Restriction Map of YDR250C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YDR250C on chromosome IV from coordinates 960361 to 960086.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.10533

EMBOSS_001 BssKI CviJI EcoRII HaeIII | ScrFI | BseBI TspDTI HphI XmnI TspDTI \ \ \ \ \ \ ATGAATGGCCTGGTGATAATAGATATGAACAACTTCGCTATCGTGTATGCCAATATCACT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTACCGGACCACTATTATCTATACTTGTTGAAGCGATAGCACATACGGTTATAGTGA / / // / / / | | |TspDTI HphI XmnI TspDTI | | EcoRII | | BssKI | BseBI | ScrFI HaeIII CviJI M N G L V I I D M N N F A I V Y A N I T * M A W * * * I * T T S L S C M P I S L E W P G D N R Y E Q L R Y R V C Q Y H F ----:----|----:----|----:----|----:----|----:----|----:----| X F P R T I I S I F L K A I T Y A L I V X S H G P S L L Y S C S R * R T H W Y * H I A Q H Y Y I H V V E S D H I G I D S SetI | FatI | |CviAII | || NlaIII TaqI TspDTI | || | TspDTI \ \ \ \\ \ \ TTTCTTTTCTACTACTTACTCGACTTTACTCTACCTTTTCATGTTTGTAGATTTCTGTTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGAAAAGATGATGAATGAGCTGAAATGAGATGGAAAAGTACAAACATCTAAAGACAAA / / / / // / | | SetI | || TspDTI | TspDTI | |FatI TaqI | CviAII NlaIII F L F Y Y L L D F T L P F H V C R F L F F F S T T Y S T L L Y L F M F V D F C F S F L L L T R L Y S T F S C L * I S V S ----:----|----:----|----:----|----:----|----:----|----:----| K R K * * K S S K V R G K * T Q L N R N K E K R S S V R S * E V K E H K Y I E T K K E V V * E V K S * R K M N T S K Q K AvaI XhoI SmlI Hpy178III* |TaqI |BmeT110I ||Hpy178III* ||| AsuI* ||| |CviJI ||| |HaeIII BsiYI* ||| |BmgT120I | TseI ||| || BsiYI* | CviJI ||| || | BbvI | |BisI ||| || | CfrI | ||BlsI ||| || | | CviJI | ||BceAI MaeI |||BsmAI || | | HaeIII | ||| TspEI FnuDII* \ \\\\ \\ \ \ \ \ \\\ \ \ CATTCTAGTCTCGAGAATGGCCCACAGCACGGCCAACAGGGGGCTGCGACAATTTCGCGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGATCAGAGCTCTTACCGGGTGTCGTGCCGGTTGTCCCCCGACGCTGTTAAAGCGCA / /// / /// / / / / ///// / / MaeI ||| | ||| BsiYI* | | BsiYI* ||||BceAI | FnuDII* ||| | ||AsuI* | CfrI |||TseI TspEI ||| | |BmgT120I | BbvI ||BisI ||| | HaeIII HaeIII |BlsI ||| | CviJI CviJI CviJI ||| BsmAI ||Hpy178III* ||SmlI ||XhoI ||AvaI |BmeT110I |TaqI Hpy178III* H S S L E N G P Q H G Q Q G A A T I S R I L V S R M A H S T A N R G L R Q F R V F * S R E W P T A R P T G G C D N F A * ----:----|----:----|----:----|----:----|----:----|----:----| * E L R S F P G C C P W C P A A V I E R E N * D R S H G V A R G V P P Q S L K A M R T E L I A W L V A L L P S R C N R T TatI Bsp1407I MwoI |Csp6I CviJI | AluI |TaqII | SduI | CviJI ||RsaI | HgiJII* CviJI | | SetI |||Hpy166II MboII \ \ \ \ \ \ \\\\ \ AGAGCCCATTGTGAAAAAAGCCACCCAAGCTATTATTGTACACAGAAGAATATGGAAGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGGGTAACACTTTTTTCGGTGGGTTCGATAATAACATGTGTCTTCTTATACCTTCGT / / / / / / / /// / | CviJI | | | CviJI | ||Bsp1407I MboII HgiJII* | | | AluI | ||TatI SduI | | SetI | |Hpy166II | MwoI | |Csp6I CviJI | RsaI TaqII R A H C E K S H P S Y Y C T Q K N M E A E P I V K K A T Q A I I V H R R I W K Q S P L * K K P P K L L L Y T E E Y G S K ----:----|----:----|----:----|----:----|----:----|----:----| L A W Q S F L W G L * * Q V C F F I S A Y L G N H F F G G L S N N Y V S S Y P L S G M T F F A V W A I I T C L L I H F C TspRI |MaeII ||BsaAI FatI ||| SetI |CviAII BsrI ||| TaiI || NlaIII \ \\\ \ \\ \ AATCGCCAGTGCTACGTGAATGGGACAAAAACATGA 250 260 270 ----:----|----:----|----:----|----:- TTAGCGGTCACGATGCACTTACCCTGTTTTTGTACT / / // / // TspRI | |MaeII | |FatI BsrI | BsaAI | CviAII TaiI NlaIII SetI N R Q C Y V N G T K T * I A S A T * M G Q K H X S P V L R E W D K N M X ----:----|----:----|----:----|----:- F R W H * T F P V F V H L D G T S R S H S L F M I A L A V H I P C F C S # Enzymes that cut Frequency Isoschizomers AluI 1 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BbvI 1 BseXI,BstV1I,Lsp1109I BceAI 1 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 7 CviKI-1 EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 2 Hpy188III MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboII 1 MwoI 1 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SetI 3 SmlI 1 SmoI TaiI 1 TaqI 2 TaqII 1 TatI 1 TseI 1 ApeKI TspDTI 4 TspEI 1 TasI,Tsp509I,Sse9I TspRI 1 TscAI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmtI BplI Bpu10I BsaBI BsaXI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstKTI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MseI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI TfiI TsoI Tsp45I Tsp4CI* TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769