Restriction Map of PHM6/YDR281C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHM6/YDR281C on chromosome IV from coordinates 1022321 to 1022007.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26126

EMBOSS_001 MnlI | AvaI | XhoI | SmlI | AbsI | PspXI | |TaqI | |SetI | |BmeT110I | || MboII | || | SetI | || | |CviRI* SfaNI | || | ||MnlI |TatI | || | ||| TaqI ||Csp6I | || | ||| ClaI |||RsaI Hin4II* \ \\ \ \\\ \ \\\\ \ ATGGAAGATACCTCGAGGTGCATCGATGATGTACTGAAAATAGGACAACAGGAGAAGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCTATGGAGCTCCACGTAGCTACTACATGACTTTTATCCTGTTGTCCTCTTCCTT / / // / / /// / | SetI || | ClaI ||TatI Hin4II* MnlI || | TaqI |SfaNI || CviRI* |Csp6I || MnlI RsaI |PspXI |AbsI |SmlI |XhoI |AvaI BmeT110I MboII TaqI SetI M E D T S R C I D D V L K I G Q Q E K E W K I P R G A S M M Y * K * D N R R R K G R Y L E V H R * C T E N R T T G E G N ----:----|----:----|----:----|----:----|----:----|----:----| X S S V E L H M S S T S F I P C C S F S X P L Y R S T C R H H V S F L V V P S P H F I G R P A D I I Y Q F Y S L L L L F HgaI | MnlI | |TstI | |BsaXI MseI Hpy188I | || MnlI SetI BseRI \ \ \\ \ \ \ ATAAGACAGGCAGAGTTTTCTGACGCACAAGGGGAGAGAGAGGAGGTTAAGTGTATTGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCTGTCCGTCTCAAAAGACTGCGTGTTCCCCTCTCTCTCCTCCAATTCACATAACTA / / // // / / / Hpy188I | || |HgaI SetI | BseRI | || MnlI MseI | |MnlI | BsaXI TstI I R Q A E F S D A Q G E R E E V K C I D * D R Q S F L T H K G R E R R L S V L I K T G R V F * R T R G E R G G * V Y * L ----:----|----:----|----:----|----:----|----:----|----:----| I L C A S N E S A C P S L S S T L H I S F L V P L T K Q R V L P S L P P * T Y Q Y S L C L K R V C L P L S L L N L T N I SetI BsaXI | AciI | TstI | | Hin6I | Tsp4CI* | | FnuDII* | | FalI | | |GlaI XcmI | | FalI MboII | | ||HhaI FalI | | | BspMI BbvII* | | ||| BsiI* FalI \ \ \ \ \ \ \ \\\ \ \ TACACAGTAGATTTGGAAGCAGGTCTTCCGCGCCACGAGAGTAGTGGAAAAAGTAATACC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTGTCATCTAAACCTTCGTCCAGAAGGCGCGGTGCTCTCATCACCTTTTTCATTATGG / / / // / /// / // | | Tsp4CI* || BbvII* ||| | |XcmI | FalI || SetI ||| | BsiI* | FalI |MboII ||| FalI BsaXI BspMI ||| FalI TstI ||Hin6I |GlaI FnuDII* AciI HhaI Y T V D L E A G L P R H E S S G K S N T T Q * I W K Q V F R A T R V V E K V I P H S R F G S R S S A P R E * W K K * Y P ----:----|----:----|----:----|----:----|----:----|----:----| * V T S K S A P R G R W S L L P F L L V N C L L N P L L D E A G R S Y H F F Y Y V C Y I Q F C T K R A V L T T S F T I G MaeI |BsiYI* || MnlI || | AvaI BceAI || | XhoI | Tsp4CI* || | SmlI | | MnlI || | Hpy178III* | | | TspRI || | |TaqI | | | |PsiI || | |BmeT110I \ \ \ \\ \\ \ \\ CTCAAACAGTGTTATAACGCCGTTCTAGGGTTTCTCGAGGAACTCATCATCGTCATTATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTTGTCACAATATTGCGGCAAGATCCCAAAGAGCTCCTTGAGTAGTAGCAGTAATAA / // / / / / / /// | || MnlI PsiI | | MnlI ||SmlI | |Tsp4CI* | MaeI ||XhoI | BceAI BsiYI* ||AvaI TspRI |BmeT110I |TaqI Hpy178III* L K Q C Y N A V L G F L E E L I I V I I S N S V I T P F * G F S R N S S S S L L Q T V L * R R S R V S R G T H H R H Y Y ----:----|----:----|----:----|----:----|----:----|----:----| R L C H * L A T R P N R S S S M M T M I G * V T N Y R R E L T E R P V * * R * * E F L T I V G N * P K E L F E D D D N N TatI Bsp1407I |Csp6I ||RsaI ||| Tsp4CI* SetI \\\ \ \ ATTGTGTTGCTGTTGTACAGTTTGACAATGGTAGGTCTTTTTTATGTGATGACGATGACG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACAACGACAACATGTCAAACTGTTACCATCCAGAAAAAATACACTACTGCTACTGC /// / ||Bsp1407I SetI ||Tsp4CI* ||TatI |Csp6I RsaI I V L L L Y S L T M V G L F Y V M T M T L C C C C T V * Q W * V F F M * * R * R C V A V V Q F D N G R S F L C D D D D E ----:----|----:----|----:----|----:----|----:----|----:----| I T N S N Y L K V I T P R K * T I V I V * Q T A T T C N S L P L D K K H S S S S N H Q Q Q V T Q C H Y T K K I H H R H R MseI \ AAGTTTTTGTTTTAA 310 ----:----|----: TTCAAAAACAAAATT / MseI K F L F * S F C F X V F V L X ----:----|----: F N K N * S T K T K L K Q K L # Enzymes that cut Frequency Isoschizomers AbsI 1 AciI 1 BspACI,SsiI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BceAI 1 BmeT110I 2 BsaXI 1 BseRI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI Bsp1407I 1 BsrGI,BstAUI BspMI 1 BfuAI,Acc36I,BveI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviRI* 1 HpyCH4V FalI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 1 HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI Hpy178III* 1 Hpy188III Hpy188I 1 MaeI 1 FspBI,BfaI,XspI MboII 2 MnlI 6 MseI 2 Tru1I,Tru9I PsiI 1 AanI PspXI 1 RsaI 2 AfaI SetI 5 SfaNI 1 LweI SmlI 2 SmoI TaqI 3 TatI 2 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspRI 1 TscAI TstI 1 XcmI 1 XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BseBI BseGI BseMII BsePI BseSI BseYI BsgI BslFI BsmAI BsmFI BsmI Bsp120I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI CspCI CviAII CviJI DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FatI FauI Fnu4HI FokI FseI FspAI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* Hin4I HindII HindIII HinfI HpaI HpaII HphI Hpy166II Hpy8I Hpy99I KasI KpnI Ksp632I* MaeII MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqII TauI TfiI TseI TsoI Tsp45I TspDTI TspEI TspGWI TspMI Tth111I VspI XbaI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769