Restriction Map of CTA1/YDR256C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CTA1/YDR256C on chromosome IV from coordinates 969680 to 968133.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26586

EMBOSS_001 TspDTI TaqI |Hpy188I | TspEI BslFI TspEI || MnlI \ \ \ \ \\ \ ATGTCGAAATTGGGACAAGAAAAAAATGAAGTAAATTACTCTGATGTAAGAGAGGATAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCTTTAACCCTGTTCTTTTTTTACTTCATTTAATGAGACTACATTCTCTCCTATCT / / / / / / / TaqI TspEI BslFI | | | MnlI | | Hpy188I | TspDTI TspEI M S K L G Q E K N E V N Y S D V R E D R C R N W D K K K M K * I T L M * E R I E V E I G T R K K * S K L L * C K R G * S ----:----|----:----|----:----|----:----|----:----|----:----| X D F N P C S F F S T F * E S T L S S L X T S I P V L F F H L L N S Q H L L P Y H R F Q S L F F I F Y I V R I Y S L I S HphI | TstI | | MaeIII | | Tsp45I | | | TspDTI | | | | MaeII MaeIII | | | | | SetI Tsp45I BsrI | | | | | TaiI | TstI TspRI | | | | | |BstXI \ \ \ \ \ \ \ \ \\ GTTGTGACAAACTCCACTGGTAATCCAATCAATGAACCATTTGTCACCCAACGTATTGGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACACTGTTTGAGGTGACCATTAGGTTAGTTACTTGGTAAACAGTGGGTTGCATAACCC / / / / / / / / // / / TstI | TspRI BsrI | HphI | | || MaeII TaqII Tsp45I TstI | | |BstXI MaeIII | | TaiI | | SetI | Tsp45I | MaeIII TspDTI V V T N S T G N P I N E P F V T Q R I G L * Q T P L V I Q S M N H L S P N V L G C D K L H W * S N Q * T I C H P T Y W G ----:----|----:----|----:----|----:----|----:----|----:----| T T V F E V P L G I L S G N T V W R I P L Q S L S W Q Y D L * H V M Q * G V Y Q N H C V G S T I W D I F W K D G L T N P TaqII | FatI | |CviAII | || AsuI* | || NlaIII MseI | || |CviJI |TspEI | || |HaeIII || TfiI | || |BmgT120I CviRI* PsiI || HinfI CviJI \ \\ \\ \ \ \\ \ \ GAACATGGCCCTTTGCTTTTGCAAGATTATAACTTAATTGATTCTTTGGCTCATTTCAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTACCGGGAAACGAAAACGTTCTAATATTGAATTAACTAAGAAACCGAGTAAAGTTG / ///// / / / / / / | ||||AsuI* CviRI* PsiI | | HinfI CviJI | |||BmgT120I | | TfiI | ||HaeIII | TspEI | ||CviJI MseI | |FatI | CviAII NlaIII E H G P L L L Q D Y N L I D S L A H F N N M A L C F C K I I T * L I L W L I S T T W P F A F A R L * L N * F F G S F Q Q ----:----|----:----|----:----|----:----|----:----|----:----| S C P G K S K C S * L K I S E K A * K L P V H G K A K A L N Y S L Q N K P E N * F M A R Q K Q L I I V * N I R Q S M E V TfiI HinfI | MnlI | | FatI | | |CviAII | | || NspI | | || NlaIII | | || |MslI | | || ||FatI | | || |||CviAII | | || |||| NlaIII XmnI | | || |||| | HgiCI* CviJI |SspI | | || |||| | | NlaIV | Hin4II* \\ \ \ \\ \\\\ \ \ \ \ \ AGGGAAAATATTCCTCAAAGGAATCCACATGCTCATGGTTCTGGTGCCTTCGGCTATTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTTTTATAAGGAGTTTCCTTAGGTGTACGAGTACCAAGACCACGGAAGCCGATAAAA // / / / //// // / / / / |SspI | | | |||| |FatI | | | Hin4II* XmnI | | | |||| CviAII | | CviJI | | | |||NlaIII | HgiCI* | | | ||MslI NlaIV | | | |FatI | | | CviAII | | NlaIII | | NspI | HinfI | TfiI MnlI R E N I P Q R N P H A H G S G A F G Y F G K I F L K G I H M L M V L V P S A I L G K Y S S K E S T C S W F W C L R L F * ----:----|----:----|----:----|----:----|----:----|----:----| L S F I G * L F G C A * P E P A K P * K C P F Y E E F S D V H E H N Q H R R S N P F I N R L P I W M S M T R T G E A I K FauI | EcoRV MaeIII | | AciI TspEI \ \ \ \ \ GAAGTAACCGATGACATTACTGATATCTGCGGGTCTGCTATGTTTAGTAAAATTGGGAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCATTGGCTACTGTAATGACTATAGACGCCCAGACGATACAAATCATTTTAACCCTTT / / / / MaeIII EcoRV AciI TspEI FauI E V T D D I T D I C G S A M F S K I G K K * P M T L L I S A G L L C L V K L G K S N R * H Y * Y L R V C Y V * * N W E K ----:----|----:----|----:----|----:----|----:----|----:----| S T V S S M V S I Q P D A I N L L I P F Q L L R H C * Q Y R R T Q * T * Y F Q S F Y G I V N S I D A P R S H K T F N P F TaqII SetI | TaqI Tsp4CI* |HphI Tsp4CI* \ \ \ \\ \ AGAACGAAATGTCTAACAAGATTTTCGACTGTGGGTGGTGATAAAGGTAGTGCCGACACG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGCTTTACAGATTGTTCTAAAAGCTGACACCCACCACTATTTCCATCACGGCTGTGC / / / / / / TaqII | Tsp4CI* | HphI Tsp4CI* TaqI SetI R T K C L T R F S T V G G D K G S A D T E R N V * Q D F R L W V V I K V V P T R N E M S N K I F D C G W * * R * C R H G ----:----|----:----|----:----|----:----|----:----|----:----| L V F H R V L N E V T P P S L P L A S V F F S I D L L I K S Q P H H Y L Y H R C S R F T * C S K R S H T T I F T T G V R BinI* | Hpy178III* | | MboI | | | DpnI | | | |BstKTI SetI | | | ||StyI ApoI Hin4II* TspEI Eco57I | | | ||SecI* TspEI | TspRI | MboII Eco57MI \ \ \ \\\ \ \ \ \ \ \ GTTCGTGATCCAAGGGGGTTTGCCACCAAATTCTACACTGAAGAAGGTAATTTAGATTGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGCACTAGGTTCCCCCAAACGGTGGTTTAAGATGTGACTTCTTCCATTAAATCTAACC / /// / / // / / // / | ||| | SecI* || Hin4II* SetI || Eco57MI | ||| | StyI |TspRI || Eco57I | ||| MboI TspEI |TspEI | ||DpnI ApoI MboII | |BstKTI | Hpy178III* BinI* V R D P R G F A T K F Y T E E G N L D W F V I Q G G L P P N S T L K K V I * I G S * S K G V C H Q I L H * R R * F R L G ----:----|----:----|----:----|----:----|----:----|----:----| T R S G L P N A V L N * V S S P L K S Q P E H D L P T Q W W I R C Q L L Y N L N N T I W P P K G G F E V S F F T I * I P AgeI BetI* BsmAI AccI Cfr10I Eco31I |Hpy166II |HpaII | Hpy188I Hin4II* MnlI \\ \\ \ \ \ \ GTCTACAATAATACACCGGTATTCTTTATCAGAGACCCTTCCAAGTTCCCTCACTTTATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAGATGTTATTATGTGGCCATAAGAAATAGTCTCTGGGAAGGTTCAAGGGAGTGAAATAG // // / / / |AccI |Cfr10I Hpy188I Hin4II* MnlI Hpy166II |BetI* Eco31I |AgeI BsmAI HpaII V Y N N T P V F F I R D P S K F P H F I S T I I H R Y S L S E T L P S S L T L S L Q * Y T G I L Y Q R P F Q V P S L Y P ----:----|----:----|----:----|----:----|----:----|----:----| T * L L V G T N K I L S G E L N G * K I P R C Y Y V P I R * * L G K W T G E S * D V I I C R Y E K D S V R G L E R V K D BseGI | FatI | AflIII SfaNI | BspLU11I* | DdeI | |CviAII | SauI* | || NspI | |SetI | || NlaIII Ksp632I* MboII | |BsiYI* | || |FokI HphI \ \ \ \\ \ \\ \\ \ CACACACAGAAGAGAAACCCACAAACCAACCTAAGGGATGCTGACATGTTTTGGGATTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTGTGTCTTCTCTTTGGGTGTTTGGTTGGATTCCCTACGACTGTACAAAACCCTAAAG / / // / / / / // / Ksp632I* MboII || | SauI* | | || FokI || | DdeI | | || HphI || SfaNI | | |BspLU11I* |BsiYI* | | |AflIII SetI | | |FatI | | CviAII | NlaIII | NspI BseGI H T Q K R N P Q T N L R D A D M F W D F T H R R E T H K P T * G M L T C F G I S H T E E K P T N Q P K G C * H V L G F P ----:----|----:----|----:----|----:----|----:----|----:----| W V C F L F G C V L R L S A S M N Q S K G C V S S F G V F W G L P H Q C T K P N V C L L S V W L G V * P I S V H K P I E MnlI Hpy178III* | TspDTI | | CfrI BinI* | | SetI | MboI Hpy188I | | | BalI | | DpnI | SecI* | | | CviJI | | |BstKTI | DsaI* | | | HaeIII | | ||BaeI | |Tsp4CI* \ \ \ \ \ \ \\\ \ \\ CTCACCACTCCTGAAAATCAGGTGGCCATTCATCAAGTAATGATCCTTTTTTCAGACCGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTGGTGAGGACTTTTAGTCCACCGGTAAGTAGTTCATTACTAGGAAAAAAGTCTGGCA / / / / / / / / // / / / | | | SetI | CfrI | | || MboI | Tsp4CI* | | TspDTI HaeIII | | |DpnI Hpy188I | Hpy178III* CviJI | | BstKTI MnlI BalI | BaeI BinI* L T T P E N Q V A I H Q V M I L F S D R S P L L K I R W P F I K * * S F F Q T V H H S * K S G G H S S S N D P F F R P W ----:----|----:----|----:----|----:----|----:----|----:----| R V V G S F * T A M * * T I I R K E S R G * W E Q F D P P W E D L L S G K K L G E G S R F I L H G N M L Y H D K K * V T Acc65I HgiCI* FatI SetI |Csp6I CviRI* | BsiYI* ||RsaI BaeI |CviAII | | AsuI* ||NlaIV |Tsp4CI* ||EcoT22I | | AvaII ||| KpnI ||TsoI ||| NlaIII | | |BmgT120I \\\ \ \\\ \\\ \ \ \ \\ GGTACCCCTGCCAACTACCGTAGTATGCATGGTTATTCTGGTCATACCTATAAATGGTCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGGGACGGTTGATGGCATCATACGTACCAATAAGACCAGTATGGATATTTACCAGG / /// / / / / // / / // | ||HgiCI* BaeI | | | |FatI SetI BsiYI* |AvaII | ||Acc65I | | | CviAII |AsuI* | |Csp6I | | CviRI* BmgT120I | NlaIV | | NlaIII | RsaI | EcoT22I DsaI* Tsp4CI* SecI* TsoI KpnI G T P A N Y R S M H G Y S G H T Y K W S V P L P T T V V C M V I L V I P I N G P Y P C Q L P * Y A W L F W S Y L * M V Q ----:----|----:----|----:----|----:----|----:----|----:----| P V G A L * R L I C P * E P * V * L H D H Y G Q W S G Y Y A H N N Q D Y R Y I T T G R G V V T T H M T I R T M G I F P G TspDTI |TspGWI ||MwoI MboI ||BstAPI | DpnI ApoI ||| CviRI* | |BstKTI TspEI \\\ \ \ \\ \ AATAAAAACGGAGATTGGCATTATGTGCAAGTTCATATCAAAACCGATCAAGGAATAAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTTGCCTCTAACCGTAATACACGTTCAAGTATAGTTTTGGCTAGTTCCTTATTTC // / // / || CviRI* || MboI |TspGWI |DpnI |BstAPI BstKTI |MwoI TspDTI N K N G D W H Y V Q V H I K T D Q G I K I K T E I G I M C K F I S K P I K E * R * K R R L A L C A S S Y Q N R S R N K E ----:----|----:----|----:----|----:----|----:----|----:----| L L F P S Q C * T C T * I L V S * P I F W Y F R L N A N H A L E Y * F R D L F L I F V S I P M I H L N M D F G I L S Y L CviJI | FauI | |MboII | ||TspEI | ||| BinI* | ||| | AciI | ||| | | MboI | ||| | | BamHI | ||| | | XhoII | ||| | | | DpnI | ||| | | | NlaIV | ||| | | | |BstKTI Cac8I Ksp632I* | ||| | | | || BinI* | BdaI |MnlI | ||| | | | || |Hpy178III* | BdaI \\ \ \\\ \ \ \ \\ \\ \ \ AATTTGACCATAGAAGAGGCTACCAAAATTGCGGGATCCAATCCAGATTACTGCCAGCAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACTGGTATCTTCTCCGATGGTTTTAACGCCCTAGGTTAGGTCTAATGACGGTCGTC / / / / / / / / // / / / // | | | | | | | | || | | | |BdaI | | | | | | | | || | | | |BdaI | | | | | | | | || | | | Cac8I | | | | | | | | || | | Hpy178III* | | | | | | | | || | BinI* | | | | | | | | || XhoII | | | | | | | | || BamHI | | | | | | | | || MboI | | | | | | | | |NlaIV | | | | | | | | |DpnI | | | | | | | | BstKTI | | | | | | | AciI | | | | | | TspEI | | | | | | BinI* | | | | | FauI | | | | MboII | | | CviJI | | Ksp632I* | MnlI TspEI ApoI N L T I E E A T K I A G S N P D Y C Q Q I * P * K R L P K L R D P I Q I T A S R F D H R R G Y Q N C G I Q S R L L P A G ----:----|----:----|----:----|----:----|----:----|----:----| F K V M S S A V L I A P D L G S * Q W C S N S W L L P * W F Q P I W D L N S G A I Q G Y F L S G F N R S G I W I V A L L PfoI BssKI EcoRII Hpy188I | ScrFI | EcoP15I | BseBI | | BdaI | | Hin4II* MnlI CviJI | | BdaI | | |Tsp4CI* BcgI \ \ \ \ \ \ \ \\ \ GATTTATTTGAGGCTATTCAGAATGGAAACTATCCTTCCTGGACAGTTTATATTCAAACA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATAAACTCCGATAAGTCTTACCTTTGATAGGAAGGACCTGTCAAATATAAGTTTGT / / / / / / /// / MnlI CviJI Hpy188I | BdaI | ||Tsp4CI* BcgI | BdaI | |Hin4II* EcoP15I | EcoRII | BssKI | PfoI BseBI ScrFI D L F E A I Q N G N Y P S W T V Y I Q T I Y L R L F R M E T I L P G Q F I F K Q F I * G Y S E W K L S F L D S L Y S N N ----:----|----:----|----:----|----:----|----:----|----:----| S K N S A I * F P F * G E Q V T * I * V P N I Q P * E S H F S D K R S L K Y E F I * K L S N L I S V I R G P C N I N L C TaqII | TspEI | | BtgZI CviJI SfaNI FnuDII* | | | BcgI HaeIII \ \ \ \ \ \ \ ATGACCGAACGCGATGCCAAAAAATTACCATTTTCAGTCTTTGATTTGACTAAAGTATGG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCTTGCGCTACGGTTTTTTAATGGTAAAAGTCAGAAACTAAACTGATTTCATACC / / / // / / | | TaqII || BtgZI HaeIII | FnuDII* |BcgI CviJI SfaNI TspEI M T E R D A K K L P F S V F D L T K V W * P N A M P K N Y H F Q S L I * L K Y G D R T R C Q K I T I F S L * F D * S M A ----:----|----:----|----:----|----:----|----:----|----:----| I V S R S A L F N G N E T K S K V L T H L S R V R H W F I V M K L R Q N S * L I H G F A I G F F * W K * D K I Q S F Y P DdeI SauI* | BglI | MwoI | | TspEI | | |MnlI | | || BspCNI TfiI | | || |BseMII BceAI HinfI MboII \ \ \\ \\ \ \ \ CCTCAGGGGCAATTCCCTTTACGGCGTGTGGGTAAGATTGTTTTGAACGAGAATCCACTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGTCCCCGTTAAGGGAAATGCCGCACACCCATTCTAACAAAACTTGCTCTTAGGTGAC / / / // / // / | | | |BseMII BceAI || MboII | | | |TspEI |HinfI | | | BspCNI |TfiI | | MnlI TspRI | SauI* | DdeI MwoI BglI P Q G Q F P L R R V G K I V L N E N P L L R G N S L Y G V W V R L F * T R I H * S G A I P F T A C G * D C F E R E S T E ----:----|----:----|----:----|----:----|----:----|----:----| G * P C N G K R R T P L I T K F S F G S A E P A I G K V A H P Y S Q K S R S D V R L P L E R * P T H T L N N Q V L I W Q TseI BsrI AluI |Hin4II* CviJI || Csp6I |BisI || |RsaI ||BlsI || || SecI* ||SetI || || DsaI* TspRI ||| MwoI || || | Tsp4CI* | XmnI BbvI SetI ||| |BfiI || || | | NlaIV \ \ \ \ \\\ \\ \\ \\ \ \ \ AACTTCTTCGCACAGGTGGAACAAGCTGCCTTCGCCCCCAGTACCACGGTTCCTTACCAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAGAAGCGTGTCCACCTTGTTCGACGGAAGCGGGGGTCATGGTGCCAAGGAATGGTT / / / / //// / / / // // / XmnI | BbvI | |||| BfiI | | || || NlaIV SetI | |||MwoI | | || |DsaI* | |||TseI | | || |SecI* | ||BisI | | || Tsp4CI* | |BlsI | | |Csp6I | CviJI | | RsaI | AluI | Hin4II* SetI BsrI N F F A Q V E Q A A F A P S T T V P Y Q T S S H R W N K L P S P P V P R F L T K L L R T G G T S C L R P Q Y H G S L P R ----:----|----:----|----:----|----:----|----:----|----:----| F K K A C T S C A A K A G L V V T G * W S S R R V P P V L Q R R G W Y W P E K G V E E C L H F L S G E G G T G R N R V L Cac8I |BinI* ||Hin6I |||GlaI |||Eco47III ||||HhaI |||||HaeII AsuI* ||||||MboI |CviJI ||||||| DpnI |HaeIII SfaNI ||||||| |BstKTI |BmgT120I | NdeI ||||||| ||BsrI ||TspDTI | | AciI BseGI \\\\\\\ \\\ \\\ \ \ \ \ GAAGCAAGCGCTGATCCAGTATTACAGGCCCGTTTGTTTTCATATGCGGATGCTCATAGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTTCGCGACTAGGTCATAATGTCCGGGCAAACAAAAGTATACGCCTACGAGTATCT ///// // / //// // / / ||||| || MboI |||AsuI* || | BseGI ||||| |DpnI ||BmgT120I || AciI ||||| |BsrI |HaeIII |NdeI ||||| BstKTI |CviJI SfaNI ||||Hin6I TspDTI |||Eco47III |||GlaI ||BinI* ||HhaI |HaeII Cac8I E A S A D P V L Q A R L F S Y A D A H R K Q A L I Q Y Y R P V C F H M R M L I D S K R * S S I T G P F V F I C G C S * I ----:----|----:----|----:----|----:----|----:----|----:----| S A L A S G T N C A R K N E Y A S A * L L L L R Q D L I V P G N T K M H P H E Y F C A S I W Y * L G T Q K * I R I S M S CviJI Hpy166II |MaeI | Tsp4CI* || AsuI* | | NdeI || AvaII | | | CviRI* || DraII | | | | EcoT22I || PpuMI | | | | | ApoI || |BmgT120I | | | | | TspEI FokI || ||SetI BccI | | | | | | SfaNI \ \\ \\\ \ \ \ \ \ \ \ \ TACAGGCTAGGTCCTAACTTCCATCAAATACCCGTAAACTGTCCATATGCATCTAAATTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCCGATCCAGGATTGAAGGTAGTTTATGGGCATTTGACAGGTATACGTAGATTTAAA // // // / / / / / / || || |PpuMI BccI | Tsp4CI* | CviRI* TspEI || || |DraII Hpy166II EcoT22I ApoI || || |AvaII NdeI || || |AsuI* || || BmgT120I || |MaeI || SetI |CviJI FokI Y R L G P N F H Q I P V N C P Y A S K F T G * V L T S I K Y P * T V H M H L N F Q A R S * L P S N T R K L S I C I * I F ----:----|----:----|----:----|----:----|----:----|----:----| Y L S P G L K W * I G T F Q G Y A D L N I C A L D * S G D F V R L S D M H M * I V P * T R V E M L Y G Y V T W I C R F K MseI |HpaI |HindII |Hpy166II || TaqII || | TspDTI BccI || | | MwoI | FauI || | | | CviJI | |Hpy188I || | | | |DdeI | || AsuI* || | | | || BceAI | || AvaII || | | | || Hpy188I AciI | || |BmgT120I || | | | || | SetI \ \ \\ \\ \\ \ \ \ \\ \ \ TTCAATCCCGCTATCAGAGATGGACCGATGAATGTTAACGGCAACTTCGGCTCAGAACCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTAGGGCGATAGTCTCTACCTGGCTACTTACAATTGCCGTTGAAGCCGAGTCTTGGA / / // / // // / / / // / SfaNI | || FauI |AvaII || | MwoI | || BceAI | |Hpy188I |AsuI* || TspDTI | || SetI | BccI BmgT120I |TaqII | |DdeI AciI |MseI | Hpy188I Hpy166II CviJI HindII HpaI F N P A I R D G P M N V N G N F G S E P S I P L S E M D R * M L T A T S A Q N L Q S R Y Q R W T D E C * R Q L R L R T Y ----:----|----:----|----:----|----:----|----:----|----:----| K L G A I L S P G I F T L P L K P E S G K * D R * * L H V S S H * R C S R S L V E I G S D S I S R H I N V A V E A * F R Csp6I |RsaI BspCNI ||AflIII |BseMII ||Hpy166II || CfrI ||| MaeII || | BalI ||| |BsaAI || | CviJI ||| || SetI MnlI || | HaeIII ||| || TaiI MmeI \\ \ \ \\\ \\ \ \ ACATATTTGGCCAACGATAAATCGTACACGTATATCCAACAGGACAGACCCATTCAACAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATAAACCGGTTGCTATTTAGCATGTGCATATAGGTTGTCCTGTCTGGGTAAGTTGTT // / / /// // // |BseMII | CfrI ||| |AflIII |MnlI BspCNI HaeIII ||| |MaeII MmeI CviJI ||| BsaAI BalI ||TaiI ||SetI |Hpy166II |Csp6I RsaI T Y L A N D K S Y T Y I Q Q D R P I Q Q H I W P T I N R T R I S N R T D P F N N I F G Q R * I V H V Y P T G Q T H S T T ----:----|----:----|----:----|----:----|----:----|----:----| V Y K A L S L D Y V Y I W C S L G M * C * M N P W R Y I T C T Y G V P C V W E V C I Q G V I F R V R I D L L V S G N L L AsuI* |BmgT120I BseGI ||CviJI | BssKI ||HaeIII | SecI* ||| Cac8I | EcoRII ||| | AluI | | ScrFI ||| | CviJI | | BseBI SetI ||| | | SetI FokI | | | SetI \ \\\ \ \ \ \ \ \ \ \ CACCAAGAGGTATGGAATGGGCCAGCTATCCCTTATCATTGGGCAACATCCCCAGGTGAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTTCTCCATACCTTACCCGGTCGATAGGGAATAGTAACCCGTTGTAGGGGTCCACTA / /// / / / //// SetI ||| CviJI FokI BseGI |||EcoRII ||| AluI |||BssKI ||Cac8I ||SecI* ||SetI |BseBI |AsuI* |ScrFI BmgT120I SetI HaeIII CviJI H Q E V W N G P A I P Y H W A T S P G D T K R Y G M G Q L S L I I G Q H P Q V M P R G M E W A S Y P L S L G N I P R * C ----:----|----:----|----:----|----:----|----:----|----:----| C W S T H F P G A I G * * Q A V D G P S V G L P I S H A L * G K D N P L M G L H V L L Y P I P W S D R I M P C C G W T I Hpy166II | BssKI | EcoRII AciI | | ScrFI CviRI* | FnuDII* | | BseBI HphI | Cac8I | | BsiYI* | | |SetI \ \ \ \ \ \ \ \ \\ GTAGATTTCGTGCAAGCAAGAAATCTCTACCGCGTTTTGGGTAAACAACCTGGACAGCAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTAAAGCACGTTCGTTCTTTAGAGATGGCGCAAAACCCATTTGTTGGACCTGTCGTT / / / // / / / / HphI | Cac8I |BsiYI* | | | EcoRII CviRI* FnuDII* | | | BssKI AciI | | BseBI | | ScrFI | SetI Hpy166II V D F V Q A R N L Y R V L G K Q P G Q Q * I S C K Q E I S T A F W V N N L D S K R F R A S K K S L P R F G * T T W T A K ----:----|----:----|----:----|----:----|----:----|----:----| T S K T C A L F R * R T K P L C G P C C H L N R A L L F D R G R K P Y V V Q V A Y I E H L C S I E V A N Q T F L R S L L BsmI | FatI | |CviAII | |Hin4II* | || NlaIII | || | KasI | || | HgiCI* | || | |AcyI | || | |NarI | || | |Hin6I | || | ||GlaI MnlI | || | ||DinI |TseI | || | ||NlaIV ||BisI | || | |||HhaI |||BlsI TspDTI | || | ||||HaeII ||||Hin6I \ \ \\ \ \\\\\ \\\\\ AAGAACTTGGCATATAACATCGGCATTCATGTAGAAGGCGCCTGTCCTCAAATACAGCAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTGAACCGTATATTGTAGCCGTAAGTACATCTTCCGCGGACAGGAGTTTATGTCGTC / / / // ///// / /// TspDTI BsmI | |FatI ||||HgiCI* | ||TseI | CviAII ||||KasI | ||HhaI Hin4II* |||Hin6I | |BisI NlaIII |||NarI | BlsI |||AcyI MnlI ||NlaIV ||DinI ||GlaI |HhaI HaeII K N L A Y N I G I H V E G A C P Q I Q Q R T W H I T S A F M * K A P V L K Y S S E L G I * H R H S C R R R L S S N T A A ----:----|----:----|----:----|----:----|----:----|----:----| F F K A Y L M P M * T S P A Q G * I C C F S S P M Y C R C E H L L R R D E F V A L V Q C I V D A N M Y F A G T R L Y L L DdeI |Hpy188I || TspEI BsiI* || BslFI GlaI | EcoP15I || | MseI |HhaI | | BseMII || | | BseMII |FnuDII* | | |BspCNI || | | |BspCNI || BbvI | | || MnlI || | | || MnlI \\ \ \ \ \\ \ \\ \ \ \\ \ CGCGTTTATGATATGTTTGCTCGTGTTGATAAGGGACTATCTGAGGCAATTAAAAAAGTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCAAATACTATACAAACGAGCACAACTATTCCCTGATAGACTCCGTTAATTTTTTCAT // / / / // / / / // / / |FnuDII* BbvI | | || MnlI | DdeI || | SetI |Hin6I | | |BspCNI Hpy188I || MnlI GlaI | | BseMII |BspCNI | EcoP15I |MseI BsiI* BseMII BslFI TspEI R V Y D M F A R V D K G L S E A I K K V A F M I C L L V L I R D Y L R Q L K K * R L * Y V C S C * * G T I * G N * K S S ----:----|----:----|----:----|----:----|----:----|----:----| R T * S I N A R T S L P S D S A I L F T A R K H Y T Q E H Q Y P V I Q P L * F L A N I I H K S T N I L S * R L C N F F Y BseMII |FatI |BspCNI ||MwoI ||CviAII ||BstAPI ||| NspI ||| NlaIII ||| | DdeI AluI ||| | |Hpy188I CviJI ||| | || AluI |DdeI ||| | || CviJI |BbvCI ||| | || | SetI |Bpu10I ||| | || | | TaqI ApoI ||SetI ||| | || | | | MaeIII TspEI \\\ \\\ \ \\ \ \ \ \ \ GCTGAGGCAAAACATGCTTCTGAGCTTTCGAGTAACTCCAAATTTTGA 1510 1520 1530 1540 ----:----|----:----|----:----|----:----|----:--- CGACTCCGTTTTGTACGAAGACTCGAAAGCTCATTGAGGTTTAAAACT / / // / // / /// / / / | | || | || | ||CviJI TaqI MaeIII TspEI | | || | || | ||AluI ApoI | | || | || | |DdeI | | || | || | SetI | | || | || Hpy188I | | || | |FatI | | || | CviAII | | || NlaIII | | || NspI | | |BstAPI | | |BspCNI | | |MwoI | | BseMII | Bpu10I | BbvCI | DdeI CviJI AluI A E A K H A S E L S S N S K F * L R Q N M L L S F R V T P N F X * G K T C F * A F E * L Q I L X ----:----|----:----|----:----|----:----|----:--- A S A F C A E S S E L L E L N Q L Q P L V H K Q A K S Y S W I K S L C F M S R L K R T V G F K S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 4 AluBI ApoI 4 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 2 BceAI 2 BcgI 1 BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BinI* 5 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 6 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 5 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 5 BspLU11I* 1 PscI,PciI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 2 BstKTI 5 BstXI 1 BtgZI 1 Cac8I 4 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 7 CviJI 16 CviKI-1 CviRI* 5 HpyCH4V DdeI 6 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 5 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 1 EcoP15I 2 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I FatI 7 FauI 3 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 3 HaeII 2 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 3 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 8 KasI 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MmeI 1 MnlI 11 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 2 FauNDI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspI 3 BstNSI,XceI PfoI 1 PpuMI 1 Psp5II,PspPPI PsiI 1 AanI RsaI 3 AfaI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 17 SfaNI 4 LweI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 3 TaqII 4 TfiI 3 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BarI BbvII* Bce83I* BciVI BclI BglII BmeT110I BmtI BplI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstZ17I BtrI BtsI CauII* Cfr9I ClaI CspCI DraIII DrdI Eam1105I EciI Ecl136II EcoICRI EcoNI EcoRI Esp3I EspI* FalI FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* Hin4I HindIII Hpy99I MauBI McrI* MfeI MluI MlyI MroNI MstI* NaeI NcoI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PflMI PleI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SchI SduI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TauI TspMI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769