Restriction Map of YDR316W-B

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

YDR316W-B on chromosome IV from coordinates 1096064 to 1101332.


FatI |CviAII || NlaIII || | Hin6I || | |GlaI TfiI || | ||HhaI HinfI TspEI TspEI || | |||HaeII MaeIII \ \ \ \\ \ \\\\ \ ATGGAATCCCAACAATTATCTAATTACCCACATATATCTCATGGTAGCGCCTGTGCTTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAGGGTTGTTAATAGATTAATGGGTGTATATAGAGTACCATCGCGGACACGAAGC / / / / // //// HinfI TspEI TspEI | || |||Hin6I TfiI | || ||GlaI | || |HhaI | || HaeII | |FatI | CviAII NlaIII M E S Q Q L S N Y P H I S H G S A C A S W N P N N Y L I T H I Y L M V A P V L R G I P T I I * L P T Y I S W * R L C F G ----:----|----:----|----:----|----:----|----:----|----:----| X S D W C N D L * G C I D * P L A Q A E X P I G V I I * N G V Y I E H Y R R H K H F G L L * R I V W M Y R M T A G T S R Hpy166II | TspGWI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeII AluI | | | | | DpnI | SetI CviJI ApoI DdeI | | | | | |BstKTI | TaiI | SetI TspEI \ \ \ \ \ \ \\ \ \ \ \ \ GTTACTTCTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTCAGCTTCCAAAATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGAAGATTCCTTCAGGTGTGTTTAGTTCTAGGCAATCTGCAAAGTCGAAGGTTTTAA / / / / / /// / / / / / / | DdeI | | | ||| XhoII | | | CviJI TspEI MaeIII | | | ||| MboI | | | AluI ApoI | | | ||DpnI | | SetI | | | |BstKTI | MaeII | | | | TaiI | | | | SetI | | | Hpy178III* | | BinI* | TspGWI Hpy166II V T S K E V H T N Q D P L D V S A S K I L L L R K S T Q I K I R * T F Q L P K F Y F * G S P H K S R S V R R F S F Q N S ----:----|----:----|----:----|----:----|----:----|----:----| T V E L S T W V F * S G N S T E A E L I P * K * P L G C L D L D T L R K L K W F N S R L F D V C I L I R * V N * S G F N AarI Hpy178III* CviJI DdeI CviJI TspDTI SetI BspMI \ \ \ \ \ \ \ CAAGAATATGATAAGGCTTCCACTAAGGCTAACTCTCAACAGACAACAACACCTGCTTCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTATACTATTCCGAAGGTGATTCCGATTGAGAGTTGTCTGTTGTTGTGGACGAAGT / / / / / / / Hpy178III* CviJI | CviJI | SetI MwoI DdeI TspDTI Q E Y D K A S T K A N S Q Q T T T P A S K N M I R L P L R L T L N R Q Q H L L H R I * * G F H * G * L S T D N N T C F I ----:----|----:----|----:----|----:----|----:----|----:----| * S Y S L A E V L A L E * C V V V G A E E L I H Y P K W * P * S E V S L L V Q K L F I I L S G S L S V R L L C C C R S * MnlI MwoI BseRI | SetI | AluI |FatI | | MnlI | CviJI ||CviAII | | | BspMI | PvuII ||| NlaIII | | | |Csp6I | NspBII* ||| |BccI | | | ||RsaI | | SetI ||| |Eco57I | | | ||| BceAI | | | Hpy178III* ||| |Eco57MI | | | ||| | SetI \ \ \ \ \\\ \\ \ \ \ \\\ \ \ TCAGCTGTTCCAGAGAACCCCCATCATGCCTCTCCTCAACCTGCTTCAGTACCACCTCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGACAAGGTCTCTTGGGGGTAGTACGGAGAGGAGTTGGACGAAGTCATGGTGGAGGT / / / / / // / / / //// / | NspBII* | | | || BccI MnlI MnlI |||| BceAI | BspMI | | | |FatI SetI |||SetI | PvuII | | | Eco57MI ||BspMI | CviJI | | | CviAII |Csp6I | AarI | | | Eco57I RsaI | AluI | | NlaIII SetI | BseRI Hpy178III* S A V P E N P H H A S P Q P A S V P P P Q L F Q R T P I M P L L N L L Q Y H L H S C S R E P P S C L S S T C F S T T S T ----:----|----:----|----:----|----:----|----:----|----:----| D A T G S F G W * A E G * G A E T G G G M L Q E L S G G D H R E E V Q K L V V E * S N W L V G M M G R R L R S * Y W R W PflMI BsiYI* |MnlI || AsuI* FatI || |BmgT120I CviRI* || ||CviJI |CviAII || ||HaeIII ||BtsI || ||| Csp6I OliI ||TspRI CviJI BstXI || ||| |RsaI MslI ||| NlaIII | EcoP15I |BccI \\ \\\ \\ \ \\\ \ \ \ \\ CAGAATGGGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGCCAATCCATCTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTACCCGGCATGGGTGTCGTCACGTACTACTGGGTTTTGGTTCGGTTAGGTAGACCA / / // // / / / // / / / | MnlI || || | MslI | |FatI | | BstXI BsiYI* || || | OliI | CviAII | EcoP15I PflMI || || TspRI CviRI* CviJI || |Csp6I NlaIII || RsaI BtsI |AsuI* BmgT120I HaeIII CviJI Q N G P Y P Q Q C M M T Q N Q A N P S G R M G R T H S S A * * P K T K P I H L V E W A V P T A V H D D P K P S Q S I W L ----:----|----:----|----:----|----:----|----:----|----:----| C F P G Y G C C H M I V W F W A L G D P V S H A T G V A T C S S G F G L W D M Q L I P R V W L L A H H G L V L G I W R T TspGWI | TspGWI | |TfiI | |BccI | |HinfI | || TaqII | || | AccI | || | |BssNAI | || | |Hpy166II TatI | || | || SetI |Csp6I \ \\ \ \\ \ \\ TGGTCATTTTACGGACACCCATCTATGATTCCGTATACACCTTATCAAATGTCGCCTATG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGTAAAATGCCTGTGGGTAGATACTAAGGCATATGTGGAATAGTTTACAGCGGATAC / / / / / // / BccI | | | | || SetI | | | | |AccI | | | | Hpy166II | | | | BssNAI | | | TaqII | | | HinfI | | | TfiI | | BccI | TspGWI TspGWI W S F Y G H P S M I P Y T P Y Q M S P M G H F T D T H L * F R I H L I K C R L C V I L R T P I Y D S V Y T L S N V A Y V ----:----|----:----|----:----|----:----|----:----|----:----| Q D N * P C G D I I G Y V G * * I D G I N T M K R V G M * S E T Y V K D F T A * P * K V S V W R H N R I C R I L H R R H BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI ||||AsuI* BciVI |||||BmgT120I Tsp4CI* |BccI ||||||CviJI | MmeI || BseMII RsaI ||||||HaeIII | |AciI || |BspCNI \ \\\\\\\ \ \\ \\ \\ TACTTTCCACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATCAGTTGGAACGCCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAAAGGTGGACCCGGTGTTAGTGTCAAAGGCGTCATAGGTAGTAGTCAACCTTGCGGA /// / / /// / / / / /// ||TatI | | ||AsuI* | MmeI AciI | ||BspCNI |Csp6I | | |BmgT120I Tsp4CI* | |BseMII RsaI | | |HaeIII | BccI | | |CviJI BciVI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI SetI Y F P P G P Q S Q F P Q Y P S S V G T P T F H L G H N H S F R S I H H Q L E R L L S T W A T I T V S A V S I I S W N A S ----:----|----:----|----:----|----:----|----:----|----:----| Y K G G P G C D C N G C Y G D D T P V G T S E V Q A V I V T E A T D M M L Q F A V K W R P W L * L K R L I W * * N S R R TfiI HinfI | BseGI | | DdeI DdeI | | BbvCI |SetI | | Bpu10I |BccI | | |MlyI ||HinfI | | |PleI DdeI |||EcoNI | | || AciI |Hpy188I |||| BsiYI* | | || Hin4I || HphI |||| | SetI | | || Hin4I || | SduI |||| | PleI | | || NspBII* || | HgiAI* |||| | |MlyI | | || | FokI || | |MnlI |||| | || FokI | | || | |HinfI || | |BseMII |||| | || |Hin4I | | || | || MnlI || | ||BspCNI |||| | || ||TspDTI | | || | || | Hpy188I \\ \ \\\ \\\\ \ \\ \\\ \ \ \\ \ \\ \ \ CTGAGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATCCTCAGCGGACTCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCGTGAGGTAGTGGACTCAGTCCATTATGTAAATGACTAAGTAGGAGTCGCCTGAGA / // // / ///// / / / / / / / //// / / /// | || |BspCNI SetI ||||| | | | FokI | | | |||| | | ||BseMII | || |MnlI ||||| | | TspDTI | | | |||| | | |Hpy188I | || BseMII ||||| | PleI | | | |||| | | |BspCNI | |DdeI ||||| | MlyI | | | |||| | | Hin4I | |HphI ||||| Hin4I | | | |||| | | HinfI | HgiAI* ||||SetI | | | |||| | | FokI | SduI |||HinfI | | | |||| | MnlI Hpy188I ||EcoNI | | | |||| AciI |DdeI | | | |||NspBII* BsiYI* | | | ||Bpu10I BccI | | | ||BbvCI | | | ||DdeI | | | |PleI | | | MlyI | | Hin4I | | Hin4I | HinfI | TfiI BseGI L S T P S P E S G N T F T D S S S A D S * A L H H L S Q V I H L L I H P Q R T L E H S I T * V R * Y I Y * F I L S G L * ----:----|----:----|----:----|----:----|----:----|----:----| R L V G D G S D P L V N V S E D E A S E E S C E M V Q T L Y Y M * Q N M R L P S Q A S W * R L * T I C K S I * G * R V R HphI | MseI BspCNI | |HpaI |BseMII Hin4I | |HindII ||Hin4I Hin4I | |Hpy166II SetI ||| BseGI | Hpy188I | || SetI | MnlI \\\ \ \ \ \ \\ \ \ \ GATATGACATCCACTAAAAAATATGTCAGACCACCACCAATGTTAACCTCACCTAATGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTATACTGTAGGTGATTTTTTATACAGTCTGGTGGTGGTTACAATTGGAGTGGATTACTG / / / / // / / BseGI Hin4I Hpy188I | |MseI SetI MnlI Hin4I | |SetI | Hpy166II | HindII | HpaI HphI D M T S T K K Y V R P P P M L T S P N D I * H P L K N M S D H H Q C * P H L M T Y D I H * K I C Q T T T N V N L T * * L ----:----|----:----|----:----|----:----|----:----|----:----| S I V D V L F Y T L G G G I N V E G L S Q Y S M W * F I H * V V V L T L R V * H I H C G S F F I D S W W W H * G * R I V TaqI ApoI | TfiI TspEI MseI TspEI | HinfI \ \ \ \ \ TTTCCAAATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAATCTCGGTGGTATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTTTAACCCAATTTTGTATGTAGTTTAAAAATGTTTTGAGCTTAGAGCCACCATAA / / / / / TspEI MseI TspEI | HinfI ApoI | TfiI TaqI F P N W V K T Y I K F L Q N S N L G G I F Q I G L K H T S N F Y K T R I S V V L S K L G * N I H Q I F T K L E S R W Y Y ----:----|----:----|----:----|----:----|----:----|----:----| K G F Q T L V Y M L N K C F E F R P P I S E L N P * F M C * I K V F S S D R H Y K W I P N F C V D F K * L V R I E T T N SplI* |Csp6I ||RsaI |||MaeII ||||MmeI |||||TspGWI ||||||SetI ||||||TaiI ||||||| MboI Hpy188I ||||||| Hpy188I | Tsp4CI* ||||||| | DpnI HphI SetI | | Hpy166II ||||||| | |BstKTI TspRI | TspDTI \ \ \ \\\\\\\ \ \\ \ \ \ ATTCCGACAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGAACTCACCTTCTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGCTGTCATTTGCCTTTTGGGCATGCAGTCTAGTGACTACTACTTGAGTGGAAGAAC / / / //// / // / / / / | | Hpy166II |||| | || MboI HphI SetI TspDTI | Tsp4CI* |||| | |DpnI Hpy188I |||| | BstKTI |||| | TspRI |||| Hpy188I |||MaeII ||SplI* |TspGWI |Csp6I MmeI RsaI TaiI SetI I P T V N G K P V R Q I T D D E L T F L F R Q * T E N P Y V R S L M M N S P S C S D S K R K T R T S D H * * * T H L L V ----:----|----:----|----:----|----:----|----:----|----:----| I G V T F P F G T R * I V S S S S V K K * E S L L R F V R V D S * Q H H V * R R N R C Y V S F G Y T L D S I I F E G E Q SetI |FokI |BssKI |EcoRII ||SecI* |||ScrFI |||BseBI ||||SetI TspEI ||||Hin4I TspGWI Hin4II* SspI | MnlI ||||Hin4I | BseGI \ \ \ \ \\\\\ \ \ TATAACACTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTGGGTCAAAGACATC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTGTGAAAAGTTTATAAACGAGGGAGAGTTAAGGATGGATGGACCCAGTTTCTGTAG / / / / // /// / / Hin4II* SspI | | || ||| | BseGI | | || ||| TspGWI | | || ||EcoRII | | || ||BssKI | | || ||SecI* | | || |FokI | | || BseBI | | || ScrFI | | |SetI | | Hin4I | | Hin4I | SetI TspEI MnlI Y N T F Q I F A P S Q F L P T W V K D I I T L F K Y L L P L N S Y L P G S K T S * H F S N I C S L S I P T Y L G Q R H P ----:----|----:----|----:----|----:----|----:----|----:----| Y L V K * I N A G E * N R G V Q T L S M T Y C K E F I Q E R E I G V * R P * L C I V S K L Y K S G R L E * R G P D F V D Hin4I Hin4I | EcoRV | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || NlaIII | | || | ApoI | | || | TspEI | | || | | TspGWI TspDTI CviRI* \ \ \\ \ \ \ \ \ CTATCCGTTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTATTGAAAAAATGCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGGCAACTAATATGCCTATAGTACTTTTAAGAAAGGTTTTCATAACTTTTTTACGTT / / / // / / / / Hin4I | | || | | TspDTI CviRI* Hin4I | | || | TspEI | | || | ApoI | | || TspGWI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII EcoRV L S V D Y T D I M K I L S K S I E K M Q Y P L I I R I S * K F F P K V L K K C N I R * L Y G Y H E N S F Q K Y * K N A I ----:----|----:----|----:----|----:----|----:----|----:----| R D T S * V S I M F I R E L L I S F I C G I R Q N Y P Y * S F E K W F Y Q F F A * G N I I R I D H F N K G F T N F F H L MaeIII Tsp45I | BssKI | SecI* | EcoRII | | ScrFI TatI | | BseBI |Csp6I Hpy188I | | | ApoI ||RsaI | MnlI | | | TspEI CviRI* ||SfaNI \ \ \ \ \ \ \ \\\ TCTGATACCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCAATATAATGGCAGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTATGGGTTCTCCGTTTGCTGTAACACTGGGACCGTTTAAACGTTATATTACCGTCA / / / /// / / / | MnlI | ||| | CviRI* RsaI Hpy188I | ||| TspEI | ||| ApoI | ||EcoRII | ||BssKI | |SecI* | BseBI | ScrFI Tsp45I MaeIII S D T Q E A N D I V T L A N L Q Y N G S L I P K R Q T T L * P W Q I C N I M A V * Y P R G K R H C D P G K F A I * W Q Y ----:----|----:----|----:----|----:----|----:----|----:----| D S V W S A F S M T V R A F K C Y L P L I Q Y G L P L R C Q S G P L N A I Y H C R I G L L C V V N H G Q C I Q L I I A T Hpy166II | SfeI* | |SetI | ||CviRI* | ||| PstI | ||| | AarI | ||| | BspMI | ||| | |CviRI* MaeIII | ||| | || EcoT22I Tsp45I TaqI TspDTI \ \\\ \ \\ \ \ \ \ ACACCTGCAGATGCATTTGAAACAAAAGTCACAAACATTATCGACAGACTGAACAATAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGACGTCTACGTAAACTTTGTTTTCAGTGTTTGTAATAGCTGTCTGACTTGTTATTA // // / / / / / / / / / || || | | | | BspMI Tsp45I TaqI TspDTI BsmI || || | | | | AarI MaeIII || || | | | CviRI* || || | | EcoT22I || || | SfeI* || || CviRI* || |PstI || SfaNI |TatI |SetI Hpy166II Csp6I T P A D A F E T K V T N I I D R L N N N H L Q M H L K Q K S Q T L S T D * T I M T C R C I * N K S H K H Y R Q T E Q * W ----:----|----:----|----:----|----:----|----:----|----:----| V G A S A N S V F T V F M I S L S F L L Y V Q L H M Q F L L * L C * R C V S C Y C R C I C K F C F D C V N D V S Q V I I SetI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| NlaIII | ||| | TspEI | ||| | | MseI | ||| | | VspI | ||| | | |TspEI BsmI | ||| | | || MnlI SetI \ \ \\\ \ \ \\ \ \ GGCATTCATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGGTCTATCTGGCGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTAAGTATAGTTATTGTTCCAGCGTACGGTTAATTAATACTCTCCAGATAGACCGCTT / / /// // / / SetI | ||FatI || | SetI | |CviAII || TspEI | Cac8I |VspI NlaIII |MseI NspI |MnlI SphI TspEI G I H I N N K V A C Q L I M R G L S G E A F I S I T R S H A N * L * E V Y L A N H S Y Q * Q G R M P I N Y E R S I W R I ----:----|----:----|----:----|----:----|----:----|----:----| P M * I L L L T A H W N I I L P R D P S H C E Y * Y C P R M G I L * S L D I Q R A N M D I V L D C A L * N H S T * R A F AflIII | MaeII | |BtrI | || SetI ApoI | || TaiI Tsp4CI* Tsp4CI* TspEI | || | TaqI | AlwNI | DdeI \ \ \\ \ \ \ \ \ \ TATAAATTTTTACGCTACACACGTCATCGACATCTAAATATGACAGTCGCTGAACTGTTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTAAAAATGCGATGTGTGCAGTAGCTGTAGATTTATACTGTCAGCGACTTGACAAG / / // / / / / TspEI | || TaqI | AlwNI Tsp4CI* ApoI | |AflIII Tsp4CI* | |MaeII | BtrI TaiI SetI Y K F L R Y T R H R H L N M T V A E L F I N F Y A T H V I D I * I * Q S L N C S * I F T L H T S S T S K Y D S R * T V L ----:----|----:----|----:----|----:----|----:----|----:----| Y L N K R * V R * R C R F I V T A S S N I Y I K V S C V D D V D L Y S L R Q V T I F K * A V C T M S M * I H C D S F Q E MboI MboII |TspDTI ||DpnI EcoRV |||TaqI | FatI |||BstKTI | |CviAII ||||Hpy178III* SetI | || NlaIII ||||| BinI* TspEI \ \\ \ \\\\\ \ \ TTAGATATCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAGCAAACCTAATTAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTATAGGTACGATAAATACTTCTTGTTGTCCCTAGCTCTTTGTCGTTTGGATTAATG / / / // / // /// / / / | | | |FatI | || ||| BinI* SetI TspEI | | | CviAII | || ||Hpy178III* | | NlaIII | || |TaqI | EcoRV | || MboI DdeI | |DpnI | BstKTI TspDTI MboII L D I H A I Y E E Q Q G S R N S K P N Y * I S M L F M K N N R D R E T A N L I T R Y P C Y L * R T T G I E K Q Q T * L Q ----:----|----:----|----:----|----:----|----:----|----:----| K S I W A I * S S C C P D L F L L G L * R L Y G H * K H L V V P I S F C C V * N * I D M S N I F F L L S R S V A F R I V TfiI HinfI | MboII | | TseI | | |BisI | | ||BlsI | | |||AluI | | |||CviJI Hpy188I | | |||| SetI BbvI \ \ \ \\\\ \ \ AGGAGAAATCCGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAATACAACCAAACCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTTTAGGCTCACTACTCTTCTTACTAAGAGCGTCGATATGCTTATGTTGGTTTGGG / // /// / Hpy188I || ||CviJI BbvI || ||TseI || ||AluI || |BisI || BlsI || SetI |MboII HinfI TfiI R R N P S D E K N D S R S Y T N T T K P G E I R V M R R M I L A A I R I Q P N P E K S E * * E E * F S Q L Y E Y N Q T Q ----:----|----:----|----:----|----:----|----:----|----:----| L L F G L S S F F S E R L * V F V V L G C S F D S H H S S H N E C S Y S Y L W V P S I R T I L L I I R A A I R I C G F G TstI BssKI CviJI EcoRII AluI |SecI* CviJI ||ScrFI | SetI MnlI ||BseBI | | Hpy188I | TspEI ||| CviJI | | |TfiI | | TaqI ||| | SduI | | |HinfI | | AsuII TaqI ||| | HgiJII* \ \ \\ \ \ \ \ \\\ \ \ AAAGTTATAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAAAACAGCCAGGGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAATATCGAGCCTTAGGAGTTTTTTGTTTATTAAGCTTTAGCTTTTGTCGGTCCCGA / / / / / / / / / / //// | | | HinfI MnlI | AsuII | TstI | |||CviJI | | | TfiI | TaqI TaqI | ||EcoRII | | Hpy188I TspEI | ||BssKI | CviJI | ||SecI* | AluI | |HgiJII* SetI | |SduI | BseBI | ScrFI CviJI K V I A R N P Q K T N N S K S K T A R A K L * L G I L K K Q I I R N R K Q P G L S Y S S E S S K N K * F E I E N S Q G S ----:----|----:----|----:----|----:----|----:----|----:----| L T I A R F G * F V F L E F D F V A L A W L * L E S D E F F L Y N S I S F L W P F N Y S P I R L F C I I R F R F C G P S TspGWI TstI | BdaI | BseYI TfiI | BdaI BciVI | | GsaI HinfI | BccI \ \ \ \ \ \ \ CACAATGTATCCACATCTAATAACTCTCCCAGCACGGACAACGATTCCATCAGTAAATCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTACATAGGTGTAGATTATTGAGAGGGTCGTGCCTGTTGCTAAGGTAGTCATTTAGT / / / / // / / | TstI | BseYI || | BccI BciVI GsaI || BdaI || BdaI |TspGWI HinfI TfiI H N V S T S N N S P S T D N D S I S K S T M Y P H L I T L P A R T T I P S V N Q Q C I H I * * L S Q H G Q R F H Q * I N ----:----|----:----|----:----|----:----|----:----|----:----| * L T D V D L L E G L V S L S E M L L D E C H I W M * Y S E W C P C R N W * Y I V I Y G C R I V R G A R V V I G D T F * XmnI |TfiI DdeI |HinfI TspDTI | Hin4II* || MfeI |BdaI | | CviJI || TspEI |BdaI SetI | | HaeIII \\ \ \\ \ \ \ \ ACTACTGAACCGATTCAATTGAACAATAAGCACGACCTTCATCTTAGGCCAGAAACTTAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGACTTGGCTAAGTTAACTTGTTATTCGTGCTGGAAGTAGAATCCGGTCTTTGAATG / / / // / // / | | TspEI |BdaI SetI || HaeIII | | MfeI |BdaI || CviJI | HinfI TspDTI |DdeI | TfiI Hin4II* XmnI T T E P I Q L N N K H D L H L R P E T Y L L N R F N * T I S T T F I L G Q K L T Y * T D S I E Q * A R P S S * A R N L L ----:----|----:----|----:----|----:----|----:----|----:----| V V S G I * N F L L C S R * R L G S V * L * Q V S E I S C Y A R G E D * A L F K S S F R N L Q V I L V V K M K P W F S V BssKI TfiI SecI* HinfI EcoRII | SfeI* MslI | ScrFI TspDTI Hpy178III* | | Tsp4CI* |Hpy188I | BseBI | SetI |TaqI \ \ \ \\ \ \ \ \ \\ TGAATCTACAGTAAATCATACTAATCATTCTGATGATGAACTCCCTGGACACCTCCTTCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTAGATGTCATTTAGTATGATTAGTAAGACTACTACTTGAGGGACCTGTGGAGGAAGA / // / ///// | |SfeI* Hpy188I ||||SetI | Tsp4CI* MslI |||TspDTI HinfI ||EcoRII TfiI ||BssKI |SecI* BseBI ScrFI * I Y S K S Y * S F * * * T P W T P P S E S T V N H T N H S D D E L P G H L L L N L Q * I I L I I L M M N S L D T S F S ----:----|----:----|----:----|----:----|----:----|----:----| Q I * L L D Y * D N Q H H V G Q V G G E S F R C Y I M S I M R I I F E R S V E K S D V T F * V L * E S S S S G P C R R R TfiI MnlI PsiI HinfI | MboI | Hin4II* | BglII | |Hpy178III* | XhoII | || Hpy178III* | | DpnI | || | SfaNI | | |BstKTI DdeI \ \\ \ \ \ \ \\ \ CGATTCAGGAGCATCACGAACCCTTATAAGATCTGCTCATCACATACACTCAGCATCATC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GCTAAGTCCTCGTAGTGCTTGGGAATATTCTAGACGAGTAGTGTATGTGAGTCGTAGTAG // // / / / / // / / / || || | | | | || XhoII DdeI BspCNI || || | | | | || BglII || || | | | | || MboI || || | | | | |DpnI || || | | | | BstKTI || || | | | PsiI || || | | SfaNI || || | Hpy178III* || || Hpy178III* || |HinfI || |TfiI || Hin4II* |TaqI Hpy178III* MnlI R F R S I T N P Y K I C S S H T L S I I D S G A S R T L I R S A H H I H S A S S I Q E H H E P L * D L L I T Y T Q H H L ----:----|----:----|----:----|----:----|----:----|----:----| R N L L M V F G * L I Q E D C V S L M M E I * S C * S G K Y S R S M V Y V * C * S E P A D R V R I L D A * * M C E A D D SfaNI BspCNI |BseMII || Hpy178III* || | SfaNI || | | MaeII MaeIII || | | | SetI TspEI Tsp45I || | | | TaiI | MseI BstEII \\ \ \ \ \ \ \ \ TAATCCTGACATAAACGTAGTTGATGCTCAAAAAAGAAATATACCAATTAACGCTATTGG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATTAGGACTGTATTTGCATCAACTACGAGTTTTTTCTTTATATGGTTAATTGCGATAACC / // / / // | || | MaeII |MseI | || | SfaNI TspEI | || TaiI | || SetI | |Hpy178III* | SfaNI BseMII * S * H K R S * C S K K K Y T N * R Y W N P D I N V V D A Q K R N I P I N A I G I L T * T * L M L K K E I Y Q L T L L V ----:----|----:----|----:----|----:----|----:----|----:----| * D Q C L R L Q H E F F F Y V L * R * Q R I R V Y V Y N I S L F S I Y W N V S N L G S M F T T S A * F L F I G I L A I P PfoI BssKI SetI EcoRII | TspEI | ScrFI SetI | | HphI | BseBI | CviRI* \ \ \ \ \ \ \ TGACCTACAATTTCACTTCCAGGACAACACCAAAACATCAATAAAGGTATTGCACACTCC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ACTGGATGTTAAAGTGAAGGTCCTGTTGTGGTTTTGTAGTTATTTCCATAACGTGTGAGG / / / / / / / / | | | TspEI | EcoRII SetI CviRI* | | HphI | BssKI | BstEII | PfoI | Tsp45I BseBI | MaeIII ScrFI SetI * P T I S L P G Q H Q N I N K G I A H S D L Q F H F Q D N T K T S I K V L H T P T Y N F T S R T T P K H Q * R Y C T L L ----:----|----:----|----:----|----:----|----:----|----:----| H G V I E S G P C C W F M L L P I A C E T V * L K V E L V V G F C * Y L Y Q V S S R C N * K W S L V L V D I F T N C V G TspEI |BspCNI ||BseMII ||| TseI ||| CviJI ||| |BisI ||| |SfeI* FatI ||| ||BlsI |CviAII ||| |||CviRI* ||Cac8I ||| |||| PstI ||| SphI ||| |||| | TspDTI ||| NspI CviJI DdeI BbvI ||| |||| | | EcoRV ||| NlaIII \ \ \ \\\ \\\\ \ \ \ \\\ \ TAACATAGCCTATGACTTACTCAGTTTGAATGAATTGGCTGCAGTAGATATCACAGCATG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATTGTATCGGATACTGAATGAGTCAAACTTACTTAACCGACGTCATCTATAGTGTCGTAC / / / // / //// / / / /// CviJI DdeI | || | |||| | EcoRV | ||FatI | || | |||| TspDTI | |CviAII | || | |||| SfeI* | Cac8I | || | |||CviRI* NlaIII | || | |||TseI NspI | || | ||BisI SphI | || | |BlsI | || | |PstI | || | CviJI | || TspEI | |BseMII | BspCNI BbvI * H S L * L T Q F E * I G C S R Y H S M N I A Y D L L S L N E L A A V D I T A C T * P M T Y S V * M N W L Q * I S Q H A ----:----|----:----|----:----|----:----|----:----|----:----| * C L R H S V * N S H I P Q L L Y * L M R V Y G I V * E T Q I F Q S C Y I D C C L M A * S K S L K F S N A A T S I V A H TatI Tsp4CI* |Csp6I ||RsaI MaeII |||TspRI | SetI |||| CviRI* | TaiI Tsp4CI* |||| | BceAI | |DdeI | Hpy188I |||| | | SetI BsmAI \ \\ \ \ \\\\ \ \ \ \ CTTTACCAAAAACGTCTTAGAACGGTCTGACGGCACTGTACTTGCACCTATCGTAAAATA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GAAATGGTTTTTGCAGAATCTTGCCAGACTGCCGTGACATGAACGTGGATAGCATTTTAT / / / / / / / /// // / | | | | | | | ||| || BceAI | | | | | | | ||| |SetI | | | | | | | ||| CviRI* | | | | | | | ||TatI | | | | | | | |Csp6I | | | | | | | RsaI | | | | | | Tsp4CI* | | | | | TspRI | | | | Hpy188I | | | Tsp4CI* | | DdeI | MaeII TaiI SetI L Y Q K R L R T V * R H C T C T Y R K I F T K N V L E R S D G T V L A P I V K Y L P K T S * N G L T A L Y L H L S * N M ----:----|----:----|----:----|----:----|----:----|----:----| S * W F R R L V T Q R C Q V Q V * R L I A K G F V D * F P R V A S Y K C R D Y F K V L F T K S R D S P V T S A G I T F Y TatI |Csp6I ||RsaI TspGWI Csp6I BsrI BfiI ||ScaI | BccI |RsaI \ \ \\\ \ \ \\ TGGAGACTTTTACTGGGTATCTAAAAAGTACTTGCTTCCATCAAATATCTCCGTACCCAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTCTGAAAATGACCCATAGATTTTTCATGAACGAAGGTAGTTTATAGAGGCATGGGTG / / / /// / / // BsmAI BsrI BfiI ||TatI TspGWI BccI |Csp6I |Csp6I RsaI ScaI RsaI W R L L L G I * K V L A S I K Y L R T H G D F Y W V S K K Y L L P S N I S V P T E T F T G Y L K S T C F H Q I S P Y P P ----:----|----:----|----:----|----:----|----:----|----:----| H L S K S P I * F T S A E M L Y R R V W I S V K V P Y R F L V Q K W * I D G Y G P S K * Q T D L F Y K S G D F I E T G V TatI |Csp6I TaqI ||RsaI TspDTI |AlfI BccI MslI |||Hpy166II | TspDTI |AlfI \ \ \\\\ \ \ \\ CATCAATAATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATCCTTTCATTCATCG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGTTATTACAGGTATGTTCACTTTCATGTGCGTTTATAGGAATAGGAAAGTAAGTAGC / / /// / / / / BccI MslI ||TatI | TspDTI | TaqI |Hpy166II TspDTI AlfI |Csp6I AlfI RsaI H Q * C P Y K * K Y T Q I S L S F H S S I N N V H T S E S T R K Y P Y P F I H R S I M S I Q V K V H A N I L I L S F I E ----:----|----:----|----:----|----:----|----:----|----:----| W * Y H G Y L H F Y V C I D K D K * E D G D I I D M C T F T C A F I R I R E N M M L L T W V L S L V R L Y G * G K M * R BsmI Cac8I | Hin6I | |GlaI | |MstI* | ||FatI | ||HhaI | |||CviAII | ||||Cac8I | ||||| SphI TspEI | ||||| NspI | TaqI | ||||| NlaIII | | AlfI MaeII | ||||| |MslI CviRI* | | AlfI MseI |BsaAI \ \\\\\ \\ \ \ \ \ \ \\ AATGCTTGCGCATGCCAATGCACAGACAATTCGATACTCACTTAAAAATAACACCATCAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGAACGCGTACGGTTACGTGTCTGTTAAGCTATGAGTGAATTTTTATTGTGGTAGTG / / /// //// / / / / / / | | ||| |||MslI CviRI* | TaqI MseI | BsaAI | | ||| ||FatI TspEI TaiI | | ||| |CviAII AlfI SetI | | ||| Cac8I AlfI | | ||NlaIII | | ||Hin6I | | ||NspI | | ||SphI | | |MstI* | | |GlaI | | HhaI | Cac8I BsmI N A C A C Q C T D N S I L T * K * H H H M L A H A N A Q T I R Y S L K N N T I T C L R M P M H R Q F D T H L K I T P S R ----:----|----:----|----:----|----:----|----:----|----:----| F A Q A H W H V S L E I S V * F Y C W * S H K R M G I C L C N S V * K F I V G D I S A C A L A C V I R Y E S L F L V M V TfiI HinfI | Hpy188I | | SalI | | |TaqI | | |AccI SetI | | ||HindII TaiI | | ||Hpy166II BccI | | ||| BsrI | MseI | | ||| |MaeI Hpy178III* \ \ \ \ \\\ \\ \ GTATTTTAACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATCAATGTCCTGATTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CATAAAATTGCTTAGTCTACAGCTGACCAGATCACGATAACTGATAGTTACAGGACTAAC / / / // /// / / / | BccI MseI || ||| BsrI MaeI Hpy178III* MaeII || ||SalI || |AccI || |TaqI || Hpy166II || HindII |Hpy188I HinfI TfiI V F * R I R C R L V * C Y * L S M S * L Y F N E S D V D W S S A I D Y Q C P D C I L T N Q M S T G L V L L T I N V L I V ----:----|----:----|----:----|----:----|----:----|----:----| T N * R I L H R S T * H * Q S D I D Q N R I K V F * I D V P R T S N V I L T R I Y K L S D S T S Q D L A I S * * H G S Q SetI |Hpy166II ||Hpy178III* ApoI MseI ||| TspDTI TspEI \ \\\ \ \ TTTAATCGGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGACTAAAATACCAAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTAGCCGTTTTCGTGGTTTGTGTCTGTATAGTTTCCAAGTGCTGATTTTATGGTTTT / / / / / MseI SetI | | TspDTI | Hpy178III* Hpy166II F N R Q K H Q T Q T Y Q R F T T K I P K L I G K S T K H R H I K G S R L K Y Q N * S A K A P N T D I S K V H D * N T K I ----:----|----:----|----:----|----:----|----:----|----:----| N L R C F C W V C V Y * L N V V L I G F T * D A F A G F V S M D F T * S * F V L K I P L L V L C L C I L P E R S F Y W F AsuI* AvaII |BmgT120I || Hpy166II || | SetI XmnI SetI || BsrI | |FokI \ \ \\ \ \ \\ TTCATACGAACCCTTTCAATACCTACATACTGACATATTTGGTCCAGTTCACAACCTACC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTATGCTTGGGAAAGTTATGGATGTATGACTGTATAAACCAGGTCAAGTGTTGGATGG / / / /// / / TspEI XmnI SetI ||| | SetI ApoI ||| Hpy166II ||AvaII ||AsuI* |BmgT120I BsrI F I R T L S I P T Y * H I W S S S Q P T S Y E P F Q Y L H T D I F G P V H N L P H T N P F N T Y I L T Y L V Q F T T Y Q ----:----|----:----|----:----|----:----|----:----|----:----| N M R V R E I G V Y Q C I Q D L E C G V I * V F G K L V * M S V Y K T W N V V * E Y S G K * Y R C V S M N P G T * L R G ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | TspDTI TspGWI | | HgiAI* | ApoI | | |BseGI BccI BsmAI | TspEI \ \ \\ \ \ \ \ AAATAGTGCACCATCCTATTTCATCTCATTTACTGATGAGACAACAAAATTCCGTTGGGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATCACGTGGTAGGATAAAGTAGAGTAAATGACTACTCTGTTGTTTTAAGGCAACCCA / / /// / / / / | | ||ApaLI BccI | TspGWI TspEI | | |BseGI BsmAI ApoI | | Hpy166II | | CviRI* | | TspDTI | HgiAI* | BseSI | SduI FokI K * C T I L F H L I Y * * D N K I P L G N S A P S Y F I S F T D E T T K F R W V I V H H P I S S H L L M R Q Q N S V G F ----:----|----:----|----:----|----:----|----:----|----:----| L Y H V M R N * R M * Q H S L L I G N P W I T C W G I E D * K S I L C C F E T P F L A G D * K M E N V S S V V F N R Q T MnlI McrI* |Tsp4CI* || MlyI || PleI || Hpy178III* || |NruI || |Hpy99I || |FnuDII* MaeI || ||BsiYI* | AluI || ||| HinfI TaqI MnlI | CviJI \\ \\\ \ \ \ \ \ TTATCCATTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTACTACGATACTAGC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGTAATGTGCTGGCAGCGCTCCTGAGATAGGAGCTACAAAAATGATGCTATGATCG /// //// / / / /// ||| |||| HinfI TaqI MnlI ||CviJI ||| |||Hpy178III* ||AluI ||| ||FnuDII* |MaeI ||| ||NruI SetI ||| ||PleI ||| |MlyI ||| BsiYI* ||Tsp4CI* ||Hpy99I |MnlI McrI* L S I T R P S R G L Y P R C F Y Y D T S Y P L H D R R E D S I L D V F T T I L A I H Y T T V A R T L S S M F L L R Y * L ----:----|----:----|----:----|----:----|----:----|----:----| K D M V R G D R P S * G R H K * * S V L N I W * V V T A L V R D E I N K S R Y * * G N C S R R S S E I R S T K V V I S A AsuI* AvaII |BmgT120I ||BseMII |||SecI* BsiYI* |||DsaI* | TsoI |||BspCNI | CviJI ||||Tsp4CI* | HaeIII TspRI ||||| DdeI SetI MseI BsrI | |BsrI BstXI ||||| |Hpy188I \ \ \ \ \\ \ \\\\\ \\ TTTTATTAAAAACCAGTTTCAGGCCAGTGTCTTGGTTATACAAATGGACCGTGGTTCTGA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATAATTTTTGGTCAAAGTCCGGTCACAGAACCAATATGTTTACCTGGCACCAAGACT / / / /// / //// / / / | BsrI | ||| BstXI |||| | | DdeI MseI | ||HaeIII |||| | Hpy188I | ||CviJI |||| DsaI* | |TspRI |||| SecI* | |BsrI |||Tsp4CI* | TsoI |||AvaII BsiYI* |||AsuI* ||BmgT120I |BspCNI BseMII F Y * K P V S G Q C L G Y T N G P W F * F I K N Q F Q A S V L V I Q M D R G S E L L K T S F R P V S W L Y K W T V V L S ----:----|----:----|----:----|----:----|----:----|----:----| K * * F G T E P W H R P * V F P G H N Q S K N F V L K L G T D Q N Y L H V T T R K I L F W N * A L T K T I C I S R P E S AccI FatI |BssNAI ApoI |CviAII |Hpy166II TspEI || NlaIII \\ \ \\ \ GTATACTAACAGAACTCTCCATAAATTCCTTGAAAAAAATGGTATAACTCCATGCTATAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CATATGATTGTCTTGAGAGGTATTTAAGGAACTTTTTTTACCATATTGAGGTACGATATG // / / // |AccI TspEI | |FatI Hpy166II ApoI | CviAII BssNAI NlaIII V Y * Q N S P * I P * K K W Y N S M L Y Y T N R T L H K F L E K N G I T P C Y T I L T E L S I N S L K K M V * L H A I Q ----:----|----:----|----:----|----:----|----:----|----:----| T Y * C F E G Y I G Q F F H Y L E M S Y L I S V S S E M F E K F F I T Y S W A I Y V L L V R W L N R S F F P I V G H * V AciI NspBII* | TfiI | HinfI | | AvaI | | Hpy178III* | | |BmeT110I | | || FatI Tsp4CI* | | || SduI |Csp6I | | || HgiAI* ||RsaI | | || |CviAII PleI ||| BceAI | | || || NlaIII |MlyI ||| | SetI | | || || |HinfI || CviJI ||| | BceAI \ \ \\ \\ \\ \\ \ \\\ \ \ AACCACAGCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTAAACCGTACCTTATTAGA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTGTCGCCTAAGGGCTCGTGTACCTCAGCGACTTGCCGATTTGGCATGGAATAATCT / / / /// / // / / / / // / / | | | ||| | || HinfI | CviJI | || | BceAI | | | ||| | |FatI PleI | || BceAI | | | ||| | CviAII MlyI | |Csp6I | | | ||| NlaIII | RsaI | | | ||AvaI | SetI | | | |BmeT110I Tsp4CI* | | | |HgiAI* | | | |SduI | | | Hpy178III* | | HinfI | | TfiI | AciI NspBII* N H S G F P S T W S R * T A K P Y L I R T T A D S R A H G V A E R L N R T L L D P Q R I P E H M E S L N G * T V P Y * M ----:----|----:----|----:----|----:----|----:----|----:----| L W L P N G L V H L R Q V A L G Y R I L C G C R I G S C M S D S F P * V T G * * V V A S E R A C P T A S R S F R V K N S Csp6I CviRI* |RsaI CviRI* BsrDI Hpy166II | TaqI \\ \ \ \ \ \ TGACTGCCGTACTCAACTGCAATGTAGTGGTTTACCGAACCATTTATGGTTCTCTGCAAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ACTGACGGCATGAGTTGACGTTACATCACCAAATGGCTTGGTAAATACCAAGAGACGTTA // / / / / |Csp6I | BsrDI Hpy166II CviRI* RsaI CviRI* * L P Y S T A M * W F T E P F M V L C N D C R T Q L Q C S G L P N H L W F S A I T A V L N C N V V V Y R T I Y G S L Q S ----:----|----:----|----:----|----:----|----:----|----:----| H S G Y E V A I Y H N V S G N I T R Q L I V A T S L Q L T T T * R V M * P E R C S Q R V * S C H L P K G F W K H N E A I ApoI TspEI | HphI | | MaeI | | | AluI ApoI | | | CviJI TspEI | | | | SetI SetI CviRI* \ \ \ \ \ \ \ \ CGAATTTTCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCAAAAAATCTGCAAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTAAAAGATGATAACACTCTTTAAGTGATCGAAGTGGATTTTCGTTTTTTAGACGTTC / / / /// / / | TspEI | ||| SetI CviRI* | ApoI | ||CviJI TaqI | ||AluI | |MaeI | SetI TspEI ApoI HphI R I F Y Y C E K F T S F T * K Q K I C K E F S T I V R N S L A S P K S K K S A R N F L L L * E I H * L H L K A K N L Q D ----:----|----:----|----:----|----:----|----:----|----:----| R I K * * Q S F N V L K V * F C F I Q L D F K R S N H S I * * S * R F A F F R C S N E V I T L F E S A E G L L L F D A L EcoRV FatI | TatI |CviAII | |Csp6I || NspI | ||RsaI || NlaIII | ||ScaI || | Cac8I | ||| TaqII || | | Hin4I | ||| |MaeIII || | | Hin4I | ||| || Hin4I HindII || | | CviJI | ||| || Hin4I Hpy166II || | | | MwoI | ||| || | SetI | SetI \\ \ \ \ \ \ \\\ \\ \ \ \ \ ACAACATGCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTTTCGGTCAACCTGT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTACGACCGAACCGTCCTGAACTATAGTCATGAAACAATGGAAAGCCAGTTGGACA / // /// / /// / / / // | || ||CviJI EcoRV ||| | | MaeIII |SetI | || |MwoI ||| | SetI Hpy166II | || Cac8I ||| Hin4I HindII | |FatI ||| Hin4I | CviAII ||TaqII | Hin4I ||TatI | Hin4I |Csp6I NlaIII ScaI NspI RsaI T T C W L G R T * Y Q Y F V T F R S T C Q H A G L A G L D I S T L L P F G Q P V N M L A W Q D L I S V L C Y L S V N L L ----:----|----:----|----:----|----:----|----:----|----:----| V V H Q S P L V Q Y * Y K T V K R D V Q S L M S A Q C S K I D T S Q * R E T L R C C A P K A P S S I L V K N G K P * G T BseGI | MnlI | |BssKI | |SecI* | |EcoRII | || FokI | || MwoI BsaXI FokI | || ScrFI | MboI | BseGI | || BseBI | BclI | | BsaXI | || | CviJI | | DpnI | | |MslI | || | SfaNI | | |BstKTI FokI | | |BsiI* | || | | TspGWI \ \ \\ \ \ \ \\ \ \\ \ \ \ TATCGTCAATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCATCCCAGGCTACGC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCAGTTACTAGTGTTGGGATTGAGGTTTTATGTAGGAGCACCGTAGGGTCCGATGCG / // / / / // / / // //// / BsaXI || BclI FokI | || | | || |||| SfaNI || MboI | || | | || |||TspGWI |DpnI | || | | || |||FokI BstKTI | || | | || ||EcoRII | || | | || ||BssKI | || | | || ||CviJI | || | | || |SecI* | || | | || BseBI | || | | || ScrFI | || | | |MwoI | || | | MnlI | || | BsiI* | || | BseGI | || MslI | |FokI | BsaXI BseGI Y R Q * S Q P * L Q N T S S W H P R L R I V N D H N P N S K I H P R G I P G Y A S S M I T T L T P K Y I L V A S Q A T L ----:----|----:----|----:----|----:----|----:----|----:----| * R * H D C G * S W F V D E H C G L S R N D D I I V V R V G F Y M R T A D W A V I T L S * L G L E L I C G R P M G P * A Hpy178III* |TaqI || BsmAI MseI || Esp3I Hin4I || | Hin4I FokI Hin4I BseGI || | Hin4I |MboII BseGI | BccI \ \\ \ \ \\ \ \ \ TCTACATCCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCATCCTTAAAGAAGAC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGTAGGCAGAGCTTTGAGAATACCTATATAGTAGATAGAAGGTAGGAATTTCTTCTG / /// / / / / / // / BseGI ||| Esp3I | FokI | Hin4I |BccI Tsp4CI* ||| BsmAI MboII | Hin4I MseI ||TaqI BseGI |Hpy178III* Hin4I Hin4I S T S V S K L L W I Y H L S S I L K E D L H P S R N S Y G Y I I Y L P S L K K T Y I R L E T L M D I S S I F H P * R R Q ----:----|----:----|----:----|----:----|----:----|----:----| E V D T E F S K H I Y * R D E M R L S S S * M R R S V R I S I D D I K W G * L L R C G D R F E * P Y I M * R G D K F F V TfiI HinfI Tsp4CI* | Hpy178III* |BbvII* | | MboI || MboII | | | DpnI || | Eco57I | | | |BstKTI || | Eco57MI | | | ||TspEI || | | MboII | | | ||| TspEI \\ \ \ \ \ \ \ \\\ \ AGTAGATACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGATTAGATCAATTCAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCTATGTTGATTGATACAATAAGAAGTCCCGTTCCTTAGGTCTAATCTAGTTAAGTT / / / / / // / / | | MboII | | || | TspEI | Eco57MI | | || MboI | Eco57I | | |DpnI BbvII* | | BstKTI MboII | Hpy178III* HinfI TfiI S R Y N * L C Y S S G Q G I Q I R S I Q V D T T N Y V I L Q G K E S R L D Q F N * I Q L T M L F F R A R N P D * I N S I ----:----|----:----|----:----|----:----|----:----|----:----| L L Y L * S H * E E P C P I W I L D I * C Y I C S V I N N K L A L F G S * I L E T S V V L * T I R * P L S D L N S * N L MseI |BbvII* || MboII Hpy99I || Tsp4CI* | HgaI || |TspDTI TspDTI | | TaqI || || MseI | HgaI BsrDI \ \ \ \\ \\ \ \ \ \ TTACGACGCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTTCATATCATTCGTT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCTGCGTGAGTGAAAGCTACTTCTGAATTTGGCAAATTGACGAAGTATAGTAAGCAA // // / / / / // |Hpy99I |TaqI | | MseI TspDTI |HgaI TspEI HgaI | Tsp4CI* BsrDI | TspDTI | BbvII* | MboII MseI L R R T H F R * R L K P F N C F I S F V Y D A L T F D E D L N R L T A S Y H S F T T H S L S M K T * T V * L L H I I R S ----:----|----:----|----:----|----:----|----:----|----:----| N R R V * K R H L S L G N L Q K M D N T I V V C E S E I F V * V T * S S * I M R * S A S V K S S S K F R K V A E Y * E N TfiI BinI* HinfI | MboI | Hin4I | XhoII | Hin4I | | DpnI MboI | | Hpy188I | | |BstKTI | DpnI | | | FatI | | || TfiI | |BstKTI | | | |CviAII | | || HinfI | || MseI | | | || NlaIII \ \ \\ \ \ \\ \ \ \ \ \\ \ CATTGCGTCAAATGAGATCCAAGAATCCAATGATCTTAACATAGAATCTGACCATGACTT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GTAACGCAGTTTACTCTAGGTTCTTAGGTTACTAGAATTGTATCTTAGACTGGTACTGAA / // / / // / / / // / // | || XhoII HinfI || | | | || | |FatI | || MboI TfiI || | | | || | CviAII | |DpnI || | | | || NlaIII | BstKTI || | | | |Hpy188I BinI* || | | | HinfI || | | | TfiI || | | Hin4I || | | Hin4I || | MseI || MboI |DpnI BstKTI H C V K * D P R I Q * S * H R I * P * L I A S N E I Q E S N D L N I E S D H D F L R Q M R S K N P M I L T * N L T M T S ----:----|----:----|----:----|----:----|----:----|----:----| * Q T L H S G L I W H D * C L I Q G H S E N R * I L D L F G I I K V Y F R V M V M A D F S I W S D L S R L M S D S W S K BseMII |BspCNI || BseGI || Hin4I || Hin4I || | Hpy178III* AluI || | |DdeI CviJI FokI || | |Bpu10I | SetI |Hpy188I || | || MmeI | | HinfI \\ \\ \ \\ \ \ \ \ CCAATCCGACATTGAACTACATCCTGAGCAACCGAGAAATGTCCTTTCAAAAGCTGTGAG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGGCTGTAACTTGATGTAGGACTCGTTGGCTCTTTACAGGAAAGTTTTCGACACTC / / // / / // / / | | || BseGI | |MmeI | CviJI | | |BspCNI | Bpu10I | AluI | | |Hin4I | DdeI SetI | | |Hin4I Hpy178III* | | BseMII | FokI Hpy188I P I R H * T T S * A T E K C P F K S C E Q S D I E L H P E Q P R N V L S K A V S N P T L N Y I L S N R E M S F Q K L * V ----:----|----:----|----:----|----:----|----:----|----:----| G I R C Q V V D Q A V S F H G K L L Q S E L G V N F * M R L L R S I D K * F S H W D S M S S C G S C G L F T R E F A T L TfiI HinfI | TaqI | AsuII PleI | | MaeII |MlyI HindII | | AflIII ||TfiI Hpy166II | | |MboII ||HinfI | MmeI | | || SetI Eco57I |||TspGWI SetI | |MnlI | | || TaiI Eco57MI \\\\ \ \ \\ \ \ \\ \ \ TCCAACCGATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAACGTGTTTCTAAAAC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGGCTAAGGTGTGGAGGCAGTTGAGTATGACTTCTAAGCTTTGCACAAAGATTTTG / / / / / / / / // / / / HinfI | | SetI | MnlI | | || | | Eco57MI | HinfI Hpy166II | | || | | Eco57I | TfiI HindII | | || | AflIII TspGWI MmeI | | || MaeII PleI | | |MboII MlyI | | TaiI | | SetI | AsuII | TaqI HinfI TfiI S N R F H T S V N S Y * R F E T C F * N P T D S T P P S T H T E D S K R V S K T Q P I P H L R Q L I L K I R N V F L K P ----:----|----:----|----:----|----:----|----:----|----:----| D L R N W V E T L E Y Q L N S V H K * F T W G I G C R R * S M S F I R F T N R F G V S E V G G D V * V S S E F R T E L V Hpy188I Hin6I |TfiI FnuDII* HindII |HinfI |GlaI Hpy166II || MboII SspI ||HhaI | TaqII || | SspI Ksp632I* \ \\\ \ \ \\ \ \ \ CAATATTCGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTAATATTCTTCCATC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATAAGCGCGTGGGTCTCTTCAACTGGGGTTGTATAGACTTAGATTATAAGAAGGTAG / /// // / // / SspI ||Hin6I |TaqII | || SspI |GlaI Hpy166II | |HinfI FnuDII* HindII | |TfiI HhaI | MboII Hpy188I Q Y S R T Q R S * P Q H I * I * Y S S I N I R A P R E V D P N I S E S N I L P S I F A H P E K L T P T Y L N L I F F H Q ----:----|----:----|----:----|----:----|----:----|----:----| W Y E R V W L L Q G W C I Q I * Y E E M G I N A C G S F N V G V Y R F R I N K W L I R A G L S T S G L M D S D L I R G D BccI TaqI | MboI |Hpy178III* | BglII || Csp6I | XhoII || |RsaI | | DpnI || ||AgeI | | |BstKTI || ||BetI* | | ||MaeI ApoI || ||Cfr10I | | ||| MboII TspEI PpiI || |||HpaII \ \ \\\ \ \ \ \\ \\\\ AAAGAAGAGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCGGTTCGGGTGGTAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCTCTAGATCGTGGGGGGTTTAAAGGTTATAGCTCTCATGGCCAAGCCCACCATA / / // / // / / // // // // | | || | |MboII | TspEI || || |Cfr10I |EcoT22I | | || | MaeI | ApoI || || |BetI* PpiI | | || XhoII PpiI || || |AgeI | | || BglII || || HpaII | | || MboI || |Csp6I | | |DpnI || RsaI | | BstKTI |Hpy178III* | BccI TaqI Ksp632I* K E E I * H P P N F Q Y R E Y R F G W Y K K R S S T P Q I S N I E S T G S G G M R R D L A P P K F P I S R V P V R V V C ----:----|----:----|----:----|----:----|----:----|----:----| L S S I * C G G F K W Y R S Y R N P H Y * L L S R A G G L N G I D L T G T R T T F F L D L V G W I E L I S L V P E P P I CviRI* | PpiI FatI | EcoT22I FatI |CviAII | | TspEI |CviAII || HinfI | | | MseI BslFI || NlaIII || NlaIII \ \ \ \ \ \\ \ \\ \ GCATAAATTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACACACATGAGTCGTC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTATTTAATTTACAAGGAAATGAACGAGGGTACAGGGTTAGATTGTGTGTACTCAGCAG / // / / // / // / CviRI* |MseI BslFI | |FatI | || Hpy99I TspEI | CviAII | || HinfI NlaIII | |FatI | CviAII NlaIII A * I K C S F T C S H V P I * H T * V V H K L N V P L L A P M S Q S N T H E S S I N * M F L Y L L P C P N L T H M S R R ----:----|----:----|----:----|----:----|----:----|----:----| A Y I L H E K V Q E W T G I * C V H T T H M F * I N R * K S G H G L R V C M L R C L N F T G K S A G M D W D L V C S D D Hpy188I | MlyI | PleI | | DdeI | | | Hpy188I | | | |HinfI | | | || Csp6I | | | || |BdaI | | | || |BdaI | | | || |RsaI | | | || || BspCNI PleI | | | || || Tsp4CI* Hpy99I | | | || || |BseMII |MlyI | | | || || || BsmAI ||Cac8I | | | || || || | TspRI ||| BsrI | | | || || || | | BaeI \\\ \ \ \ \ \\ \\ \\ \ \ \ GCACGCCAGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTGAAAATGAGACTAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGCGGTCATTTAGATTTCTAAAGTCTGTGAGTCTGAGCATGTCACTTTTACTCTGATT /// / // // ////// / / ||BsrI | || || |||||| | BsmAI |Cac8I | || || |||||| BaeI PleI | || || |||||Tsp4CI* MlyI | || || |||||BseMII | || || ||||BspCNI | || || ||||Csp6I | || || |||RsaI | || || ||TspRI | || || |BdaI | || || |BdaI | || || HinfI | || |DdeI | || Hpy188I | |PleI | MlyI Hpy188I A R Q * I * R F Q T L R L V Q * K * D * H A S K S K D F R H S D S Y S E N E T N T P V N L K I S D T Q T R T V K M R L I ----:----|----:----|----:----|----:----|----:----|----:----| A R W Y I * L N * V S L S T C H F H S * R V G T F R F I E S V * V R V T F I L S C A L L D L S K L C E S E Y L S F S V L MaeII | Csp6I Acc65I | |RsaI HgiCI* | |SetI BsrI |Csp6I | |TaiI | Csp6I ||RsaI | || BdaI | |RsaI ||NlaIV Tsp4CI* | || BdaI | || BaeI ||| KpnI | AciI \ \\ \ \ \\ \ \\\ \ \ \ TCATACAAACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAACTGTTCCGCAGAT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTATGTTTGCATGGTTATAGGTCATGCCCACCATGGTTGTTGTTTTGACAAGGCGTCTA / /// / / // / /// / / | ||Csp6I | | |Csp6I | ||HgiCI* | AciI | ||BdaI | | RsaI | ||Acc65I Tsp4CI* | ||BdaI | BaeI | |Csp6I | |RsaI BsrI | NlaIV | MaeII | RsaI TaiI KpnI SetI S Y K R T N I Q Y G W Y Q Q Q N C S A D H T N V P I S S T G G T N N K T V P Q I I Q T Y Q Y P V R V V P T T K L F R R * ----:----|----:----|----:----|----:----|----:----|----:----| D Y L R V L I W Y P H Y W C C F Q E A S I M C V Y W Y G T R T T G V V F S N R L * V F T G I D L V P P V L L L V T G C I MaeIII Tsp45I Tsp4CI* | BsmAI | Hpy166II TaqI | |BseMII | | SfaNI ClaI | ||BspCNI DdeI HphI | | | SetI | Hin4II* BtgZI \ \\\ \ \ \ \ \ \ \ \ \ AAGTGACCAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAATCGATGCTTCTCC 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACTGGTTCTCTGACTCTTTTCCTAATATGTGGCAAGTGGAAGTTAGCTACGAAGAGG // / / / / / // / / || | BsmAI DdeI HphI | |SetI SfaNI Hin4II* || Tsp45I | Hpy166II ClaI || MaeIII Tsp4CI* TaqI |BspCNI BseMII K * P R D * E K D Y T P F T F N R C F S S D Q E T E K R I I H R S P S I D A S P V T K R L R K G L Y T V H L Q S M L L H ----:----|----:----|----:----|----:----|----:----|----:----| L H G L S Q S F S * V G N V K L R H K E Y T V L L S L F P N Y V T * R * D I S R L S W S V S F L I I C R E G E I S A E G BetI* |HpaII Tsp4CI* ||TspDTI TspEI SspI AjuI | Hpy188I \\\ \ \ \ \ \ ACCGGAAAATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAACTACTGTTTCTGA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCCTTTTATTAAGTAGCGTGTTATAACAAGGATAGTTTTGCGGTTGATGACAAAGACT / // / / / / / | |BetI* TspEI SspI AjuI | Hpy188I | HpaII Tsp4CI* | BtgZI TspDTI T G K * F I A Q Y C S Y Q N A N Y C F * P E N N S S H N I V P I K T P T T V S E R K I I H R T I L F L S K R Q L L F L N ----:----|----:----|----:----|----:----|----:----|----:----| V P F Y N M A C Y Q E * * F A L * Q K Q W R F I I * R V I N N R D F R W S S N R G S F L E D C L I T G I L V G V V T E S MboI | DpnI | |BstKTI | || GsuI | || Eco57MI | || | MboI | || | | DpnI MnlI | || | | |BstKTI | BtgZI | || | | || SetI | | AjuI | || | | || |Hpy178III* | | SecI* | || | | || || TfiI | | | TfiI | || | | || || HinfI | | | HinfI | || | | || || | MnlI \ \ \ \ \ \\ \ \ \\ \\ \ \ ACAGAATACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATCTACCTCCAGAATC 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTATGGCTCCTTAGATAGTAGCGACTAGAGGGTGAGGGACTAGATGGAGGTCTTAG // / / / // / / // // / / |AjuI | | HinfI || | Eco57MI || |SetI | HinfI MnlI | | TfiI || | GsuI || MboI | MnlI | SecI* || MboI |DpnI | TfiI BtgZI |DpnI BstKTI Hpy178III* BstKTI T E Y R G I Y H R * S P T P * S T S R I Q N T E E S I I A D L P L P D L P P E S R I P R N L S S L I S H S L I Y L Q N L ----:----|----:----|----:----|----:----|----:----|----:----| V S Y R P I * * R Q D G V G Q D V E L I F L I G L F R D D S I E W E R I * R W F C F V S S D I M A S R G S G S R G G S D ApoI MseI TspEI |AhaIII* ApoI TspEI EcoRI || Hin4I TspEI |TaqII \ \\ \ \ \\ TCCTACCGAATTCCCTGACCCATTTAAAGAACTCCCACCGATAAATTCTCATCAAACTAA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AGGATGGCTTAAGGGACTGGGTAAATTTCTTGAGGGTGGCTATTTAAGAGTAGTTTGATT / // / // EcoRI |Hin4I TspEI |Hin4I TspEI |MseI ApoI TaqII ApoI AhaIII* S Y R I P * P I * R T P T D K F S S N * P T E F P D P F K E L P P I N S H Q T N L P N S L T H L K N S H R * I L I K L I ----:----|----:----|----:----|----:----|----:----|----:----| E * R I G Q G M * L V G V S L N E D F * R R G F E R V W K F F E W R Y I R M L S G V S N G S G N L S S G G I F E * * V L MlyI PleI | MaeIII BsrI | Tsp45I Hin4I | | HinfI HphI Tsp4CI* MboI \ \ \ \ \ \ \ TTCCAGTTTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCAACAGTAAGAAAAG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTCAAACCCACCATAACCACTGAGATTACGGATATGATGATAGTTGTCATTCTTTTC // // // / / / |TspEI |PleI || HphI Tsp4CI* BstKTI BsrI MlyI |HinfI Tsp45I MaeIII F Q F G W Y W * L * C L Y Y Y Q Q * E K S S L G G I G D S N A Y T T I N S K K R P V W V V L V T L M P I L L S T V R K D ----:----|----:----|----:----|----:----|----:----|----:----| N W N P H Y Q H S * H R Y * * * C Y S F I G T Q T T N T V R I G I S S D V T L F E L K P P I P S E L A * V V I L L L F L MboII | TspEI | | MseI | | | TspDTI | | | | SetI | | | | BsmAI | | | | | BsiI* | | | | | Hpy178III* | | | | | | FatI | | | | | | |CviAII DpnI | | | | | | || NlaIII |BstKTI | | | | | | || | DdeI \\ \ \ \ \ \ \ \\ \ \ ATCATTAGAAGATAATGAAACTGAAATTAAGGTATCACGAGACACATGGAATACTAAGAA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAATCTTCTATTACTTTGACTTTAATTCCATAGTGCTCTGTGTACCTTATGATTCTT / / / // // / / // / | MboI MboII |MseI || | | |FatI DdeI DpnI |SetI || | | CviAII TspDTI || | NlaIII TspEI || BsiI* |Hpy178III* BsmAI I I R R * * N * N * G I T R H M E Y * E S L E D N E T E I K V S R D T W N T K N H * K I M K L K L R Y H E T H G I L R I ----:----|----:----|----:----|----:----|----:----|----:----| I M L L Y H F Q F * P I V L C M S Y * S S * * F I I F S F N L Y * S V C P I S L D N S S L S V S I L T D R S V H F V L F SetI | Hpy188I | | MboI TseI | | | DpnI CviRI* | | | |TaqI |BisI | | | |BstKTI ||BlsI | | | || HphI |||AluI | | | || | ApoI |||CviJI | | | || | TspEI |||PvuII | | | || | EcoRI |||NspBII* | | | || | | MboII |||| SetI | | | ||MnlI | | | SetI |||| | MwoI \ \ \ \\\ \ \ \ \ \\\\ \ \ TATGCGTAGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTAAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGCATCAAATCTTGGAGGCTCTAGCTTCTTTGCTTAAGTGGACTAACGTCGACATTT / / ///// / /// //// / SetI | ||||| HphI ||SetI |||| MwoI | ||||TaqI |EcoRI |||NspBII* | |||MboI |TspEI |||PvuII | ||MnlI |ApoI |||CviJI | |DpnI MboII |||TseI | BstKTI |||AluI Hpy188I ||BisI |BlsI |SetI CviRI* Y A * F R T S E I E E T N S P D C S C K M R S L E P P R S K K R I H L I A A V K C V V * N L R D R R N E F T * L Q L * K ----:----|----:----|----:----|----:----|----:----|----:----| Y A Y N L V E S I S S V F E G S Q L Q L I H T T * F R R S R L F S N V Q N C S Y I R L K S G G L D F F R I * R I A A T F SmlI AflII MnlI |MseI TspGWI BbvI |SetI | HphI SetI \ \\ \ \ \ AGCAGTAAAATCAATCAAACCAATACGGACAACCTTAAGATACGATGAGGCAATCACCTA 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCATTTTAGTTAGTTTGGTTATGCCTGTTGGAATTCTATGCTACTCCGTTAGTGGAT / / /// / / BbvI SetI ||MnlI HphI SetI |TspGWI |AflII |SmlI MseI S S K I N Q T N T D N L K I R * G N H L A V K S I K P I R T T L R Y D E A I T Y Q * N Q S N Q Y G Q P * D T M R Q S P I ----:----|----:----|----:----|----:----|----:----|----:----| L L L I L * V L V S L R L I R H P L * R F C Y F * D F W Y P C G * S V I L C D G A T F D I L G I R V V K L Y S S A I V * HindII MseI TaqI Hpy166II \ \ \ TAATAAAGATATTAAAGAAAAGGAAAAATATATCGAAGCATACCACAAAGAAGTCAACCA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| ATTATTTCTATAATTTCTTTTCCTTTTTATATAGCTTCGTATGGTGTTTCTTCAGTTGGT / / / MseI TaqI Hpy166II HindII * * R Y * R K G K I Y R S I P Q R S Q P N K D I K E K E K Y I E A Y H K E V N Q I K I L K K R K N I S K H T T K K S T N ----:----|----:----|----:----|----:----|----:----|----:----| Y Y L Y * L F P F I Y R L M G C L L * G I I F I N F F L F F I D F C V V F F D V L L S I L S F S F Y I S A Y W L S T L W TspDTI | TspRI | | SspI | | BslFI \ \ \ ACTATTGAAAATGAATACTTGGGACACTGACAAATATTATGACAGAAAAGAAATAGACCC 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACTTTTACTTATGAACCCTGTGACTGTTTATAATACTGTCTTTTCTTTATCTGGG / / / / | TspDTI | BslFI TspRI SspI T I E N E Y L G H * Q I L * Q K R N R P L L K M N T W D T D K Y Y D R K E I D P Y * K * I L G T L T N I M T E K K * T L ----:----|----:----|----:----|----:----|----:----|----:----| V I S F S Y K P C Q C I N H C F L F L G L * Q F H I S P V S V F I I V S F F Y V S N F I F V Q S V S L Y * S L F S I S G MaeII |MaeIII |Tsp45I || SetI || TaiI || | Tsp4CI* AluI ApoI BdaI || | |Csp6I CviJI TspEI MboII BdaI || | ||RsaI |MaeI \ \ \ \\ \ \\\ \\ TAAAAGAGTAATAAATTCAATGTTTATCTTCAACAGGAAACGTGACGGTACTCATAAAGC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTTCTCATTATTTAAGTTACAAATAGAAGTTGTCCTTTGCACTGCCATGAGTATTTCG // / / / / // / / |MboII BdaI | | | |Csp6I | CviJI TspEI BdaI | | | RsaI | AluI ApoI | | Tsp4CI* SetI | | Tsp45I | | MaeIII | MaeII TaiI SetI * K S N K F N V Y L Q Q E T * R Y S * S K R V I N S M F I F N R K R D G T H K A K E * * I Q C L S S T G N V T V L I K L ----:----|----:----|----:----|----:----|----:----|----:----| * F L L L N L T * R * C S V H R Y E Y L R F S Y Y I * H K D E V P F T V T S M F L L T I F E I N I K L L F R S P V * L A FatI |CviAII ||Cac8I BdaI BseGI ||| SphI BdaI |HphI ||| NspI | MnlI || Hpy178III* ||| CviRI* | | CviRI* || | SfaNI ||| NlaIII | | | FokI || | |MlyI HinfI ||| | BspCNI SetI | | | | SetI || | |PleI | DdeI ||| | |BseMII \ \ \ \ \ \ \\ \ \\ \ \ \\\ \ \\ TAGATTTGTTGCAAGAGGTGATATTCAGCATCCTGACACTTACGACTCAGGCATGCAATC 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| ATCTAAACAACGTTCTCCACTATAAGTCGTAGGACTGTGAATGCTGAGTCCGTACGTTAG / / / / / / / / / // / / / / /// // | | | | | FokI | HphI | || SfaNI | | | ||| |BseMII | | | | SetI BseGI | |PleI | | | ||| BspCNI | | | CviRI* | MlyI | | | ||CviRI* | | MnlI Hpy178III* | | | ||FatI | BdaI | | | |CviAII | BdaI | | | Cac8I MaeI | | NlaIII | | NspI | | SphI | DdeI HinfI * I C C K R * Y S A S * H L R L R H A I R F V A R G D I Q H P D T Y D S G M Q S D L L Q E V I F S I L T L T T Q A C N P ----:----|----:----|----:----|----:----|----:----|----:----| * I Q Q L L H Y E A D Q C K R S L C A I S S K N C S T I N L M R V S V V * A H L L N T A L P S I * C G S V * S E P M C D MslI |FokI || CviRI* || | EcoT22I || | | BseGI Tsp4CI* || | | | DrdI |Csp6I || | |MseI | | MaeIII ||RsaI || | |VspI | | Tsp45I CviRI* \\\ \\ \ \\ \ \ \ \ CAATACCGTACATCACTATGCATTAATGACATCCCTGTCACTTGCATTAGACAATAACTA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATGGCATGTAGTGATACGTAATTACTGTAGGGACAGTGAACGTAATCTGTTATTGAT / // / / / / / / / / | || | | | | | DrdI | CviRI* | || | | | | BseGI Tsp45I | || | | | VspI MaeIII | || | | | MseI | || | | CviRI* | || | | FokI | || | EcoT22I | || MslI | |Csp6I | RsaI Tsp4CI* Q Y R T S L C I N D I P V T C I R Q * L N T V H H Y A L M T S L S L A L D N N Y I P Y I T M H * * H P C H L H * T I T T ----:----|----:----|----:----|----:----|----:----|----:----| W Y R V D S H M L S M G T V Q M L C Y S G I G Y M V I C * H C G Q * K C * V I V L V T C * * A N I V D R D S A N S L L * TspEI | MboII CviRI* TspEI \ \ \ \ CTATATTACACAATTAGACATATCTTCGGCATATTTGTATGCAGACATCAAAGAAGAATT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| GATATAATGTGTTAATCTGTATAGAAGCCGTATAAACATACGTCTGTAGTTTCTTCTTAA // / / |TspEI CviRI* TspEI MboII L Y Y T I R H I F G I F V C R H Q R R I Y I T Q L D I S S A Y L Y A D I K E E L I L H N * T Y L R H I C M Q T S K K N Y ----:----|----:----|----:----|----:----|----:----|----:----| S Y * V I L C I K P M N T H L C * L L I V I N C L * V Y R R C I Q I C V D F F F * I V C N S M D E A Y K Y A S M L S S N TspDTI | MaeII MnlI | | SetI MboII SetI | BsiYI* | | TaiI \ \ \ \ \ \ \ ATACATAAGACCTCCACCACATTTAGGAATGAATGATAAGTTGATACGTTTGAAGAAATC 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTATTCTGGAGGTGGTGTAAATCCTTACTTACTATTCAACTATGCAAACTTCTTTAG / / / / / / | SetI BsiYI* | | MaeII MboII MnlI | TaiI | SetI TspDTI I H K T S T T F R N E * * V D T F E E I Y I R P P P H L G M N D K L I R L K K S T * D L H H I * E * M I S * Y V * R N H ----:----|----:----|----:----|----:----|----:----|----:----| I C L V E V V N L F S H Y T S V N S S I * V Y S R W W M * S H I I L Q Y T Q L F Y M L G G G C K P I F S L N I R K F F D Csp6I |RsaI MboII |BsrI SetI \ \\ \ ACTTTATGGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCAAATCATACCTGAT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATACCTAACTTTGTTTCACCTCGCTTGACCATGCTTTGATAGTTTAGTATGGACTA / / // / MboII | |Csp6I SetI | RsaI BsrI T L W I E T K W S E L V R N Y Q I I P D L Y G L K Q S G A N W Y E T I K S Y L I F M D * N K V E R T G T K L S N H T * * ----:----|----:----|----:----|----:----|----:----|----:----| V K H I S V F H L S S T R F * * I M G S * K I S Q F L T S R V P V F S D F * V Q S * P N F C L P A F Q Y S V I L D Y R I FatI BseGI |CviAII || NlaIII Tsp4CI* XmnI || | FokI | TspRI | BccI MboII || | | MseI MaeIII \ \ \ \ \ \\ \ \ \ \ AAAACAGTGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTAAGAATAGTCAAGT 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTCACACCATACCTTCTTCAAGCACCTACCAGTACGCATAAATTCTTATCAGTTCA / / / / / / / // // | Tsp4CI* | | | | | |FatI |MseI TspRI | | | | | CviAII FokI | | | | NlaIII | | | BseGI | | MboII | BccI XmnI K T V W Y G R S S W M V M R I * E * S S K Q C G M E E V R G W S C V F K N S Q V N S V V W K K F V D G H A Y L R I V K * ----:----|----:----|----:----|----:----|----:----|----:----| L V T H Y P L L E H I T M R I * S Y D L Y F L T T H F F N T S P * A Y K L I T L F C H P I S S T R P H D H T N L F L * T MseI | BdaI BdaI | BdaI TspEI BdaI | | CviRI* \ \ \ \ \ AACAATTTGCTTATTCGTTGATGATATGATATTGTTCAGCAAAGACTTAAATGCAAATAA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTAAACGAATAAGCAACTACTATACTATAACAAGTCGTTTCTGAATTTACGTTTATT / / / // / / | TspEI BdaI || CviRI* Bce83I* MaeIII BdaI |MseI BdaI BdaI N N L L I R * * Y D I V Q Q R L K C K * T I C L F V D D M I L F S K D L N A N K Q F A Y S L M I * Y C S A K T * M Q I R ----:----|----:----|----:----|----:----|----:----|----:----| L L K S I R Q H Y S I T * C L S L H L Y Y C N A * E N I I H Y Q E A F V * I C I V I Q K N T S S I I N N L L S K F A F L SmlI Hin4I Bce83I* | Hpy178III* Hin4I TaqII \ \ \ \ \ GAAAATCATAACAACACTCAAGAAACAATACGATACAAAGATAATAAATCTGGGTGAAAG 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAGTATTGTTGTGAGTTCTTTGTTATGCTATGTTTCTATTATTTAGACCCACTTTC / / / / | Hin4I TaqII Hin4I | Hin4I Hin4I Hpy178III* SmlI E N H N N T Q E T I R Y K D N K S G * K K I I T T L K K Q Y D T K I I N L G E S K S * Q H S R N N T I Q R * * I W V K V ----:----|----:----|----:----|----:----|----:----|----:----| S F * L L V * S V I R Y L S L L D P H F L F D Y C C E L F L V I C L Y Y I Q T F F I M V V S L F C Y S V F I I F R P S L Hin4I Hin4I | HphI | | ApoI Csp6I CviJI | | TspEI |RsaI |DdeI MnlI SetI FatI \ \ \ \\ \\ \ \ \ TGATAACGAAATTCAGTACGACATACTTGGCTTAGAAATCAAATATCAAAGAGGTAAATA 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| ACTATTGCTTTAAGTCATGCTGTATGAACCGAATCTTTAGTTTATAGTTTCTCCATTTAT / / // / / / / / HphI | |Csp6I | DdeI MnlI SetI NlaIII | RsaI CviJI TspEI ApoI * * R N S V R H T W L R N Q I S K R * I D N E I Q Y D I L G L E I K Y Q R G K Y I T K F S T T Y L A * K S N I K E V N T ----:----|----:----|----:----|----:----|----:----|----:----| H Y R F E T R C V Q S L F * I D F L Y I T I V F N L V V Y K A * F D F I L S T F S L S I * Y S M S P K S I L Y * L P L Y TspEI | MseI SetI | | MaeII | TspDTI | | | Csp6I | | BseMII | | | |RsaI CviAII | | |BspCNI | | | |SetI | NlaIII | | || MseI | | | |TaiI | |TspEI | | || | DdeI | | | || SetI \ \\ \ \ \\ \ \ \ \ \ \\ \ CATGAAATTAGGTATGGAAAACTCATTAACTGAGAAAATACCCAAATTAAACGTACCTTT 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTTAATCCATACCTTTTGAGTAATTGACTCTTTTATGGGTTTAATTTGCATGGAAA // / / // / / /// /// |FatI TspEI | |BspCNI MseI DdeI ||| ||Csp6I | SetI | BseMII ||| |RsaI CviAII TspDTI ||| |SetI ||| MaeII ||TaiI ||SetI |MseI TspEI H E I R Y G K L I N * E N T Q I K R T F M K L G M E N S L T E K I P K L N V P L * N * V W K T H * L R K Y P N * T Y L * ----:----|----:----|----:----|----:----|----:----|----:----| C S I L Y P F S M L Q S F V W I L R V K V H F * T H F V * * S L F Y G F * V Y R M F N P I S F E N V S F I G L N F T G K DdeI | Hin6I | MboII | |GlaI | |Eco47III | ||HhaI | |||HaeII | ||||BssKI | ||||EcoRII | ||||| ScrFI | ||||| BseBI | ||||| | SetI | ||||| | |HindII | ||||| | |Hpy166II | ||||| | || BssKI | ||||| | || SexAI | ||||| | || EcoRII BssKI | ||||| | || | ScrFI EcoRII TfiI GsuI | ||||| | || | BseBI | ScrFI HinfI Eco57MI | ||||| | || | | SetI | BseBI \ \ \ \\\\\ \ \\ \ \ \ \ \ GAATCCAAAAGGAAGAAAACTTAGCGCTCCAGGTCAACCAGGTCTTTATATAGACCAGGA 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGTTTTCCTTCTTTTGAATCGCGAGGTCCAGTTGGTCCAGAAATATATCTGGTCCT / / //// // / / // / / / HinfI Eco57MI |||| || | | || EcoRII | EcoRII TfiI GsuI |||| || | | || SexAI | BssKI |||| || | | || BssKI BseBI |||| || | | |BseBI ScrFI |||| || | | |ScrFI |||| || | | SetI |||| || | Hpy166II |||| || | HindII |||| || EcoRII |||| || BssKI |||| |BseBI |||| |ScrFI |||| SetI |||Hin6I ||Eco47III ||GlaI |HhaI MboII HaeII DdeI E S K R K K T * R S R S T R S L Y R P G N P K G R K L S A P G Q P G L Y I D Q D I Q K E E N L A L Q V N Q V F I * T R M ----:----|----:----|----:----|----:----|----:----|----:----| S D L L F F V * R E L D V L D K Y L G P Q I W F S S F K A S W T L W T K I Y V L F G F P L F S L A G P * G P R * I S W S Hin4II* |MboII ||TspDTI ||| TspDTI ||| | Csp6I ||| | |RsaI ||| | |SetI ||| | ||FatI ||| | |||CviAII TspDTI BseGI FokI ||| | |||| NlaIII |MmeI |MaeI | TspDTI ||| | |||| | CviRI* || TspDTI \\ \ \ \\\ \ \\\\ \ \ \\ \ TGAACTAGAAATAGATGAAGATGAATACAAAGAGAAGGTACATGAAATGCAAAAGTTGAT 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTGATCTTTATCTACTTCTACTTATGTTTCTCTTCCATGTACTTTACGTTTTCAACTA / / / / // // // // / // / | MaeI | FokI || || || |FatI | || TspDTI BseGI TspDTI || || || | | |MmeI || || || | | TspDTI || || || | CviRI* || || || CviAII || || |NlaIII || || |Csp6I || || RsaI || |SetI || TspDTI |TspDTI |MboII Hin4II* * T R N R * R * I Q R E G T * N A K V D E L E I D E D E Y K E K V H E M Q K L I N * K * M K M N T K R R Y M K C K S * L ----:----|----:----|----:----|----:----|----:----|----:----| H V L F L H L H I C L S P V H F A F T S I F * F Y I F I F V F L L Y M F H L L Q S S S I S S S S Y L S F T C S I C F N I MaeI | AluI | CviJI | | SetI ApoI | | | NdeI TspEI \ \ \ \ \ TGGTCTAGCTTCATATGTTGGATATAAATTTAGATTTGACTTACTATACTACATCAACAC 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGATCGAAGTATACAACCTATATTTAAATCTAAACTGAATGATATGATGTAGTTGTG /// / / ||CviJI NdeI TspEI ||AluI ApoI |MaeI SetI W S S F I C W I * I * I * L T I L H Q H G L A S Y V G Y K F R F D L L Y Y I N T V * L H M L D I N L D L T Y Y T T S T H ----:----|----:----|----:----|----:----|----:----|----:----| Q D L K M H Q I Y I * I Q S V I S C * C N T * S * I N S I F K S K V * * V V D V P R A E Y T P Y L N L N S K S Y * M L V FatI |CviAII || NlaIII || | NdeI || | |CspCI || | || TspDTI MaeI MnlI || | || |MseI \ \ \\ \ \\ \\ ACTTGCTCAACATATACTATTCCCCTCTAGGCAAGTTTTAGACATGACATATGAGTTAAT 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACGAGTTGTATATGATAAGGGGAGATCCGTTCAAAATCTGTACTGTATACTCAATTA / / / // / / / / | MnlI | || | | | MseI MaeI | || | | TspDTI | || | NdeI | || CspCI | |FatI | CviAII NlaIII T C S T Y T I P L * A S F R H D I * V N L A Q H I L F P S R Q V L D M T Y E L I L L N I Y Y S P L G K F * T * H M S * Y ----:----|----:----|----:----|----:----|----:----|----:----| V Q E V Y V I G R * A L K L C S M H T L C K S L M Y * E G R P L N * V H C I L * S A * C I S N G E L C T K S M V Y S N I TspEI | FatI | |CviAII CspCI | || NlaIII MaeI |BslFI SetI \ \\ \ \ \\ \ ACAATTCATGTGGGACACTAGAGATAAACAACTGATATGGCACAAAAACAAACCTACCGA 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTAAGTACACCCTGTGATCTCTATTTGTTGACTATACCGTGTTTTTGTTTGGATGGCT / // / / / / | |FatI | CspCI BslFI SetI | CviAII MaeI NlaIII TspEI T I H V G H * R * T T D M A Q K Q T Y R Q F M W D T R D K Q L I W H K N K P T E N S C G T L E I N N * Y G T K T N L P S ----:----|----:----|----:----|----:----|----:----|----:----| V I * T P C * L Y V V S I A C F C V * R Y L E H P V S S I F L Q Y P V F V F R G C N M H S V L S L C S I H C L F L G V S SpeI |MaeI || FalI || FalI NdeI TsoI || | SfaNI | MaeIII FalI |MaeIII CviJI || | | TspDTI | BstEII FalI |Tsp45I \ \\ \ \ \ \ \ \ \\ GCCAGATAATAAACTAGTCGCAATAAGTGATGCTTCATATGGTAACCAACCATATTACAA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCTATTATTTGATCAGCGTTATTCACTACGAAGTATACCATTGGTTGGTATAATGTT / / // // / / / / CviJI FalI |SpeI |SfaNI | | BstEII TsoI FalI MaeI TspDTI | | MaeIII | FalI | FalI NdeI A R * * T S R N K * C F I W * P T I L Q P D N K L V A I S D A S Y G N Q P Y Y K Q I I N * S Q * V M L H M V T N H I T S ----:----|----:----|----:----|----:----|----:----|----:----| A L Y Y V L R L L H H K M H Y G V M N C L W I I F * D C Y T I S * I T V L W I V G S L L S T A I L S A E Y P L W G Y * L TspDTI MnlI Hpy166II |SetI | StyI TspEI MseI |TspEI | SecI* \ \ \\ \ \ GTCACAAATTGGCAACATATATTTACTTAATGGAAAGGTAATTGGAGGAAAGTCCACCAA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGTTTAACCGTTGTATATAAATGAATTACCTTTCCATTAACCTCCTTTCAGGTGGTT / / / / / / / / | TspEI MseI | MnlI TspEI | Hpy166II Tsp45I SetI TspDTI MaeIII V T N W Q H I F T * W K G N W R K V H Q S Q I G N I Y L L N G K V I G G K S T K H K L A T Y I Y L M E R * L E E S P P R ----:----|----:----|----:----|----:----|----:----|----:----| T V F Q C C I N V * H F P L Q L F T W W L * L N A V Y I * K I S L Y N S S L G G D C I P L M Y K S L P F T I P P F D V L MseI | MslI | |FatI | |AflIII | |BspLU11I* | ||CviAII | ||| TatI | ||| |NspI | ||| |Csp6I TspGWI TfiI | ||| |NlaIII | BslFI BarI CviJI | ||| ||RsaI BarI | FnuDII* HinfI \ \ \\\ \\\ \ \ \ \ GGCTTCATTAACATGTACTTCAACTACGGAAGCAGAAATACACGCGATAAGTGAATCTGT 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAAGTAATTGTACATGAAGTTGATGCCTTCGTCTTTATGTGCGCTATTCACTTAGACA // // ///// / / / / |CviJI || ||||TatI | | BslFI HinfI SecI* || |||Csp6I | | BarI TfiI StyI || ||RsaI | FnuDII* || ||BarI TspGWI || |BspLU11I* || |AflIII || |FatI || CviAII |NlaIII |NspI MslI MseI G F I N M Y F N Y G S R N T R D K * I C A S L T C T S T T E A E I H A I S E S V L H * H V L Q L R K Q K Y T R * V N L S ----:----|----:----|----:----|----:----|----:----|----:----| P K M L M Y K L * P L L F V R S L H I Q L S * * C T S * S R F C F Y V R Y T F R A E N V H V E V V S A S I C A I L S D T HphI | DdeI | |SetI | || MaeIII | || Tsp45I | || | MnlI | || | |SetI | || | ||DraIII | || | ||| BspCNI | || | ||| |CviRI* MseI | || | ||| |BseMII MseI TspEI \ \ \\ \ \\\ \\ \ \ CCCATTATTAAATAACCTCAGTCACCTTGTGCAAGAACTTAACAAGAAACCAATTACTAA 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTAATAATTTATTGGAGTCAGTGGAACACGTTCTTGAATTGTTCTTTGGTTAATGATT / // / / / // / / / / | |SetI | | | || CviRI* MseI | Hin4I | HphI | | | |BseMII | Hin4I MseI | | | BspCNI TspEI | | Tsp45I | | MaeIII | | DraIII | | MnlI | SetI DdeI P I I K * P Q S P C A R T * Q E T N Y * P L L N N L S H L V Q E L N K K P I T K H Y * I T S V T L C K N L T R N Q L L K ----:----|----:----|----:----|----:----|----:----|----:----| G M I L Y G * D G Q A L V * C S V L * * D W * * I V E T V K H L F K V L F W N S G N N F L R L * R T C S S L L F G I V L TspEI Hin4I |Hin4I ApoI Hin4I Tsp4CI* |Hin4I Ksp632I* TspEI \ \ \\ \ \ AGGATTACTAACCGACAGTAAATCTACAATCAGTATAATTATATCCAATAATGAAGAGAA 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTAATGATTGGCTGTCATTTAGATGTTAGTCATATTAATATAGGTTATTACTTCTCTT / / / / Tsp4CI* Hin4I TspEI Ksp632I* Hin4I R I T N R Q * I Y N Q Y N Y I Q * * R E G L L T D S K S T I S I I I S N N E E K D Y * P T V N L Q S V * L Y P I M K R N ----:----|----:----|----:----|----:----|----:----|----:----| L I V L R C Y I * L * Y L * I W Y H L S F S * * G V T F R C D T Y N Y G I I F L P N S V S L L D V I L I I I D L L S S F Hin4I Hin4I BsgI MboII Csp6I |BsrDI | Hpy178III* |TspDTI |RsaI BsmAI || DdeI | | TspDTI \\ \\ \ \\ \ \ \ \ ATTTAGAAACAGATTTTTTGGTACTAAAGCAATGAGACTAAGAGATGAAGTATCAGGAAA 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATCTTTGTCTAAAAAACCATGATTTCGTTACTCTGATTCTCTACTTCATAGTCCTTT // // / / / / / / / |TspDTI |Csp6I | | BsrDI DdeI BsgI | TspDTI |MboII RsaI | BsmAI Hpy178III* TspEI Hin4I ApoI Hin4I I * K Q I F W Y * S N E T K R * S I R K F R N R F F G T K A M R L R D E V S G N L E T D F L V L K Q * D * E M K Y Q E I ----:----|----:----|----:----|----:----|----:----|----:----| I * F C I K Q Y * L L S V L L H L I L F F K S V S K K T S F C H S * S I F Y * S N L F L N K P V L A I L S L S S T D P F Hin4I Hin4I SspI CviRI* | CviRI* | MaeII | | Hin4I | |BsaAI | | | MaeII | || SetI | | | | SetI | || TaiI TaqI | | | | TaiI MboII \ \\ \ \ \ \ \ \ \ \ TCATCTGCACGTATGCTATATCGAAACCAAAAAGAATATTGCAGACGTAATGACCAAACC 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGACGTGCATACGATATAGCTTTGGTTTTTCTTATAACGTCTGCATTACTGGTTTGG / // // / // / / / / / | || |MaeII TaqI || | | | | SetI | || BsaAI || | | | MboII | |TaiI || | | MaeII | |SetI || | TaiI | CviRI* || | SetI Hin4I || CviRI* Hin4I |Hin4I SspI S S A R M L Y R N Q K E Y C R R N D Q T H L H V C Y I E T K K N I A D V M T K P I C T Y A I S K P K R I L Q T * * P N L ----:----|----:----|----:----|----:----|----:----|----:----| D D A R I S Y R F W F S Y Q L R L S W V I M Q V Y A I D F G F L I N C V Y H G F * R C T H * I S V L F F I A S T I V L G Hpy188I Ksp632I* TfiI SetI | MnlI Hin4I MseI TspDTI HinfI \ \ \ \ \ \ \ TCTTCCGATAAAAACATTCAAACTATTAACAAACAAATGGATTCATTAG 5230 5240 5250 5260 ----:----|----:----|----:----|----:----|----:---- AGAAGGCTATTTTTGTAAGTTTGATAATTGTTTGTTTACCTAAGTAATC / /// / / / | ||Hin4I | TspDTI HinfI | |Ksp632I* MseI TfiI | MnlI Hpy188I S S D K N I Q T I N K Q M D S L X L P I K T F K L L T N K W I H * F R * K H S N Y * Q T N G F I X ----:----|----:----|----:----|----:----|----:---- E E S L F M * V I L L C I S E N R K R Y F C E F * * C V F P N M L R G I F V N L S N V F L H I * * # Enzymes that cut Frequency Isoschizomers AarI 2 Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 4 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 3 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AlfI 2 AluI 10 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 18 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 13 Bce83I* 1 BpuEI BceAI 4 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 8 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 4 Bpu10I 2 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 10 Bst2UI,BstNI,BstOI,MvaI BseGI 13 BstF5I,BtsCI BseMII 12 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 12 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 3 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 10 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 13 BstXI 2 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 7 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 25 CviQI,RsaNI CspCI 1 CviAII 22 CviJI 27 CviKI-1 CviRI* 25 HpyCH4V DdeI 21 BstDEI,HpyF3I DpnI 13 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 10 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 2 FatI 22 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 13 GlaI 4 GsaI 1 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 19 Hin4II* 5 HpyAV Hin6I 4 HinP1I,HspAI HindII 7 HincII HinfI 32 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 12 AsuHPI Hpy166II 19 Hpy8I Hpy178III* 22 Hpy188III Hpy188I 20 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 13 HpyCH4IV MaeIII 13 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 20 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 9 SchI MmeI 5 MnlI 26 MseI 28 Tru1I,Tru9I MslI 7 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 4 HpyF10VI,BstMWI NdeI 3 FauNDI NlaIII 22 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 4 MspA1I NspI 6 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 9 PpsI PpiI 1 PsiI 1 AanI PstI 2 PvuII 2 RsaI 25 AfaI SalI 1 ScaI 2 BmcAI,AssI,ZrmI ScrFI 10 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 73 SexAI 1 MabI SfaNI 8 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI SphI 4 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 6 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 13 TaqI 20 TaqII 5 TatI 7 TfiI 23 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 9 NmuCI Tsp4CI* 21 HpyCH4III,TaaI,Bst4CI TspDTI 31 TspEI 47 TasI,Tsp509I,Sse9I TspGWI 13 TspRI 7 TscAI TstI 1 VspI 2 PshBI,AseI XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AcyI AloI ApaI AscI AvrII BalI BamHI BcgI BglI BmtI BplI BsaBI BsePI Bsp120I Bsp1407I BspMII* BspOI BsrBI BstAPI CauII* Cfr9I CfrI DinI DraII Eam1105I EciI Ecl136II Eco31I EcoICRI EgeI EheI EspI* FauI FseI FspAI HindIII KasI MauBI MluI MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI PacI PasI PmaCI PmeI PpuMI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769