Restriction Map of BFR2/YDR299W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BFR2/YDR299W on chromosome IV from coordinates 1059627 to 1061231.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26231

MaeI | AciI | | MboI | | | DpnI | | | |BstKTI | | | || ApoI MseI | | | || TspEI | AgeI | | | || | BinI* | BetI* | | | || | | Hpy188I | Cfr10I | | | || | | | EcoRV | |HpaII \ \ \ \\ \ \ \ \ \ \\ ATGGAAAAATCACTAGCGGATCAAATTTCCGATATCGCCATTAAACCGGTCAATAAAGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTTTAGTGATCGCCTAGTTTAAAGGCTATAGCGGTAATTTGGCCAGTTATTTCTG / /// / / / / / // | ||| MboI | | EcoRV MseI |Cfr10I | ||DpnI | Hpy188I |BetI* | |BstKTI BinI* |AgeI | AciI TspEI HpaII MaeI ApoI M E K S L A D Q I S D I A I K P V N K D W K N H * R I K F P I S P L N R S I K T G K I T S G S N F R Y R H * T G Q * R L ----:----|----:----|----:----|----:----|----:----|----:----| X S F D S A S * I E S I A M L G T L L S X P F I V L P D F K R Y R W * V P * Y L H F F * * R I L N G I D G N F R D I F V MboII | CviRI* | | EcoT22I TaqI MnlI | | | SfaNI TspDTI \ \ \ \ \ \ \ TTCGATATTGAAGATGAGGAAAATGCATCTTTATTTCAACACAATGAAAAAAATGGAGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTATAACTTCTACTCCTTTTACGTAGAAATAAAGTTGTGTTACTTTTTTTACCTCTT / / / / / / / | MnlI | | CviRI* SfaNI TspDTI TaqI | EcoT22I MboII F D I E D E E N A S L F Q H N E K N G E S I L K M R K M H L Y F N T M K K M E K R Y * R * G K C I F I S T Q * K K W R K ----:----|----:----|----:----|----:----|----:----|----:----| K S I S S S S F A D K N * C L S F F P S S R Y Q L H P F H M K I E V C H F F H L E I N F I L F I C R * K L V I F F I S F Hin4II* | MboII | | Hin6I | | |GlaI | | ||HhaI MseI | | ||| MnlI \ \ \ \\\ \ AGTGATTTAAGCGACTATGGAAATAGCAACACAGAAGAAACCAAGAAGGCGCACTATTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTAAATTCGCTGATACCTTTATCGTTGTGTCTTCTTTGGTTCTTCCGCGTGATAAAC / / / /// / MseI | | ||| MnlI | | ||Hin6I | | |GlaI | | HhaI | MboII Hin4II* S D L S D Y G N S N T E E T K K A H Y L V I * A T M E I A T Q K K P R R R T I W * F K R L W K * Q H R R N Q E G A L F G ----:----|----:----|----:----|----:----|----:----|----:----| L S K L S * P F L L V S S V L F A C * K F H N L R S H F Y C C L L F W S P A S N T I * A V I S I A V C F F G L L R V I Q BinI* | MboI | | DpnI SetI DdeI MseI SetI | | |BstKTI \ \ \ \ \ \ \\ GAGGTGGAAAAGTCTAAGTTAAGAGCAGAAAAAGGTTTAGAACTAAACGATCCAAAATAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCACCTTTTCAGATTCAATTCTCGTCTTTTTCCAAATCTTGATTTGCTAGGTTTTATA / / / / / // / SetI | MseI SetI | || MboI DdeI | |DpnI | BstKTI BinI* E V E K S K L R A E K G L E L N D P K Y R W K S L S * E Q K K V * N * T I Q N I G G K V * V K S R K R F R T K R S K I Y ----:----|----:----|----:----|----:----|----:----|----:----| S T S F D L N L A S F P K S S F S G F Y P P P F T * T L L L F L N L V L R D L I L H F L R L * S C F F T * F * V I W F I MnlI Hpy188I SetI SetI |MboII | MseI | Hpy178III* ||TspDTI \ \ \ \ \\\ ACAGGTGTTAAAGGTTCAAGACAAGCATTATATGAAGAAGTTTCCGAGAATGAGGACGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCACAATTTCCAAGTTCTGTTCGTAATATACTTCTTCAAAGGCTCTTACTCCTGCTT / // / // SetI |SetI Hpy178III* |TspDTI MseI |MboII Hpy188I MnlI T G V K G S R Q A L Y E E V S E N E D E Q V L K V Q D K H Y M K K F P R M R T K R C * R F K T S I I * R S F R E * G R R ----:----|----:----|----:----|----:----|----:----|----:----| V P T L P E L C A N Y S S T E S F S S S Y L H * L N L V L M I H L L K R S H P R C T N F T * S L C * I F F N G L I L V F Ksp632I* |MnlI ||MboII ||| MboII ||| | MboII ||| | | MboII ||| | | | MboII ||| | | | | MnlI ||| | | | | |MboII ||| | | | | ||FalI MboII ||| | | | | ||FalI | Hpy178III* ||| | | | | |||SfaNI | | TfiI ||| | | | | |||| MboII | | FalI ||| | | | | |||| | MboII | | FalI ||| | | | | |||| | |TspDTI | | HinfI \\\ \ \ \ \ \\\\ \ \\ \ \ \ GAAGAAGAAGAAGAAGAGGAAGAAGAAAAAGAGGAAGATGCTCTTTCATTCAGGACAGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTTCTTCTTCTCCTTCTTCTTTTTCTCCTTCTACGAGAAAGTAAGTCCTGTCTA // // / / / // // / / / / || || | | | |MboII || TspDTI MboII | AlwNI || || | | | MnlI || MboII Hpy178III* || || | | MboII |SfaNI FalI || || | | FalI MboII FalI || || | | FalI || || | MboII || || MboII || |MboII || Ksp632I* |MboII MnlI E E E E E E E E E K E E D A L S F R T D K K K K K R K K K K R K M L F H S G Q I R R R R R G R R K R G R C S F I Q D R F ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S S S S F S S S A R E N L V S L L L L L L P L L F L P L H E K M * S L F F F F F L F F F F L F I S K * E P C I TfiI HinfI | Hpy188I | |MboII | ||TspDTI | ||| AciI | ||| MboII | ||| FnuDII* MboII | ||| | HgaI |TspDTI | ||| | |AciI AlwNI |Eco57I | ||| | || MnlI | Hpy188I MboII |Eco57MI | ||| | || | MnlI \ \ \ \\ \ \\\ \ \\ \ \ TCTGAAGATGAAGAAGTAGAGATTGATGAAGAAGAATCAGACGCGGACGGCGGTGAAACG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTCTACTTCTTCATCTCTAACTACTTCTTCTTAGTCTGCGCCTGCCGCCACTTTGC // / / /// // / /// / |Hpy188I MboII Eco57MI ||| || AciI ||| MnlI HinfI Eco57I ||| |FnuDII* ||HgaI TfiI TspDTI ||| MboII |MnlI MboII ||TspDTI AciI ||MboII |Hpy188I HinfI TfiI S E D E E V E I D E E E S D A D G G E T L K M K K * R L M K K N Q T R T A V K R * R * R S R D * * R R I R R G R R * N G ----:----|----:----|----:----|----:----|----:----|----:----| E S S S S T S I S S S S D S A S P P S V N Q L H L L L S Q H L L I L R P R R H F R F I F F Y L N I F F F * V R V A T F R TspGWI | BseRI | | FatI | | |CviAII | | ||Cac8I | | ||| SphI | | ||| NspI BceAI | | ||| CviRI* |HphI | | ||| NlaIII TspEI || CviJI | | ||| | TaqI | BsmAI \\ \ \ \ \\\ \ \ \ \ GAGGAGGCTCAACAGAAAAGGCATGCACTATCGAAACTAATTCAACAAGAGACTAAACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCCGAGTTGTCTTTTCCGTACGTGATAGCTTTGATTAAGTTGTTCTCTGATTTGTT / / / / / / /// / / / / | | | | BseRI | ||CviRI* TaqI | BsmAI SetI | | | TspGWI | ||FatI TspEI | | CviJI | |CviAII | BceAI | Cac8I HphI NlaIII NspI SphI E E A Q Q K R H A L S K L I Q Q E T K Q R R L N R K G M H Y R N * F N K R L N K G G S T E K A C T I E T N S T R D * T S ----:----|----:----|----:----|----:----|----:----|----:----| S S A * C F L C A S D F S I * C S V L C P P P E V S F A H V I S V L E V L S * V L L S L L F P M C * R F * N L L L S F L Tsp4CI* AluI | BsmAI CviJI | |FalI Hin4II* | SetI | |FalI | TaqI FalI | | MseI | || SfaNI | AsuII FalI \ \ \ \ \\ \ \ \ \ GCTATTAACAAACTGTCTCAATCAGTTCAAAGAGATGCTTCGAAGGGTTATTCCATTTTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAATTGTTTGACAGAGTTAGTCAAGTTTCTCTACGAAGCTTCCCAATAAGGTAAAAT / / / / / / / / / CviJI MseI | FalI | SfaNI | AsuII FalI AluI | FalI BsmAI | TaqI FalI Tsp4CI* Hin4II* A I N K L S Q S V Q R D A S K G Y S I L L L T N C L N Q F K E M L R R V I P F Y Y * Q T V S I S S K R C F E G L F H F T ----:----|----:----|----:----|----:----|----:----|----:----| A I L L S D * D T * L S A E F P * E M K L * * C V T E I L E F L H K S P N N W K S N V F Q R L * N L S I S R L T I G N * AluI CviJI | SetI TspEI | | TspEI \ \ \ \ CAACAGACAAAATTATTTGACAACATCATTGATTTGAGAATAAAACTACAAAAAGCTGTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCTGTTTTAATAAACTGTTGTAGTAACTAAACTCTTATTTTGATGTTTTTCGACAT / / / / TspEI | | MwoI | CviJI | AluI SetI Q Q T K L F D N I I D L R I K L Q K A V N R Q N Y L T T S L I * E * N Y K K L * T D K I I * Q H H * F E N K T T K S C N ----:----|----:----|----:----|----:----|----:----|----:----| C C V F N N S L M M S K L I F S C F A T V V S L I I Q C C * Q N S F L V V F L Q L L C F * K V V D N I Q S Y F * L F S Y MseI | SfeI* | | HinfI | | | BssKI | | | EcoRII | | | |SecI* | | | |Ksp632I* MwoI | | | ||MnlI MboII | TseI AluI | | | ||ScrFI | MnlI | CviRI* CviJI | | | ||BseBI | |TfiI | |BisI |BbvI | | | ||| PleI | |HinfI | ||BlsI ||SetI | | | ||| |MlyI CviJI | || BseGI \ \\\ \\\ \ \ \ \\\ \\ \ \ \\ \ ATTGCAGCAAATAAGCTCCCATTAACTACAGAGTCCTGGGAAGAGGCTAAAATGGATGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGTCGTTTATTCGAGGGTAATTGATGTCTCAGGACCCTTCTCCGATTTTACCTACTA ///// / / / / / // //// / / / / ||||TseI | | | MseI | || |||PleI | | | BseGI |||BisI | | BbvI | || |||MlyI | | MnlI ||BlsI | CviJI | || ||EcoRII | MboII |CviRI* | AluI | || ||BssKI CviJI TspEI SetI | || ||SecI* | || |Ksp632I* | || BseBI | || ScrFI | |MnlI | HinfI SfeI* I A A N K L P L T T E S W E E A K M D D L Q Q I S S H * L Q S P G K R L K W M I C S K * A P I N Y R V L G R G * N G * F ----:----|----:----|----:----|----:----|----:----|----:----| I A A F L S G N V V S D Q S S A L I S S L Q L L Y A G M L * L T R P L P * F P H N C C I L E W * S C L G P F L S F H I I Tsp4CI* | Eco57I Hpy188I | Eco57MI BdaI | FokI Hin4II* | | TspEI BdaI \ \ \ \ \ \ \ TCAGAGGAAACAAAGCGTTTGCTGAAGGAAAACGAAAAACTGTTCAATAATTTATTCAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCTCCTTTGTTTCGCAAACGACTTCCTTTTGCTTTTTGACAAGTTATTAAATAAGTTA // / / // / |Hpy188I FokI Hin4II* |Eco57MI TspEI HinfI |Eco57I BdaI TfiI Tsp4CI* BdaI S E E T K R L L K E N E K L F N N L F N Q R K Q S V C * R K T K N C S I I Y S I R G N K A F A E G K R K T V Q * F I Q S ----:----|----:----|----:----|----:----|----:----|----:----| E S S V F R K S F S F S F S N L L K N L N L P F L A N A S P F R F V T * Y N I * * L F C L T Q Q L F V F F Q E I I * E I Hpy188I MboI Ksp632I* ApoI | ApoI BdaI | DpnI |MnlI TspEI | TspEI BdaI | |BstKTI |MmeI \ \ \ \ \ \\ \\ CGGTTGATAAATTTCAGAATAAAATTCCAACTTGGCGATCATATCACTCAAAATGAAGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCCAACTATTTAAAGTCTTATTTTAAGGTTGAACCGCTAGTATAGTGAGTTTTACTTCTC / / / // / // / / | Hpy188I TspEI || MboI || | SetI TspEI BdaI |DpnI || Ksp632I* ApoI BdaI BstKTI |MnlI ApoI MmeI R L I N F R I K F Q L G D H I T Q N E E G * * I S E * N S N L A I I S L K M K R V D K F Q N K I P T W R S Y H S K * R G ----:----|----:----|----:----|----:----|----:----|----:----| R N I F K L I F N W S P S * I V * F S S D T S L N * F L I G V Q R D Y * E F H L P Q Y I E S Y F E L K A I M D S L I F L MboI BglII MboII XhoII AluI |TspDTI | DpnI CviJI SetI || TspEI | |BstKTI | SetI \ \\ \ \ \\ \ \ GTGGCGAAGCATAAATTGTCCAAAAAAAGATCTCTCAAAGAGCTTTACCAAGAAACTAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGCTTCGTATTTAACAGGTTTTTTTCTAGAGAGTTTCTCGAAATGGTTCTTTGATTA / / // / / / / TspDTI TspEI || XhoII | CviJI SetI MboII || BglII | AluI || MboI SetI |DpnI BstKTI V A K H K L S K K R S L K E L Y Q E T N W R S I N C P K K D L S K S F T K K L I G E A * I V Q K K I S Q R A L P R N * * ----:----|----:----|----:----|----:----|----:----|----:----| T A F C L N D L F L D R L S S * W S V L P P S A Y I T W F F I E * L A K G L F * H R L M F Q G F F S R E F L K V L F S I MlyI PleI |AluI |CviJI ||DdeI |||SetI |||| HinfI |||| | DdeI |||| | | Hpy188I |||| | | | BceAI |||| | | | | BspCNI |||| | | | | |TatI |||| | | | | |BseMII AccI |||| | | | | ||Csp6I |Hpy166II |||| | | | | |||RsaI MseI || MboII \\\\ \ \ \ \ \\\\ \ \\ \ AGCTTAGACTCAGAACTAAAAGAGTACAGGACTGCCGTATTAAACAAGTGGTCTACCAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAATCTGAGTCTTGATTTTCTCATGTCCTGACGGCATAATTTGTTCACCAGATGGTTT // / /// // /// / /// || | ||DdeI || ||TatI MseI ||MboII || | |Hpy188I || |Csp6I |AccI || | HinfI || RsaI Hpy166II || DdeI |BseMII |CviJI |BceAI |AluI BspCNI |PleI MlyI S L D S E L K E Y R T A V L N K W S T K A * T Q N * K S T G L P Y * T S G L P K L R L R T K R V Q D C R I K Q V V Y Q S ----:----|----:----|----:----|----:----|----:----|----:----| L K S E S S F S Y L V A T N F L H D V L Y S L S L V L L T C S Q R I L C T T * W A * V * F * F L V P S G Y * V L P R G F BbvI |CviRI* || MaeIII || | SetI || | |SfaNI || | || TseI AluI || | || |BisI ApoI CviJI || | || ||BlsI TspEI | SetI \\ \ \\ \\\ \ \ \ GTTTCTTCTGCATCAGGTAACGCTGCTTTATCATCTAACAAATTCAAAGCTATCAACTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGAAGACGTAGTCCATTGCGACGAAATAGTAGATTGTTTAAGTTTCGATAGTTGAAT / // / /// / / / / | |SetI | ||TseI | | CviJI SetI | BbvI | |BisI | | AluI CviRI* | SfaNI | SetI | BlsI TspEI MaeIII ApoI V S S A S G N A A L S S N K F K A I N L F L L H Q V T L L Y H L T N S K L S T Y F F C I R * R C F I I * Q I Q S Y Q L T ----:----|----:----|----:----|----:----|----:----|----:----| T E E A D P L A A K D D L L N L A I L K L K K Q M L Y R Q K I M * C I * L * * S N R R C * T V S S * * R V F E F S D V * SfeI* |SetI ||CviRI* ||| PstI ||| | TatI ||| | BspMI ||| | Bsp1407I ||| | |Csp6I BslFI ||| | ||RsaI TaqI |TspEI Hpy188I \\\ \ \\\ \ \\ \ CCTGCAGATGTACAAGTCGAAAACCAATTATCCGATATGTCCCGTTTGATGAAAAGAACA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGTCTACATGTTCAGCTTTTGGTTAATAGGCTATACAGGGCAAACTACTTTTCTTGT / / / /// / // / | | | ||| TaqI || Hpy188I | | | ||Bsp1407I |TspEI | | | ||BspMI BslFI | | | ||TatI | | | |Csp6I | | | RsaI | | SfeI* | CviRI* PstI P A D V Q V E N Q L S D M S R L M K R T L Q M Y K S K T N Y P I C P V * * K E Q C R C T S R K P I I R Y V P F D E K N K ----:----|----:----|----:----|----:----|----:----|----:----| G A S T C T S F W N D S I D R K I F L V V Q L H V L R F G I I R Y T G N S S F F R C I Y L D F V L * G I H G T Q H F S C Cac8I TspDTI Tsp4CI* | CviJI \ \ \ \ AAGTTGAACAGGAGAAACATAACGCCTTTGTATTTCCAAAAAGACTGTGCTAATGGCAGG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAACTTGTCCTCTTTGTATTGCGGAAACATAAAGGTTTTTCTGACACGATTACCGTCC / / / / TspDTI Tsp4CI* | CviJI Cac8I K L N R R N I T P L Y F Q K D C A N G R S * T G E T * R L C I S K K T V L M A G V E Q E K H N A F V F P K R L C * W Q A ----:----|----:----|----:----|----:----|----:----|----:----| F N F L L F M V G K Y K W F S Q A L P L L T S C S F C L A K T N G F L S H * H C L Q V P S V Y R R Q I E L F V T S I A P ApoI TspEI EcoRI | BccI TspEI | | Hpy188I \ \ \ \ CTACCAGAATTGATTTCTCCCGTTGTCAAAGATAGTGTTGATGACAATGAGAATTCGGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGTCTTAACTAAAGAGGGCAACAGTTTCTATCACAACTACTGTTACTCTTAAGCCTA / // TspEI |Hpy188I |BccI EcoRI TspEI ApoI L P E L I S P V V K D S V D D N E N S D Y Q N * F L P L S K I V L M T M R I R M T R I D F S R C Q R * C * * Q * E F G * ----:----|----:----|----:----|----:----|----:----|----:----| S G S N I E G T T L S L T S S L S F E S A V L I S K E R Q * L Y H Q H C H S N P * W F Q N R G N D F I T N I V I L I R I BseGI | CviJI | | FokI | | | EcoRV | | | | Hpy178III* MboII \ \ \ \ \ \ GATGGGCTTGATATCCCGAAAAACTATGACCCAAGAAGAAAGGATAACAATGCCATTGAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCCGAACTATAGGGCTTTTTGATACTGGGTTCTTCTTTCCTATTGTTACGGTAACTG / / / / / / | CviJI | | Hpy178III* MboII BseGI | FokI EcoRV D G L D I P K N Y D P R R K D N N A I D M G L I S R K T M T Q E E R I T M P L T W A * Y P E K L * P K K K G * Q C H * H ----:----|----:----|----:----|----:----|----:----|----:----| S P S S I G F F * S G L L F S L L A M S H H A Q Y G S F S H G L F F P Y C H W Q I P K I D R F V I V W S S L I V I G N V MboII NdeI Tsp4CI* \ \ ATTACCGAAAACCCATATGTTTTTGATGACGAAGATTTTTACCGTGTTTTACTAAACGAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGGCTTTTGGGTATACAAAAACTACTGCTTCTAAAAATGGCACAAAATGATTTGCTA / / NdeI Tsp4CI* MboII I T E N P Y V F D D E D F Y R V L L N D L P K T H M F L M T K I F T V F Y * T I Y R K P I C F * * R R F L P C F T K R F ----:----|----:----|----:----|----:----|----:----|----:----| M V S F G Y T K S S S S K * R T K S F S C * R F G M H K Q H R L N K G H K V L R N G F V W I N K I V F I K V T N * * V I Hpy188I | TseI | CviRI* | |BisI | |MmeI | ||BlsI MseI | ||| TspEI |TspEI TspEI | ||| |HphI BbvI \\ \ \ \\\ \\ \ TTAATTGACAAAAAGATTTCCAACGCTCACAATTCTGAAAGTGCAGCAATTACAATCACC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAACTGTTTTTCTAAAGGTTGCGAGTGTTAAGACTTTCACGTCGTTAATGTTAGTGG / / // ////// / / // | TspEI || |||||| TspEI | |BsgI MseI || |||||HphI | BbvI || ||||TseI SetI || |||BisI || ||BlsI || |CviRI* || MmeI |Hpy188I TspEI L I D K K I S N A H N S E S A A I T I T * L T K R F P T L T I L K V Q Q L Q S P N * Q K D F Q R S Q F * K C S N Y N H L ----:----|----:----|----:----|----:----|----:----|----:----| K I S L F I E L A * L E S L A A I V I V N L Q C F S K W R E C N Q F H L L * L * * N V F L N G V S V I R F T C C N C D G TaqI AluI ClaI CviJI SetI TaqI CviJI | MboII | StyI |BsgI MnlI AsuII | SetI | | DdeI | SecI* \\ \ \ \ \ \ \ \ \ \ TCAACTAATGCTCGTTCGAACAACAAGCTAAAGAAGAATATCGATACTAAGGCTTCCAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGATTACGAGCAAGCTTGTTGTTCGATTTCTTCTTATAGCTATGATTCCGAAGGTTC / / / / // / / // MnlI AsuII | CviJI |MboII | CviJI |SecI* TaqI | AluI ClaI DdeI |StyI SetI TaqI BsiYI* S T N A R S N N K L K K N I D T K A S K Q L M L V R T T S * R R I S I L R L P R N * C S F E Q Q A K E E Y R Y * G F Q G ----:----|----:----|----:----|----:----|----:----|----:----| E V L A R E F L L S F F F I S V L A E L R L * H E N S C C A L S S Y R Y * P K W * S I S T R V V L * L L I D I S L S G L DdeI | BinI* | | Hpy178III* | | | MboI | | | XhoII | | | | DpnI | | | | |BstKTI | | | | ||BspCNI | | | | |||MfeI BciVI BsiYI* | | | | |||TspEI FokI BseGI | TspEI | | | | |||BseMII TspEI | CviJI |TspDTI \ \ \ \ \ \ \\\\ \ \ \ \\ GGTAGGAAATTGAACTACTCAGTTCAAGATCCAATTGCGAATTATGAAGCCCCCATCACA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCCTTTAACTTGATGAGTCAAGTTCTAGGTTAACGCTTAATACTTCGGGGGTAGTGT / / / ///// / / / // TspEI | | ||||| TspEI TspEI CviJI |TspDTI | | ||||| MfeI FokI |BciVI | | ||||XhoII BseGI | | ||||MboI | | |||BseMII | | ||BspCNI | | ||DpnI | | |BstKTI | | Hpy178III* | BinI* DdeI G R K L N Y S V Q D P I A N Y E A P I T V G N * T T Q F K I Q L R I M K P P S H * E I E L L S S R S N C E L * S P H H I ----:----|----:----|----:----|----:----|----:----|----:----| P L F N F * E T * S G I A F * S A G M V P Y S I S S S L E L D L Q S N H L G W * T P F Q V V * N L I W N R I I F G G D C BccI BetI* ApoI BspMII* TspEI SetI |HpaII TaqI EcoRI AciI |HindII |Hpy178III* Hpy188I ClaI | FauI | TspDTI |Hpy166II \\ \ \ \ \ \ \ \\ TCCGGATACAAATGGTCAGACGACCAAATCGATGAATTCTTTGCGGGATTGTTAGGTCAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCTATGTTTACCAGTCTGCTGGTTTAGCTACTTAAGAAACGCCCTAACAATCCAGTT / // / / / / / / | |BspMII* Hpy188I ClaI EcoRI TspDTI SetI Hpy166II | |BetI* TaqI TspEI AciI HindII | Hpy178III* ApoI | HpaII FauI BccI S G Y K W S D D Q I D E F F A G L L G Q P D T N G Q T T K S M N S L R D C * V N R I Q M V R R P N R * I L C G I V R S T ----:----|----:----|----:----|----:----|----:----|----:----| D P Y L H D S S W I S S N K A P N N P * M R I C I T L R G F R H I R Q P I T L D G S V F P * V V L D I F E K R S Q * T L FatI |FokI Hpy166II |CviAII | MseI TspDTI || NspI | | MnlI MnlI |BseGI || NlaIII MnlI \ \ \ \ \\ \\ \ \ CGAGTGAACTTTAATGAAAATGAGGATGAGGAACAACATGCCAGAATAGAAAATGACGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCACTTGAAATTACTTTTACTCCTACTCCTTGTTGTACGGTCTTATCTTTTACTGCTT / // / // / /// / | |MnlI MnlI |BseGI | ||FokI MnlI | MseI TspDTI | |FatI Hpy166II | CviAII NlaIII NspI R V N F N E N E D E E Q H A R I E N D E E * T L M K M R M R N N M P E * K M T K S E L * * K * G * G T T C Q N R K * R R ----:----|----:----|----:----|----:----|----:----|----:----| R T F K L S F S S S S C C A L I S F S S V L S S * H F H P H P V V H W F L F H R S H V K I F I L I L F L M G S Y F I V F CviJI MboII TspEI | MseI EcoRV BstXI \ \ \ \ \ GAATTAGAGGCTGTTAAAAACGATGATATCCAAATCTTTGGTTGA 1570 1580 1590 1600 ----:----|----:----|----:----|----:----|----: CTTAATCTCCGACAATTTTTGCTACTATAGGTTTAGAAACCAACT / // / / / | |CviJI MseI EcoRV BstXI | MboII TspEI E L E A V K N D D I Q I F G * N * R L L K T M I S K S L V X I R G C * K R * Y P N L W L X ----:----|----:----|----:----|----:----|----: S N S A T L F S S I W I K P Q L I L P Q * F R H Y G F R Q N F * L S N F V I I D L D K T S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 7 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 3 BseXI,BstV1I,Lsp1109I BccI 2 BceAI 2 BciVI 1 BfuI BdaI 2 BetI* 2 BsaWI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BseRI 1 BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BssKI 1 BstSCI,StyD4I BstKTI 5 BstXI 1 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 14 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 5 MalI Eco57I 2 AcuI Eco57MI 2 EcoRI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 3 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 4 FatI 2 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 1 HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 5 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 11 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeIII 1 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 23 MfeI 1 MunI MlyI 2 SchI MmeI 2 MnlI 14 MseI 10 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NspI 2 BstNSI,XceI PleI 2 PpsI PstI 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 16 SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 7 TatI 2 TfiI 3 PfeI TseI 3 ApeKI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 20 TasI,Tsp509I,Sse9I TspGWI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BclI BfiI BglI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BseYI BsiI* BsmI Bsp120I BspHI BspLU11I* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EgeI EheI Esp3I EspI* FseI FspAI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* Hin4I HindIII HpaI Hpy99I KasI KpnI MaeII MauBI McrI* MluI MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NlaIV NmeAIII NotI NruI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaiI TaqII TauI TsoI Tsp45I TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769