Restriction Map of MET32/YDR253C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MET32/YDR253C on chromosome IV from coordinates 964565 to 963990.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BbvI SfaNI | MboI | | DpnI | | |BstKTI | | ||Hpy178III* | | ||| BinI* | | ||| | TseI | | ||| | |BisI | | ||| | ||BlsI | | ||| | ||BseGI CviJI | | ||| | |||CviRI* |SfeI* | | ||| | |||| FokI || MwoI BseGI \ \ \\\ \ \\\\ \ \\ \ \ ATGGAGGATCAGGATGCTGCATTTATCAAACAGGCTACAGAAGCAATAGTGGATGTATCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCCTAGTCCTACGACGTAAATAGTTTGTCCGATGTCTTCGTTATCACCTACATAGT // / / ///// / / / / / || | | ||||CviRI* FokI | | SfeI* BseGI || | | ||||TseI | MwoI || | | |||BisI CviJI || | | ||BlsI || | | |BseGI || | | BinI* || | Hpy178III* || MboI |DpnI BstKTI SfaNI BbvI M E D Q D A A F I K Q A T E A I V D V S W R I R M L H L S N R L Q K Q * W M Y H G G S G C C I Y Q T G Y R S N S G C I I ----:----|----:----|----:----|----:----|----:----|----:----| X S S * S A A N I L C A V S A I T S T D X P P D P H Q M * * V P * L L L L P H I H L I L I S C K D F L S C F C Y H I Y * BinI* | MboI | XhoII MseI | | DpnI | FokI | | |BstKTI \ \ \ \ \\ TTAAATATAGATAACATAGATCCTATAATAAAAGAGTTATTAGAAAGGGTAAGGAATAGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTATATCTATTGTATCTAGGATATTATTTTCTCAATAATCTTTCCCATTCCTTATCC / / / // / MseI FokI | || XhoII | || MboI | |DpnI | BstKTI BinI* L N I D N I D P I I K E L L E R V R N R * I * I T * I L * * K S Y * K G * G I G K Y R * H R S Y N K R V I R K G K E * A ----:----|----:----|----:----|----:----|----:----|----:----| N F I S L M S G I I F S N N S L T L F L M L Y L Y C L D * L L L T I L F P L S Y * I Y I V Y I R Y Y F L * * F P Y P I P MaeIII Cfr10I | SetI |HpaII \ \ \\ CAAAACAGGTTACAAAATAAAAAACCAGCACTCATACCGGCAGAAAATGGTGTTGATATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGTCCAATGTTTTATTTTTTGGTCGTGAGTATGGCCGTCTTTTACCACAACTATAT / / // SetI MaeIII |Cfr10I HpaII Q N R L Q N K K P A L I P A E N G V D I K T G Y K I K N Q H S Y R Q K M V L I * K Q V T K * K T S T H T G R K W C * Y K ----:----|----:----|----:----|----:----|----:----|----:----| C F L N C F L F G A S M G A S F P T S I A F C T V F Y F V L V * V P L F H H Q Y L V P * L I F F W C E Y R C F I T N I Y AciI MseI | MaeIII SetI \ \ \ AATAGTCAAGGCGGTAACATAAAGGTTAAAAAGGAAAACGCATTACCAAAACCACCGAAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCAGTTCCGCCATTGTATTTCCAATTTTTCCTTTTGCGTAATGGTTTTGGTGGCTTC / / / / AciI | SetI MseI MaeIII N S Q G G N I K V K K E N A L P K P P K I V K A V T * R L K R K T H Y Q N H R S * S R R * H K G * K G K R I T K T T E V ----:----|----:----|----:----|----:----|----:----|----:----| F L * P P L M F T L F S F A N G F G G F L Y D L R Y C L P * F P F R M V L V V S I T L A T V Y L N F L F V C * W F W R L HphI |MmeI TatI |MseI MboI |Csp6I ||SwaI | DpnI ||RsaI ||AhaIII* | |BstKTI ||ScaI BsrI |||AjuI \ \\ \\\ \ \\\\ TCCAGCAAAAGCAAACCCCAAGATCGTAGAAATAGTACTGGTGAAAAAAGATTTAAATGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCGTTTTCGTTTGGGGTTCTAGCATCTTTATCATGACCACTTTTTTCTAAATTTACA // / /// / // // || MboI ||| BsrI || |MseI |DpnI ||TatI || AhaIII* BstKTI |Csp6I || SwaI ScaI |HphI RsaI |MmeI AjuI S S K S K P Q D R R N S T G E K R F K C P A K A N P K I V E I V L V K K D L N V Q Q K Q T P R S * K * Y W * K K I * M C ----:----|----:----|----:----|----:----|----:----|----:----| D L L L L G W S R L F L V P S F L N L H T W C F C V G L D Y F Y Y Q H F F I * I G A F A F G L I T S I T S T F F S K F T Hpy178III* | MboI | | DpnI | | AjuI | | |BstKTI ApoI | | || Hpy188I FalI TspEI | | || | Hin4II* FalI \ \ \ \\ \ \ \ GCGAAATGTTCGTTGGAATTTTCAAGATCATCAGATTTGAGAAGGCACGAAAAGACACAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTTTACAAGCAACCTTAAAAGTTCTAGTAGTCTAAACTCTTCCGTGCTTTTCTGTGTG / / /// / / / / | | ||| | | | FalI | | ||| | | | FalI | | ||| | | Hin4II* | | ||| | Hpy188I | | ||| MboI | | ||DpnI | | |BstKTI | | Hpy178III* | AjuI TspEI ApoI A K C S L E F S R S S D L R R H E K T H R N V R W N F Q D H Q I * E G T K R H T E M F V G I F K I I R F E K A R K D T L ----:----|----:----|----:----|----:----|----:----|----:----| A F H E N S N E L D D S K L L C S F V C H S I N T P I K L I M L N S F A R F S V R F T R Q F K * S * * I Q S P V F L C V SetI FalI BsiYI* | SfaNI CviRI* FalI | MnlI | |CviRI* | EcoT22I \ \ \ \ \\ \ \ TTCGCCATATTGCCTAACATTTGTCCTCAATGTGGCAAAGGTTTTGCAAGGAAAGATGCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGGTATAACGGATTGTAAACAGGAGTTACACCGTTTCCAAAACGTTCCTTTCTACGT / / / / / / / / FalI | | SetI | SfaNI | CviRI* FalI | MnlI CviRI* EcoT22I BsiYI* F A I L P N I C P Q C G K G F A R K D A S P Y C L T F V L N V A K V L Q G K M H R H I A * H L S S M W Q R F C K E R C I ----:----|----:----|----:----|----:----|----:----|----:----| K A M N G L M Q G * H P L P K A L F S A S R W I A * C K D E I H C L N Q L S L H E G Y Q R V N T R L T A F T K C P F I C MslI |FatI |AflIII |BspLU11I* ||TspRI ||CviAII ||| NspI TspEI AciI ||| NlaIII | FauI | MnlI \\\ \ \ \ \ \ TTGAAAAGACATTATGATACACTGACATGTAGGAGAAACAGGACTAAATTACTAACTGCG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTTCTGTAATACTATGTGACTGTACATCCTCTTTGTCCTGATTTAATGATTGACGC / // // / / // TspRI || |BspLU11I* | FauI |AciI || |AflIII TspEI MnlI || |FatI || CviAII |NlaIII |NspI MslI L K R H Y D T L T C R R N R T K L L T A * K D I M I H * H V G E T G L N Y * L R E K T L * Y T D M * E K Q D * I T N C G ----:----|----:----|----:----|----:----|----:----|----:----| N F L C * S V S V H L L F L V L N S V A M S F V N H Y V S M Y S F C S * I V L Q Q F S M I I C Q C T P S V P S F * * S R BdaI BdaI TspDTI |HphI | BdaI || TspEI TspDTI | BdaI \\ \ \ \ \ GGTGGTGAGGGTATCAATGAATTACTGAAAAAAGTCAAGCAATCCAACATCGTTCATCGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACTCCCATAGTTACTTAATGACTTTTTTCAGTTCGTTAGGTTGTAGCAAGTAGCA / / / / / / | HphI TspEI TspDTI | BdaI BdaI | BdaI BdaI TspDTI G G E G I N E L L K K V K Q S N I V H R V V R V S M N Y * K K S S N P T S F I V W * G Y Q * I T E K S Q A I Q H R S S S ----:----|----:----|----:----|----:----|----:----|----:----| P P S P I L S N S F F T L C D L M T * R P H H P Y * H I V S F L * A I W C R E D T T L T D I F * Q F F D L L G V D N M T Hpy178III* MwoI | MmeI | CviJI \ \ \ \ CAAGATAACAACCACAATGGTAGCAGTAATGGCTGA 550 560 570 ----:----|----:----|----:----|----:- GTTCTATTGTTGGTGTTACCATCGTCATTACCGACT / / / / | MmeI MwoI CviJI Hpy178III* Q D N N H N G S S N G * K I T T T M V A V M A X R * Q P Q W * Q * W L X ----:----|----:----|----:----|----:- * S L L W L P L L L P Q D L Y C G C H Y C Y H S L I V V V I T A T I A S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AflIII 1 AhaIII* 1 DraI AjuI 1 ApoI 1 AcsI,XapI BbvI 1 BseXI,BstV1I,Lsp1109I BdaI 2 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BseGI 2 BstF5I,BtsCI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BspLU11I* 1 PscI,PciI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 4 Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 2 CviKI-1 CviRI* 3 HpyCH4V DpnI 4 MalI EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 1 FauI 1 SmuI FokI 2 Hin4II* 1 HpyAV HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy178III* 3 Hpy188III Hpy188I 1 MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MmeI 2 MnlI 2 MseI 3 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI RsaI 1 AfaI ScaI 1 BmcAI,AssI,ZrmI SetI 3 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SwaI 1 SmiI TatI 1 TseI 1 ApeKI TspDTI 2 TspEI 3 TasI,Tsp509I,Sse9I TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I CfrI ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EgeI EheI Esp3I EspI* FaqI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HindIII HinfI HinP1I HpaI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI MboII McrI* MfeI MluI MlyI MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI ScrFI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI TaiI TaqI TaqII TauI TfiI TsoI Tsp45I Tsp4CI* TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769