|----:----| N L S F P E * D E A F S F S N F I S F F I * R F H N E T K Q L L F H I S F A S F E A F I T R L R R C F F I F Q F H Q F I CviJI | MnlI | | AluI | | CviJI MboII | | |MaeI | NmeAIII | | ||SetI | | ApoI Tsp4CI* | | ||Ksp632I* | | TspEI | MseI Hin4II* \ \ \\\ \ \ \ \ \ \ AAAATAGCCGAGCTAGAGGAAGAGATTAGCACGAAAAATTCACAGTTAATCGCAAAAGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATCGGCTCGATCTCCTTCTCTAATCGTGCTTTTTAAGTGTCAATTAGCGTTTTCTT // / / / / // / / / / / || | | | Ksp632I* |NmeAIII | | | Hin4II* SetI || | | MaeI MboII | | MseI || | CviJI | Tsp4CI* || | AluI TspEI || SetI ApoI |MnlI CviJI K I A E L E E E I S T K N S Q L I A K E K * P S * R K R L A R K I H S * S Q K K N S R A R G R D * H E K F T V N R K R R ----:----|----:----|----:----|----:----|----:----|----:----| L I A S S S S S I L V F F E C N I A F S Y F L R A L P L S * C S F N V T L R L L F Y G L * L F L N A R F I * L * D C F F MseI VspI | SfaNI | | CviJI | | |DdeI Hpy166II | | |EspI* MfeI | MseI | | || AluI TspEI | | BsmAI | | || CviJI | BspCNI | | | MlyI BfiI SetI | | || | SetI | |BseMII | | | PleI Bce83I* \ \ \ \\ \ \ \ \\ \ \ \ \ \ GGTAAGTTAGCATCATTAATGGCTCAGCTAACTCAATTGGAGAGTAAACTTAATCAAAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTCAATCGTAGTAATTACCGAGTCGATTGAGTTAACCTCTCATTTGAATTAGTTTCT / // /// // / / / ///// | || ||CviJI || TspEI | | ||||BfiI | || ||AluI || MfeI | | |||Bce83I* | || |EspI* |BseMII | | ||BsmAI | || |DdeI BspCNI | | |PleI | || SetI | | MlyI | |SfaNI | MseI | CviJI Hpy166II VspI MseI G K L A S L M A Q L T Q L E S K L N Q R V S * H H * W L S * L N W R V N L I K E * V S I I N G S A N S I G E * T * S K R ----:----|----:----|----:----|----:----|----:----|----:----| P L N A D N I A * S V * N S L L S L * L L Y T L M M L P E A L E I P S Y V * D F T L * C * * H S L * S L Q L T F K I L S CviJI |SmlI AluI HinfI ||SduI MboII CviJI | BsrI ||HgiJII* TspEI | MboII | SetI \ \ \\\ \ \ \ \ \ GACTCCCAGTTGGGCTCAAGGGAAGAAGAATTGAAAAAAACAAACGATAAGCTACAAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGGGTCAACCCGAGTTCCCTTCTTCTTAACTTTTTTTGTTTGCTATTCGATGTTTTT / / / / // / / / HinfI | | SmlI || MboII | CviJI BsrI | CviJI |MboII | AluI HgiJII* TspEI SetI SduI D S Q L G S R E E E L K K T N D K L Q K T P S W A Q G K K N * K K Q T I S Y K K L P V G L K G R R I E K N K R * A T K R ----:----|----:----|----:----|----:----|----:----|----:----| S E W N P E L S S S N F F V F S L S C F L S G T P S L P L L I S F F L R Y A V F V G L Q A * P F F F Q F F C V I L * L F BseGI | MboII | |TspEI | || FokI | || | MboI | || | | DpnI EcoRV | || | | TspDTI | Hpy178III* Hin4I | || | | |BstKTI | | MnlI Tsp4CI* Hin4I | || | | || TspGWI \ \ \ \ \ \ \\ \ \ \\ \ GATATCAGGATAGCAAGAGAGGAAACAGTTTCAAAGGATGAACGGATAATTGATCTTCAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGTCCTATCGTTCTCTCCTTTGTCAAAGTTTCCTACTTGCCTATTAACTAGAAGTT / / / / / / / /// / | | MnlI | Hin4I | MboII ||| TspGWI | Hpy178III* | Hin4I BseGI ||| MboI EcoRV Tsp4CI* ||FokI ||DpnI |BstKTI TspDTI TspEI D I R I A R E E T V S K D E R I I D L Q I S G * Q E R K Q F Q R M N G * L I F K Y Q D S K R G N S F K G * T D N * S S K ----:----|----:----|----:----|----:----|----:----|----:----| S I L I A L S S V T E F S S R I I S R * L Y * S L L L P F L K L P H V S L Q D E I D P Y C S L F C N * L I F P Y N I K L MseI AluI SetI CviJI Tsp4CI* Hin4I |MaeI | HinfI Hin4I ||SetI | | TspRI \ \\\ \ \ \ AAAAAGGTTAAACAGCTAGAAAATGACTTATTTGTGATAAAAAAAACGCACAGTGAGTCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCCAATTTGTCGATCTTTTACTGAATAAACACTATTTTTTTTGCGTGTCACTCAGA // / / / / / / / |SetI | | | MaeI | | HinfI Hin4I | | CviJI | Tsp4CI* Hin4I | | AluI TspRI | SetI MseI K K V K Q L E N D L F V I K K T H S E S K R L N S * K M T Y L * * K K R T V S L K G * T A R K * L I C D K K N A Q * V * ----:----|----:----|----:----|----:----|----:----|----:----| F F T L C S S F S K N T I F F V C L S D F F P * V A L F H S I Q S L F F A C H T F L N F L * F I V * K H Y F F R V T L R MaeI |FalI |FalI MseI PleI || TfiI | ApoI FalI |MlyI || HinfI TspDTI | TspEI FalI \\ \\ \ \ \ \ \ AAAACTATTACTGATAATGAACTAGAATCTAAAGATAAACTTATTAAAATTTTAGAAAAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGATAATGACTATTACTTGATCTTAGATTTCTATTTGAATAATTTTAAAATCTTTTG / / / / / / // PleI FalI | | TspDTI | |TspEI MlyI FalI | HinfI | |ApoI | TfiI | FalI MaeI | FalI MseI K T I T D N E L E S K D K L I K I L E N K L L L I M N * N L K I N L L K F * K T N Y Y * * * T R I * R * T Y * N F R K R ----:----|----:----|----:----|----:----|----:----|----:----| L V I V S L S S S D L S L S I L I K S F * F * * Q Y H V L I * L Y V * * F K L F F S N S I I F * F R F I F K N F N * F V BplI BplI | AluI | CviJI MseI | Ecl136II |AhaIII* | | SetI || BplI TatI | | SduI || BplI |Csp6I | | SacI || |SetI ||RsaI | | HgiAI* ApoI || || CviRI* ||ScaI | | HgiJII* TspEI \\ \\ \ \\\ \ \ \ \ GATTTAAAGGTTGCACAAGAGAAGTACTCTAAAATGGAAAAAGAGCTCAAAGAAAGGGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTTCCAACGTGTTCTCTTCATGAGATTTTACCTTTTTCTCGAGTTTCTTTCCCTT /// / /// / / / ||SetI CviRI* ||TatI BplI | Ecl136II |MseI |Csp6I BplI | CviJI AhaIII* ScaI | AluI BplI RsaI HgiJII* BplI HgiAI* SacI SduI SetI D L K V A Q E K Y S K M E K E L K E R E I * R L H K R S T L K W K K S S K K G N F K G C T R E V L * N G K R A Q R K G I ----:----|----:----|----:----|----:----|----:----|----:----| S K F T A C S F Y E L I S F S S L S L S R N L P Q V L S T S * F P F L A * L F P I * L N C L L L V R F H F F L E F F P F MmeI Hpy188I | ApoI |TfiI ApoI MseI | TspEI |HinfI MboII TspDTI TspEI \ \ \ \\ \ \ \ TTTAACTATAAAATTTCCGAATCAAAGTTGGAAGATGAAAAGACCACGCTAAATGAAAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGATATTTTAAAGGCTTAGTTTCAACCTTCTACTTTTCTGGTGCGATTTACTTTTT / / / / / / / / | | MmeI | | HinfI MboII TspDTI | MseI | | TfiI TspEI | Hpy188I ApoI TspEI ApoI F N Y K I S E S K L E D E K T T L N E K L T I K F P N Q S W K M K R P R * M K K * L * N F R I K V G R * K D H A K * K N ----:----|----:----|----:----|----:----|----:----|----:----| N L * L I E S D F N S S S F V V S F S F I * S Y F K R I L T P L H F S W A L H F K V I F N G F * L Q F I F L G R * I F F TspDTI |DdeI || CviJI || |AciI Hin4I || |BisI AluI | TspEI || ||BlsI CviJI | | TaqI || |||TauI | SetI MnlI | | | HphI \\ \\\\ \ \ \ \ \ \ \ ATTTCTAACTTAGCCGCAGAAAACTCACAGCTAAAAAATAAAATAGAGGACAATTCGACT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGATTGAATCGGCGTCTTTTGAGTGTCGATTTTTTATTTTATCTCCTGTTAAGCTGA / / ///// / / / / / / | | ||||AciI | CviJI MnlI Hin4I | TaqI | | |||BisI | AluI | HphI | | ||BlsI SetI TspEI | | |CviJI | | |TauI | | DdeI | TspDTI TspEI ApoI I S N L A A E N S Q L K N K I E D N S T F L T * P Q K T H S * K I K * R T I R L F * L S R R K L T A K K * N R G Q F D C ----:----|----:----|----:----|----:----|----:----|----:----| I E L K A A S F E C S F F L I S S L E V F K * S L R L F S V A L F Y F L P C N S N R V * G C F V * L * F I F Y L V I R S TfiI DdeI NdeI Hin4I TspDTI HinfI Bpu10I Ksp632I* \ \ \ \ \ \ GCCACTCACCATATGAAAGAAAACTATGAGAAGCAGTTAGAATCGCTAAGGAAAGATATT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGAGTGGTATACTTTCTTTTGATACTCTTCGTCAATCTTAGCGATTCCTTTCTATAA / / / / / / | Hin4I TspDTI HinfI Bpu10I Ksp632I* NdeI TfiI DdeI A T H H M K E N Y E K Q L E S L R K D I P L T I * K K T M R S S * N R * G K I L H S P Y E R K L * E A V R I A K E R Y * ----:----|----:----|----:----|----:----|----:----|----:----| A V * W I F S F * S F C N S D S L F S I Q W E G Y S L F S H S A T L I A L S L Y G S V M H F F V I L L L * F R * P F I N TfiI HinfI | Hpy188I MboII | | MnlI TatI | Hin6I | | | TspEI Eco57I |Csp6I | |GlaI | | | BbvII* Eco57MI ||RsaI | ||HhaI | | | | MboII | TspEI \\\ \ \\\ \ \ \ \ \ \ \ GAAGAGTACAAAGAAAGCGCAAAAGATTCTGAAGACAAAATTGAGGAACTAAAAATTAGG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCATGTTTCTTTCGCGTTTTCTAAGACTTCTGTTTTAACTCCTTGATTTTTAATCC /// / /// // / / / / ||| | ||Hin6I || MnlI | Eco57MI TspEI ||| | |GlaI |Hpy188I | Eco57I ||| | HhaI HinfI BbvII* ||| MboII TfiI MboII ||TatI TspEI |Csp6I RsaI E E Y K E S A K D S E D K I E E L K I R K S T K K A Q K I L K T K L R N * K L G R V Q R K R K R F * R Q N * G T K N * D ----:----|----:----|----:----|----:----|----:----|----:----| S S Y L S L A F S E S S L I S S S F I L Q L T C L F R L L N Q L C F Q P V L F * F L V F F A C F I R F V F N L F * F N P Hpy188I | MboI ApoI | | DpnI TspEI Hin4I | | |BstKTI Hin4I \ \ \ \ \\ \ ATTGCTGAAAATTCTGCTAAAGTATCGGAGAAAAGATCAAAGGATATAAAACAAAAAGAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGACTTTTAAGACGATTTCATAGCCTCTTTTCTAGTTTCCTATATTTTGTTTTTCTA // / // / / |Hin4I Hpy188I || MboI Hin4I TspEI |DpnI ApoI BstKTI I A E N S A K V S E K R S K D I K Q K D L L K I L L K Y R R K D Q R I * N K K M C * K F C * S I G E K I K G Y K T K R * ----:----|----:----|----:----|----:----|----:----|----:----| I A S F E A L T D S F L D F S I F C F S S Q Q F N Q * L I P S F I L P Y L V F L N S F I R S F Y R L F S * L I Y F L F I MboI | DpnI | |BstKTI | || TspDTI | || | SetI | || | | DdeI MboII | || | | | Hpy188I BspCNI |AluI | || | | | |TfiI |BseMII |CviJI | || | | | |HinfI || BplI || SetI | || | | | ||MnlI || BplI || | MseI \ \\ \ \ \ \\\ \\ \ \\ \ \ GAACAGATCAGCGACCTCACTCAGAATCTAAAACTACAAGAAGATGAGATAAGCTCATTA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCTAGTCGCTGGAGTGAGTCTTAGATTTTGATGTTCTTCTACTCTATTCGAGTAAT // / // /// / // / / / || | |SetI ||| | |BseMII | CviJI MseI || | TspDTI ||| | |BplI | AluI || MboI ||| | |BplI MboII |DpnI ||| | BspCNI SetI BstKTI ||| HinfI ||| TfiI ||MnlI |DdeI Hpy188I E Q I S D L T Q N L K L Q E D E I S S L N R S A T S L R I * N Y K K M R * A H * T D Q R P H S E S K T T R R * D K L I K ----:----|----:----|----:----|----:----|----:----|----:----| S C I L S R V * F R F S C S S S I L E N H V S * R G * E S D L V V L L H S L S M F L D A V E S L I * F * L F I L Y A * * TspEI Csp6I BsaBI |BplI |RsaI | MfeI |BplI |SetI | TspEI Hpy188I \\ \\ \ \ \ AAATCCATAATTGACAGGTACAAAAAAGATTTCAATCAATTGAAATCTGAACAGAGTAAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGGTATTAACTGTCCATGTTTTTTCTAAAGTTAGTTAACTTTAGACTTGTCTCATTA / / / // / / / BplI | | |Csp6I BsaBI TspEI Hpy188I BplI | | RsaI MfeI | SetI TspEI K S I I D R Y K K D F N Q L K S E Q S N N P * L T G T K K I S I N * N L N R V I I H N * Q V Q K R F Q S I E I * T E * Y ----:----|----:----|----:----|----:----|----:----|----:----| F D M I S L Y L F S K L * N F D S C L L L I W L Q C T C F L N * D I S I Q V S Y F G Y N V P V F F I E I L Q F R F L T I FatI |CviAII || NlaIII || | SetI || | |ApoI || | |TspEI MmeI Hpy178III* MseI MnlI \\ \ \\ \ \ \ \ ATCCAACATGACCTAAATTTACAAATACTAAATCTGGAAAATAAGTTAATAGAGAGCGAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTTGTACTGGATTTAAATGTTTATGATTTAGACCTTTTATTCAATTATCTCTCGCTC / // / / / / / | |FatI TspEI MmeI Hpy178III* | MnlI | |SetI ApoI MseI | CviAII NlaIII I Q H D L N L Q I L N L E N K L I E S E S N M T * I Y K Y * I W K I S * * R A R P T * P K F T N T K S G K * V N R E R G ----:----|----:----|----:----|----:----|----:----|----:----| I W C S R F K C I S F R S F L N I S L S Y G V H G L N V F V L D P F Y T L L S R D L M V * I * L Y * I Q F I L * Y L A L TspEI | BseGI | |MseI | || MaeIII | || Tsp45I | || | FokI | || | | DdeI | || | | |TspDTI | || | | || TfiI Ksp632I* | || | | || HinfI TspEI | BsrI \ \\ \ \ \\ \ \ \ \ GATGAATTAAAGTCACTAAGAGATTCTCAAAAAATTGAAATAGAAAACTGGAAGAGAAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTAATTTCAGTGATTCTCTAAGAGTTTTTTAACTTTATCTTTTGACCTTCTCTTTC / // /// / / / // | |MseI ||| DdeI HinfI TspEI |BsrI | TspEI ||FokI TfiI Ksp632I* BseGI |Tsp45I |MaeIII TspDTI D E L K S L R D S Q K I E I E N W K R K M N * S H * E I L K K L K * K T G R E S * I K V T K R F S K N * N R K L E E K V ----:----|----:----|----:----|----:----|----:----|----:----| S S N F D S L S E * F I S I S F Q F L F P H I L T V L L N E F F Q F L F S S S F I F * L * * S I R L F N F Y F V P L S L TfiI BsrI HindII HinfI MboII TspRI Hpy166II | AciI Hpy188I \ \ \ \ \ \ TATAACAATCTTTCACTGGAAAATGACAGATTGTTGACAGAAAAAGAATCCGCATCAGAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTGTTAGAAAGTGACCTTTTACTGTCTAACAACTGTCTTTTTCTTAGGCGTAGTCTG / / / / / / / MboII TspRI BsrI Hpy166II | | Hpy188I HindII | AciI HinfI TfiI Y N N L S L E N D R L L T E K E S A S D I T I F H W K M T D C * Q K K N P H Q T * Q S F T G K * Q I V D R K R I R I R Q ----:----|----:----|----:----|----:----|----:----|----:----| Y L L R E S S F S L N N V S F S D A D S T Y C D K V P F H C I T S L F L I R M L I V I K * Q F I V S Q Q C F F F G C * V SfaNI | Hin6I | |GlaI | ||HhaI | ||FnuDII* | ||| EcoRV | ||| | BsaBI | ||| | | Hpy178III* | ||| | | | BccI TspDTI \ \\\ \ \ \ \ \ AAAGAGCGCGAGATATCCATCTTGAACAGAAAACTTGATGAAATGGATAAAGAAAAATGG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCGCGCTCTATAGGTAGAACTTGTCTTTTGAACTACTTTACCTATTTCTTTTTACC //// / / / / / |||| | BsaBI | BccI TspDTI |||| EcoRV Hpy178III* |||FnuDII* |||Hin6I ||GlaI |HhaI SfaNI K E R E I S I L N R K L D E M D K E K W K S A R Y P S * T E N L M K W I K K N G R A R D I H L E Q K T * * N G * R K M E ----:----|----:----|----:----|----:----|----:----|----:----| L S R S I D M K F L F S S S I S L S F H C L A R S I W R S C F V Q H F P Y L F I F L A L Y G D Q V S F K I F H I F F F P FnuDII* TfiI | Hin4II* HphI HinfI | |SfeI* SetI | MboI \ \ \\ \ \ \ AACTTACAGGAATCTAAAGAAAAATATAAACGCGAACTACAGAAGGTGATTACTGCTAAT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAATGTCCTTAGATTTCTTTTTATATTTGCGCTTGATGTCTTCCACTAATGACGATTA / / / / / / HinfI | | | SetI HphI TfiI | | SfeI* | Hin4II* FnuDII* N L Q E S K E K Y K R E L Q K V I T A N T Y R N L K K N I N A N Y R R * L L L M L T G I * R K I * T R T T E G D Y C * * ----:----|----:----|----:----|----:----|----:----|----:----| F K C S D L S F Y L R S S C F T I V A L S S V P I * L F I Y V R V V S P S * Q * V * L F R F F F I F A F * L L H N S S I DpnI FatI |BstKTI TspDTI |CviAII || Ksp632I* MnlI MboII BseRI |SspI || NlaIII \\ \ \ \ \ \\ \\ \ GATCGTTTGAGAAGAGAGAAAGAGGAGTTGAATGAAAACAGCAATAATATTCGTATCATG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCAAACTCTTCTCTCTTTCTCCTCAACTTACTTTTGTCGTTATTATAAGCATAGTAC // / / / / / / / / // || MboI | MnlI MboII BseRI | SspI | |FatI |DpnI Ksp632I* TspDTI | CviAII BstKTI NlaIII D R L R R E K E E L N E N S N N I R I M I V * E E R K R S * M K T A I I F V S W S F E K R E R G V E * K Q Q * Y S Y H G ----:----|----:----|----:----|----:----|----:----|----:----| S R K L L S F S S N F S F L L L I R I M H D N S F L S L P T S H F C C Y Y E Y * I T Q S S L F L L Q I F V A I I N T D H BbvII* BdaI | MboII BdaI BdaI | |MaeI | TspEI MnlI BdaI \ \\ \ \ \ \ GAAGACAAGATGACTAGGATAAAAAAAAATTATTTGAGTGAAATCACTTCTTTACAAGAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGTTCTACTGATCCTATTTTTTTTTAATAAACTCACTTTAGTGAAGAAATGTTCTC / / / / / / | MaeI BdaI TspEI MnlI BdaI BbvII* BdaI BdaI MboII E D K M T R I K K N Y L S E I T S L Q E K T R * L G * K K I I * V K S L L Y K R R Q D D * D K K K L F E * N H F F T R G ----:----|----:----|----:----|----:----|----:----|----:----| S S L I V L I F F F * K L S I V E K C S P L C S S * S L F F N N S H F * K K V L F V L H S P Y F F I I Q T F D S R * L L MboII | MseI | |MnlI TfiI BsmAI | || MnlI HinfI \ \ \\ \ \ GAAAATAGGAGACTTGAAGAACGCCTCATATTAAATGAGAGGCGTAAAGACAATGATTCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTATCCTCTGAACTTCTTGCGGAGTATAATTTACTCTCCGCATTTCTGTTACTAAGT / / / / / BsmAI | | MnlI HinfI | | MseI TfiI | MnlI MboII E N R R L E E R L I L N E R R K D N D S K I G D L K N A S Y * M R G V K T M I Q K * E T * R T P H I K * E A * R Q * F N ----:----|----:----|----:----|----:----|----:----|----:----| S F L L S S S R R M N F S L R L S L S E P F Y S V Q L V G * I L H S A Y L C H N F I P S K F F A E Y * I L P T F V I I * AluI CviJI CviRI* | SetI |TspEI | | PsiI DdeI || MseI | | | TspEI | Hpy188I \\ \ \ \ \ \ \ \ ACTATGCAATTAAATGACATCATAAGCTATTATAAATTGAAGTATCACTCAGAAGTAAGA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TGATACGTTAATTTACTGTAGTATTCGATAATATTTAACTTCATAGTGAGTCTTCATTCT / // / / / / // // | |MseI | CviJI PsiI TspEI |DdeI |BseMII | TspEI | AluI Hpy188I BspCNI CviRI* SetI T M Q L N D I I S Y Y K L K Y H S E V R L C N * M T S * A I I N * S I T Q K * D Y A I K * H H K L L * I E V S L R S K T ----:----|----:----|----:----|----:----|----:----|----:----| V I C N F S M M L * * L N F Y * E S T L L * A I L H C * L S N Y I S T D S L L L S H L * I V D Y A I I F Q L I V * F Y S AsuI* AvaII MboI DraII | DpnI MboI PpuMI | |BstKTI BclI SanDI | ||SmlI SetI HphI |NlaIV BspCNI | ||AflII | DpnI | MseI |BmgT120I |BseMII | |||MseI | |BstKTI | |AhaIII* SetI ||NlaIV \\ \ \\\\ \ \\ \ \\ \ \\\ CACAACAACGATCTTAAGGTGATCAATGATTATTTAAACAAGGTTCTTGCTTTGGGGACC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTGTTGCTAGAATTCCACTAGTTACTAATAAATTTGTTCCAAGAACGAAACCCCTGG // / // // / / // / //// || | || || BclI HphI || SetI |||Hpy99I || | || || MboI |MseI ||SanDI || | || |DpnI AhaIII* ||PpuMI || | || BstKTI ||DraII || | |AflII ||AvaII || | |SmlI ||AsuI* || | MseI |BmgT120I || | SetI |NlaIV || MboI NlaIV |DpnI BstKTI H N N D L K V I N D Y L N K V L A L G T T T T I L R * S M I I * T R F L L W G P Q Q R S * G D Q * L F K Q G S C F G D P ----:----|----:----|----:----|----:----|----:----|----:----| C L L S R L T I L S * K F L T R A K P V V C C R D * P S * H N N L C P E Q K P S V V V I K L H D I I I * V L N K S Q P G SduI Hpy99I HgiAI* | MseI | Tsp4CI* | | BslFI SetI | | HphI Hpy178III* \ \ \ \ \ \ \ \ CGTCGTTTAAGATTGGACACAAGGAAAGGTGAGCACAGTCTAAACATTTCACTTCCAGAC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGCAAATTCTAACCTGTGTTCCTTTCCACTCGTGTCAGATTTGTAAAGTGAAGGTCTG / / / / / / / | BslFI SetI | | HphI Hpy178III* MseI | Tsp4CI* HgiAI* SduI R R L R L D T R K G E H S L N I S L P D V V * D W T Q G K V S T V * T F H F Q T S F K I G H K E R * A Q S K H F T S R R ----:----|----:----|----:----|----:----|----:----|----:----| R R K L N S V L F P S C L R F M E S G S G D N L I P C L S L H A C D L C K V E L T T * S Q V C P F T L V T * V N * K W V TsoI | SetI MaeI | | FatI | MboI | | BspHI | | DpnI CviJI | | |CviAII | | |BstKTI |FatI | | |Hpy178III* | | ||Hpy178III* ||CviAII | | || NlaIII | | ||| TspDTI ||| NlaIII | | || |MslI \ \ \\\ \ \\\ \ \ \ \\ \\ GATGATGAACTAGATCGTGATTACTACAATAGCCATGTTTATACAAGGTATCATGACTAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACTTGATCTAGCACTAATGATGTTATCGGTACAAATATGTTCCATAGTACTGATA /// / / // // // / /// ||| | Hpy178III* || |FatI |SetI | ||MslI ||| | TspDTI || CviAII TsoI | |BspHI ||| MboI |NlaIII | |FatI ||DpnI CviJI | Hpy178III* |BstKTI | CviAII MaeI NlaIII D D E L D R D Y Y N S H V Y T R Y H D Y M M N * I V I T T I A M F I Q G I M T M * * T R S * L L Q * P C L Y K V S * L * ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S R S * * L L W T * V L Y * S * R H H V L D H N S C Y G H K Y L T D H S I I F * I T I V V I A M N I C P I M V I AciI | DdeI AciI | | TfiI AsuI* BisI | | FauI AvaII |BlsI | | HinfI DraII ||TauI | | TspDTI PpuMI |||SmlI | | | TspEI |BmgT120I |||AflII | | | | BslFI ||SetI ||||MseI | | | | | MseI ||NlaIV |||||MwoI | | | | | |AhaIII* ||| MboII ||||||HindIII | | | | | ||Ksp632I* ||| | TaqI ||||||| AluI | | | | | |||MnlI ||| | AsuII ||||||| CviJI \ \ \ \ \ \\\\ \\\ \ \ \\\\\\\ \ GAATACCCGCTTAGATTCAATTTAAACAGAAGAGGTCCCTATTTCGAACGCCGCTTAAGC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGGGCGAATCTAAGTTAAATTTGTCTTCTCCAGGGATAAAGCTTGCGGCGAATTCG / // // /// / / // / / //// /// | || || ||| | | || MboII | |||| ||CviJI | || || ||| | | |PpuMI | |||| ||AluI | || || ||| | | |DraII | |||| |AflII | || || ||| | | |AvaII | |||| |SmlI | || || ||| | | |AsuI* | |||| MseI | || || ||| | | BmgT120I | |||| SetI | || || ||| | | NlaIV | |||MwoI | || || ||| | SetI | |||AciI | || || ||| Ksp632I* | ||BisI | || || ||BslFI | |BlsI | || || ||MseI | TauI | || || ||MnlI AsuII | || || |AhaIII* TaqI | || || TspEI | || |HinfI | || |TfiI | || FauI | |DdeI | TspDTI AciI E Y P L R F N L N R R G P Y F E R R L S N T R L D S I * T E E V P I S N A A * A I P A * I Q F K Q K R S L F R T P L K L ----:----|----:----|----:----|----:----|----:----|----:----| S Y G S L N L K F L L P G * K S R R K L H I G A * I * N L C F L D R N R V G S L F V R K S E I * V S S T G I E F A A * A Cac8I FalI FokI SetI Tsp4CI* | MnlI FalI BseGI | TspDTI \ \ \ \ \ \ \ \ TTCAAAACAGTTGCCCTTTTAGTGCTTGCTTGTGTGAGGATGAAAAGGATTGCTTTTTAC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTTGTCAACGGGAAAATCACGAACGAACACACTCCTACTTTTCCTAACGAAAAATG / / / / / / / / | Tsp4CI* | | FalI BseGI | FokI HindIII | | FalI TspDTI | MnlI Cac8I F K T V A L L V L A C V R M K R I A F Y S K Q L P F * C L L V * G * K G L L F T Q N S C P F S A C L C E D E K D C F L Q ----:----|----:----|----:----|----:----|----:----|----:----| K L V T A R K T S A Q T L I F L I A K * S * F L Q G K L A Q K H S S S F S Q K K E F C N G K * H K S T H P H F P N S K V FauI MboI | TseI | DpnI | |BisI | |BstKTI | ||BlsI | ||FalI | |||AciI | ||FalI | |||NspBII* | |||Hpy188I DdeI TspEI | |||| Cac8I \ \\\\ \ \ \ \\\\ \ AGGAGATCAGACGATAACAGATTGCGAATACTAAGAGATAGAATTGAGAGTAGCAGCGGG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTAGTCTGCTATTGTCTAACGCTTATGATTCTCTATCTTAACTCTCATCGTCGCCC / // / / / / /// / | || Hpy188I DdeI TspEI | ||| Cac8I | || MboI | ||| AciI | |DpnI | ||NspBII* | BstKTI | ||TseI FalI | |BisI FalI | BlsI FauI R R S D D N R L R I L R D R I E S S S G G D Q T I T D C E Y * E I E L R V A A G E I R R * Q I A N T K R * N * E * Q R A ----:----|----:----|----:----|----:----|----:----|----:----| L L D S S L L N R I S L S L I S L L L P C S I L R Y C I A F V L L Y F Q S Y C R P S * V I V S Q S Y * S I S N L T A A P BbvI Hin4I \ \ CGTATATCTTGGTAG 2830 ----:----|----: GCATATAGAACCATC / / | BbvI Hin4I R I S W * V Y L G X Y I L V X ----:----|----: R I D Q Y A Y I K T T Y R P L # Enzymes that cut Frequency Isoschizomers AciI 6 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 4 DraI AluI 14 AluBI ApoI 14 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BglII 1 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 BplI 4 Bpu10I 1 BsaBI 2 Bse8I,BseJI BseGI 5 BstF5I,BtsCI BseMII 6 BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 6 BspHI 1 CciI,PagI,RcaI BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BstKTI 10 Cac8I 2 BstC8I Csp6I 4 CviQI,RsaNI CviAII 6 CviJI 24 CviKI-1 CviRI* 5 HpyCH4V DdeI 13 BstDEI,HpyF3I DpnI 10 MalI DraII 3 EcoO109I Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 1 EcoRI 2 EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 6 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 3 HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 3 HpyAV Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 14 HphI 5 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 10 Hpy99I 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 25 MfeI 3 MunI MlyI 3 SchI MmeI 3 MnlI 14 MseI 26 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I PleI 3 PpsI PpuMI 2 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI RsaI 4 AfaI SacI 1 Psp124BI,SstI SanDI 1 SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI SduI 3 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 30 SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 3 TatI 2 TauI 2 TfiI 11 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 23 TspEI 44 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI VspI 2 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BetI* BglI BinI* BmeT110I BmtI BsaAI BsaXI BseBI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI DsaI* Eco31I EcoNI EcoP15I EcoRII EgeI EheI Esp3I FseI FspAI GsaI GsuI HgiCI* HpaI HpaII KasI KpnI MauBI McrI* MluI MroNI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NotI NruI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SauI* ScrFI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaqII TspMI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769