Restriction Map of SIR4/YDR227W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SIR4/YDR227W on chromosome IV from coordinates 917571 to 921647.


AsuI* AvaII |BmgT120I BsrI ||SetI TaqII Hpy166II | MaeIII \\\ \ \ \ \ ATGCCAAATGACAATAAGACACCCAATAGGTCCAGCACTCCCAAGTTTACTAAAAAACCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGTTTACTGTTATTCTGTGGGTTATCCAGGTCGTGAGGGTTCAAATGATTTTTTGGT / // / / / | || TaqII Hpy166II BsrI | |AvaII | |AsuI* | BmgT120I SetI M P N D N K T P N R S S T P K F T K K P C Q M T I R H P I G P A L P S L L K N Q A K * Q * D T Q * V Q H S Q V Y * K T S ----:----|----:----|----:----|----:----|----:----|----:----| X G F S L L V G L L D L V G L N V L F G X A L H C Y S V W Y T W C E W T * * F V H W I V I L C G I P G A S G L K S F F W ApoI BbvII* TspEI |TspDTI | Hpy178III* MboII ||SetI \ \ \ \\\ GTAACCCCGAATGATAAAATTCCTGAAAGAGAAGAAAAATCCAATGAAGTGAAGACACCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGGGGCTTACTATTTTAAGGACTTTCTCTTCTTTTTAGGTTACTTCACTTCTGTGGA / / / / // MaeIII | Hpy178III* MboII |TspDTI TspEI SetI ApoI V T P N D K I P E R E E K S N E V K T P * P R M I K F L K E K K N P M K * R H L N P E * * N S * K R R K I Q * S E D T * ----:----|----:----|----:----|----:----|----:----|----:----| T V G F S L I G S L S S F D L S T F V G L L G S H Y F E Q F L L F I W H L S S V Y G R I I F N R F S F F F G I F H L C R CviJI HaeIII | TspDTI | |HindII | |Hpy166II ApoI MaeII | || AciI TspEI | SetI | || | TspEI |MboII | TaiI BceAI | || | | HphI \\ \ \ \ \ \\ \ \ \ AAAATTCCATTATTCACGTTTGCCAAAAGCAAAAACTATTCAAGGCCGTCAACCGCAATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAGGTAATAAGTGCAAACGGTTTTCGTTTTTGATAAGTTCCGGCAGTTGGCGTTAA / / / / / / / / / / / | TspEI | MaeII BceAI | | | | | TspEI | ApoI TaiI | | | | HphI BbvII* SetI | | | AciI MboII | | Hpy166II | | HindII | TspDTI HaeIII CviJI K I P L F T F A K S K N Y S R P S T A I K F H Y S R L P K A K T I Q G R Q P Q F N S I I H V C Q K Q K L F K A V N R N S ----:----|----:----|----:----|----:----|----:----|----:----| L I G N N V N A L L L F * E L G D V A I * F E M I * T Q W F C F S N L A T L R L F N W * E R K G F A F V I * P R * G C N Tsp4CI* SetI | CviRI* SetI | MnlI MnlI | | CviJI \ \ \ \ \ \ \ CATACCTCACCTCATCAACCAAGTGATGTAAAACCGACTTCCCATAAACAGTTGCAACAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGGAGTGGAGTAGTTGGTTCACTACATTTTGGCTGAAGGGTATTTGTCAACGTTGTC / / / / / / / SetI SetI MnlI MnlI | | CviJI | CviRI* Tsp4CI* H T S P H Q P S D V K P T S H K Q L Q Q I P H L I N Q V M * N R L P I N S C N S Y L T S S T K * C K T D F P * T V A T A ----:----|----:----|----:----|----:----|----:----|----:----| * V E G * * G L S T F G V E W L C N C C E Y R V E D V L H H L V S K G Y V T A V M G * R M L W T I Y F R S G M F L Q L L MnlI MnlI HphI | TspRI TspEI | Hpy178III* \ \ \ \ \ \ CCAAAATCCTCACCACTGAAAAAAAATAACTATAATTCTTTTCCTCACTCAAATCTGGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTAGGAGTGGTGACTTTTTTTTATTGATATTAAGAAAAGGAGTGAGTTTAGACCTT / / / / / / HphI TspRI MnlI TspEI MnlI Hpy178III* P K S S P L K K N N Y N S F P H S N L E Q N P H H * K K I T I I L F L T Q I W K K I L T T E K K * L * F F S S L K S G K ----:----|----:----|----:----|----:----|----:----|----:----| G F D E G S F F F L * L E K G * E F R S A L I R V V S F F Y S Y N K E E S L D P W F G * W Q F F I V I I R K R V * I Q F BsiYI* | AsuI* | AvaII | |BmgT120I | ||Hin4II* | ||| MaeII MboII | ||| | SetI |TaqII | ||| | TaiI TspEI \\ \ \\\ \ \ \ AAAATAAGCAACAGCAAACTACTCTCCCTTCTTCGGTCCAAAACGTCAGCAGGAAGAATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATTCGTTGTCGTTTGATGAGAGGGAAGAAGCCAGGTTTTGCAGTCGTCCTTCTTAA / / /// / / / MboII BsiYI* ||| | MaeII TspEI TaqII ||| TaiI ||| SetI ||AvaII ||AsuI* |BmgT120I Hin4II* K I S N S K L L S L L R S K T S A G R I K * A T A N Y S P F F G P K R Q Q E E L N K Q Q Q T T L P S S V Q N V S R K N * ----:----|----:----|----:----|----:----|----:----|----:----| F I L L L L S S E R R R D L V D A P L I F F L C C C V V R G E E T W F T L L F F F Y A V A F * E G K K P G F R * C S S N SfaNI | EcoP15I | |FatI | ||CviAII | |||BspMI | |||| NlaIII | |||| |Hin4II* | |||| || NheI SetI TfiI | |||| || |MaeI | MaeI HinfI | |||| || ||Cac8I | |BsmAI | MboII | |||| || ||| BmtI | |Eco31I \ \ \ \\\\ \\ \\\ \ \ \\ GAATCAAACAATCCTTCACATGATGCTAGCAGGTCTCTAGCAAGTTTTGAACAAACAGCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGTTTGTTAGGAAGTGTACTACGATCGTCCAGAGATCGTTCAAAACTTGTTTGTCGT / / // // // //// / / MboII | || || || |||SetI | Eco31I HinfI | || || || ||NheI | BsmAI TfiI | || || || |MaeI MaeI | || || || Cac8I | || || |BmtI | || || BspMI | || |Hin4II* | || |FatI | || CviAII | |EcoP15I | NlaIII SfaNI E S N N P S H D A S R S L A S F E Q T A N Q T I L H M M L A G L * Q V L N K Q H I K Q S F T * C * Q V S S K F * T N S I ----:----|----:----|----:----|----:----|----:----|----:----| S D F L G E C S A L L D R A L K S C V A Q I L C D K V H H * C T E L L N Q V F L F * V I R * M I S A P R * C T K F L C C BssKI | HpaII | ScrFI | CauII* | | FatI | | |CviAII | | ||Cac8I Hin4II* | | ||| SphI | BaeI | | ||| NspI | |CviJI | | ||| Hin6I | || Csp6I | | ||| NlaIII | || |RsaI | | ||| |GlaI | || ||MaeII | | ||| |MstI* | || |||BsaAI | | ||| ||TseI | || |||SnaBI | | ||| ||HhaI | || ||||Csp6I | | ||| ||MwoI | || |||||RsaI | | ||| |||BisI SetI | || |||||SetI | | ||| ||||BlsI BbvI | TspEI | || |||||TaiI \ \ \\\ \\\\\ \ \ \ \ \\ \\\\\\ TTTTCCCGGCATGCGCAGCAACAAACTTCTACCTTCAATTCAAAGCCTGTACGTACCATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGGGCCGTACGCGTCGTTGTTTGAAGATGGAAGTTAAGTTTCGGACATGCATGGTAT /// //////// // /// / ////// ||| |||||||TseI |BbvI ||| | |||||Csp6I ||| ||||||BisI SetI ||| | ||||RsaI ||| |||||BlsI ||| | |||MaeII ||| ||||Hin6I ||| | ||SnaBI ||| |||MstI* ||| | ||BsaAI ||| |||GlaI ||| | |Csp6I ||| ||FatI ||| | RsaI ||| ||HhaI ||| | TaiI ||| |CviAII ||| | SetI ||| |MwoI ||| CviJI ||| Cac8I ||Hin4II* ||NlaIII |TspEI ||BssKI BaeI ||NspI ||SphI |HpaII CauII* ScrFI F S R H A Q Q Q T S T F N S K P V R T I F P G M R S N K L L P S I Q S L Y V P * F P A C A A T N F Y L Q F K A C T Y H S ----:----|----:----|----:----|----:----|----:----|----:----| N E R C A C C C V E V K L E F G T R V M M K G A H A A V F K * R * N L A Q V Y W K G P M R L L L S R G E I * L R Y T G Y Hpy178III* | HindIII | | AluI | | CviJI | | | SetI Csp6I | | | | DdeI |RsaI EcoRV BaeI | | | | |Ksp632I* \\ \ \ \ \ \ \ \\ GTACCGATATCAACATCACAAACCAATAACTCATTTTTATCAGGAGTAAAAAGCTTACTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CATGGCTATAGTTGTAGTGTTTGGTTATTGAGTAAAAATAGTCCTCATTTTTCGAATGAT // / / / / / / || | BaeI | | | HindIII || EcoRV | | CviJI |Csp6I | | AluI RsaI | SetI Hpy178III* V P I S T S Q T N N S F L S G V K S L L Y R Y Q H H K P I T H F Y Q E * K A Y * T D I N I T N Q * L I F I R S K K L T K ----:----|----:----|----:----|----:----|----:----|----:----| T G I D V D C V L L E N K D P T F L K S L V S I L M V F W Y S M K I L L L F S V Y R Y * C * L G I V * K * * S Y F A * * TfiI HinfI MboII | MaeI \ \ \ AGTGAAGAGAAAATAAGGGATTACTCTAAAGAGATTCTAGGCATAAACTTGGCAAACGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTCTCTTTTATTCCCTAATGAGATTTCTCTAAGATCCGTATTTGAACCGTTTGCTT // / / / |Ksp632I* MboII | MaeI DdeI HinfI TfiI S E E K I R D Y S K E I L G I N L A N E V K R K * G I T L K R F * A * T W Q T N * R E N K G L L * R D S R H K L G K R T ----:----|----:----|----:----|----:----|----:----|----:----| L S S F I L S * E L S I R P M F K A F S L H L S F L P N S * L S E L C L S P L R T F L F Y P I V R F L N * A Y V Q C V F KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI MboI ||DinI | DpnI ||NlaIV CviJI | |BstKTI |||HhaI CviJI | MseI | || BinI* ||||HaeII MnlI \ \ \ \ \\ \ \\\\\ \ CAGCCTGTTTTAGAGAAGCCACTTAAAAAAGGATCAGCAGACATCGGCGCCTCTGTGATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGGACAAAATCTCTTCGGTGAATTTTTTCCTAGTCGTCTGTAGCCGCGGAGACACTAA / / / // / / ///// / CviJI CviJI MseI || MboI BinI* ||||HgiCI* MnlI |DpnI ||||KasI BstKTI |||Hin6I |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII Q P V L E K P L K K G S A D I G A S V I S L F * R S H L K K D Q Q T S A P L * F A C F R E A T * K R I S R H R R L C D F ----:----|----:----|----:----|----:----|----:----|----:----| C G T K S F G S L F P D A S M P A E T I V A Q K L S A V * F L I L L C R R R Q S L R N * L L W K F F S * C V D A G R H N EcoP15I | StyI | SecI* Hpy178III* Tsp4CI* MboII \ \ \ \ \ TCTTTGACCAAGGACAAATCTATCAGGAAAGATACCGTAGAAGAAAAAAAAGAAGAAAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAACTGGTTCCTGTTTAGATAGTCCTTTCTATGGCATCTTCTTTTTTTTCTTCTTTTC / / / / / | SecI* | Tsp4CI* MboII | StyI Hpy178III* EcoP15I S L T K D K S I R K D T V E E K K E E K L * P R T N L S G K I P * K K K K K K S F D Q G Q I Y Q E R Y R R R K K R R K V ----:----|----:----|----:----|----:----|----:----|----:----| E K V L S L D I L F S V T S S F F S S F K K S W P C I * * S L Y R L L F F L L F R Q G L V F R D P F I G Y F F F F F F L Hin4II* | Hpy188I | | SetI | | |Hin4I Hpy188I | | |Hin4I Hin4I |TfiI | | || Cfr10I MboII SetI Hin4I |HinfI | | || |HpaII \ \ \ \\ \ \ \\ \\ TTGAATATAGGTAAAAACTTTGCCCATTCTGATTCACTATCAGTTCCGAAGGTTAGTGCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTATATCCATTTTTGAAACGGGTAAGACTAAGTGATAGTCAAGGCTTCCAATCACGG / / / / / / / / | SetI Hin4I | HinfI | | Hin4I MboII Hin4I | TfiI | | Hin4I Hpy188I | | SetI | Hpy188I Hin4II* L N I G K N F A H S D S L S V P K V S A * I * V K T L P I L I H Y Q F R R L V P E Y R * K L C P F * F T I S S E G * C R ----:----|----:----|----:----|----:----|----:----|----:----| N F I P L F K A W E S E S D T G F T L A T S Y L Y F S Q G N Q N V I L E S P * H Q I Y T F V K G M R I * * * N R L N T G MaeIII Tsp45I BseRI | Tsp4CI* | PfoI | |HphI | BssKI | || TspRI | EcoRII | || |HphI | | ScrFI | || || MnlI | | BseBI | || || | BetI* | | | TspEI | || || | |HpaII | | | | CviRI* \ \\ \\ \ \\ \ \ \ \ \ GGTGACAGTGGTATATCACCGGAGGAGAGCAAGGCAAGAAGTCCTGGAATTGCAAAACCG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGTCACCATATAGTGGCCTCCTCTCGTTCCGTTCTTCAGGACCTTAACGTTTTGGC /// // / / // / / / // ||| |HphI | MnlI |BetI* BseRI | | |CviRI* ||| | HphI HpaII | | TspEI ||| Tsp4CI* | EcoRII ||| Tsp45I | BssKI ||| MaeIII | PfoI ||TspRI BseBI |Cfr10I ScrFI HpaII G D S G I S P E E S K A R S P G I A K P V T V V Y H R R R A R Q E V L E L Q N R * Q W Y I T G G E Q G K K S W N C K T E ----:----|----:----|----:----|----:----|----:----|----:----| P S L P I D G S S L L A L L G P I A F G R H C H Y I V P P S C P L F D Q F Q L V T V T T Y * R L L A L C S T R S N C F R TfiI BsmI MnlI HinfI \ \ \ AATGCCATACAAACAGAAGTGTATGGAATAAATGAGGAATCTACTAACGAGCGTTTAGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGGTATGTTTGTCTTCACATACCTTATTTACTCCTTAGATGATTGCTCGCAAATCTT / / / BsmI MnlI HinfI TfiI N A I Q T E V Y G I N E E S T N E R L E M P Y K Q K C M E * M R N L L T S V * K C H T N R S V W N K * G I Y * R A F R N ----:----|----:----|----:----|----:----|----:----|----:----| F A M C V S T Y P I F S S D V L S R K S S H W V F L L T H F L H P I * * R A N L I G Y L C F H I S Y I L F R S V L T * F Csp6I |RsaI Hpy178III* || Tsp4CI* | BsrI TspEI CviRI* || | McrI* \ \ \ \ \\ \ \ ATAAATCAAGAAAAACCAGTAAAATTAGATGAGAATAGTGCAAATAGTACGGTCGCATCG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTAGTTCTTTTTGGTCATTTTAATCTACTCTTATCACGTTTATCATGCCAGCGTAGC / / / / //// | BsrI TspEI CviRI* |||McrI* Hpy178III* ||Tsp4CI* |Csp6I RsaI I N Q E K P V K L D E N S A N S T V A S * I K K N Q * N * M R I V Q I V R S H R K S R K T S K I R * E * C K * Y G R I G ----:----|----:----|----:----|----:----|----:----|----:----| I F * S F G T F N S S F L A F L V T A D F L D L F V L L I L H S Y H L Y Y P R M Y I L F F W Y F * I L I T C I T R D C R AcyI MaeII |ZraI ||Hin4I |||SetI CviJI |||TaiI MboI HaeIII |||AatII Hin4I | DdeI |||| CviJI | DpnI | |SfaNI |||| | BslFI | |BstKTI \ \\ \\\\ \ \ \ \\ GCCTTAGATACCAATGGGACGTCAGCCACGACAGAAACTCTAACATCAAAGAAGATCGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAATCTATGGTTACCCTGCAGTCGGTGCTGTCTTTGAGATTGTAGTTTCTTCTAGCAA / / / / / // / / / // / | | SfaNI | | || CviJI BslFI Hin4I || MboI | DdeI | | |MaeII |DpnI HaeIII | | |AcyI BstKTI CviJI | | ZraI | AatII | TaiI | SetI Hin4I A L D T N G T S A T T E T L T S K K I V P * I P M G R Q P R Q K L * H Q R R S F L R Y Q W D V S H D R N S N I K E D R S ----:----|----:----|----:----|----:----|----:----|----:----| A K S V L P V D A V V S V R V D F F I T P R L Y W H S T L W S L F E L M L S S R G * I G I P R * G R C F S * C * L L D N MboI BclI | DpnI | |BstKTI | ||BsgI CviRI* MboII BccI | ||Hpy178III* BtsI | TspRI \ \ \ \\\ \ \ \ CCATCTCCAAAAAAAGTCGCCATTGATCAAGATAAAATAACACTGCACGATGAGAAAACA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGAGGTTTTTTTCAGCGGTAACTAGTTCTATTTTATTGTGACGTGCTACTCTTTTGT / / // / / / / MboII BccI || | | TspRI CviRI* || | | BtsI || | Hpy178III* || BclI || MboI |DpnI |BsgI BstKTI P S P K K V A I D Q D K I T L H D E K T H L Q K K S P L I K I K * H C T M R K H I S K K S R H * S R * N N T A R * E N T ----:----|----:----|----:----|----:----|----:----|----:----| G D G F F T A M S * S L I V S C S S F V E M E L F L R W Q D L Y F L V A R H S F W R W F F D G N I L I F Y C Q V I L F C Hpy188I | Hin4II* | | Bce83I* CviRI* | | | AcyI | SetI Hin4II* | | | | BbvII* | |TaqI | CviJI | | | | | TspDTI | |AsuII | | SfaNI | | | | | |MnlI \ \\ \ \ \ \ \ \ \ \ \\ CTTGCACCTTCGAAGCATCAGCCTATAACATCTGAACAAAAAATGAAGGAAGACGCCGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTGGAAGCTTCGTAGTCGGATATTGTAGACTTGTTTTTTACTTCCTTCTGCGGCTG // / / / / / / / // / / |SetI | | CviJI | | | Bce83I* || | BbvII* CviRI* | Hin4II* | | Hin4II* || | MboII AsuII | Hpy188I || SetI TaqI SfaNI || MnlI |TspDTI AcyI L A P S K H Q P I T S E Q K M K E D A D L H L R S I S L * H L N K K * R K T P T C T F E A S A Y N I * T K N E G R R R P ----:----|----:----|----:----|----:----|----:----|----:----| S A G E F C * G I V D S C F I F S S A S V Q V K S A D A * L M Q V F F S P L R R K C R R L M L R Y C R F L F H L F V G V SmlI HgaI MboII |SetI ||BccI TaqI ||Hpy178III* |MnlI ||| MnlI || BdaI ||| | BsaBI || BdaI ||| | |BseGI || | Bce83I* ||| | || HphI || | | AluI ||| | || | MseI || | | CviJI ||| | || | | FokI || | | PvuII ||| | || | | | MaeIII || | | NspBII* SmlI ||| | || | | | Tsp45I SetI || | | | SetI |SetI \\\ \ \\ \ \ \ \ \ \\ \ \ \ \ \\ CTCAAGAGGATGGAAATCTTAAAGTCACCTCATTTGTCGAAAAGTCCAGCTGACAGACCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GAGTTCTCCTACCTTTAGAATTTCAGTGGAGTAAACAGCTTTTCAGGTCGACTGTCTGGA /// / // / / // / /// / / / / ||| | || HphI | || Tsp45I ||| | | | SetI ||| | |BsaBI | || MaeIII ||| | | NspBII* ||| | BseGI | |SetI ||| | | PvuII ||| MnlI | FokI ||| | | CviJI ||HgaI MseI ||| | | AluI |Hpy178III* ||| | SetI |SmlI ||| Bce83I* BccI ||TaqI |BdaI |BdaI MnlI L K R M E I L K S P H L S K S P A D R P S R G W K S * S H L I C R K V Q L T D L Q E D G N L K V T S F V E K S S * Q T S ----:----|----:----|----:----|----:----|----:----|----:----| R L L I S I K F D G * K D F L G A S L G G * S S P F R L T V E N T S F D L Q C V E L P H F D * L * R M Q R F T W S V S R BdaI BdaI | CviJI | | ApoI | | TspEI MboII MnlI | | | XmnI MaeI |TspDTI \ \ \ \ \ \ \\ CAAGGGCGTAGAAACAGCCGAAATTTTTCCACTAGAGATGAAGAAACTACAAAACTTGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCCGCATCTTTGTCGGCTTTAAAAAGGTGATCTCTACTTCTTTGATGTTTTGAACGA / / / / // / / | MnlI BdaI CviJI |TspEI MaeI TspDTI SmlI BdaI |ApoI MboII XmnI Q G R R N S R N F S T R D E E T T K L A K G V E T A E I F P L E M K K L Q N L L R A * K Q P K F F H * R * R N Y K T C F ----:----|----:----|----:----|----:----|----:----|----:----| * P R L F L R F K E V L S S S V V F S A E L A Y F C G F N K W * L H L F * L V Q L P T S V A S I K G S S I F F S C F K S CviJI Hpy178III* Hin4II* HaeIII TspDTI |TaqI \ \ \ \\ TTTCTTGTTGAATATGAAGGCCAAGAAAACAACTATAACTCTACTTCTCGAAGCACAGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGAACAACTTATACTTCCGGTTCTTTTGTTGATATTGAGATGAAGAGCTTCGTGTCTT / / / // Hin4II* HaeIII TspDTI |TaqI CviJI Hpy178III* F L V E Y E G Q E N N Y N S T S R S T E F L L N M K A K K T T I T L L L E A Q K S C * I * R P R K Q L * L Y F S K H R K ----:----|----:----|----:----|----:----|----:----|----:----| K R T S Y S P W S F L * L E V E R L V S K E Q Q I H L G L F C S Y S * K E F C L K K N F I F A L F V V I V R S R S A C F HphI CviRI* |TspEI | TspDTI || MnlI \ \ \\ \ AAGAAAAATGATATGAACACTTCTGCAAAGAATAAAAATGGTGAAAACAAGAAAATTGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTACTATACTTGTGAAGACGTTTCTTATTTTTACCACTTTTGTTCTTTTAACCA // / / / |TspDTI | | TspEI CviRI* | MnlI HphI K K N D M N T S A K N K N G E N K K I G R K M I * T L L Q R I K M V K T R K L V E K * Y E H F C K E * K W * K Q E N W * ----:----|----:----|----:----|----:----|----:----|----:----| F F F S I F V E A F F L F P S F L F I P F S F H Y S C K Q L S Y F H H F C S F Q L F I I H V S R C L I F I T F V L F N T FatI BspHI |CviAII |Hpy178III* || NlaIII || | SduI || | HgiAI* || | | TspRI || | | |AluI || | | |CviJI || | | || SetI || | | || | MaeII || | | || | |BsaAI CviJI || | | || | || SetI HaeIII || | | || | || TaiI |AciI || | | || | || |Hpy166II |BisI || | | || | || || MaeIII ||BlsI || | | || | || || | Eco57I |||TauI || | | || | || || | Eco57MI \\\\ \\ \ \ \\ \ \\ \\ \ \ AAGAGGCCGCCTGAAATCATGAGCACTGAAGCTCACGTAAACAAAGTAACCGAAGAAACC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCCGGCGGACTTTAGTACTCGTGACTTCGAGTGCATTTGTTTCATTGGCTTCTTTGG //// / // / / / // / / / |||AciI | |HgiAI* | | | || | | MaeIII ||BisI | |BspHI | | | || | Eco57MI |BlsI | |TspRI | | | || | Eco57I HaeIII | |FatI | | | || Hpy166II CviJI | |SduI | | | |MaeII TauI | | | | | BsaAI | | | | TaiI | | | | SetI | | | CviJI | | | AluI | | SetI | Hpy178III* | CviAII NlaIII K R P P E I M S T E A H V N K V T E E T R G R L K S * A L K L T * T K * P K K P E A A * N H E H * S S R K Q S N R R N H ----:----|----:----|----:----|----:----|----:----|----:----| L L G G S I M L V S A * T F L T V S S V Y S A A Q F * S C Q L E R L C L L R L F L P R R F D H A S F S V Y V F Y G F F G Csp6I Hpy166II TatI |RsaI |Csp6I MboII || BccI TaqI ||RsaI \ \\ \ \ \\\ ACAAAGCAGATACAGAGTGTACGAATAGATGGTCGAAAAGTGCTTCAAAAAGTACAAGGA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTCGTCTATGTCTCACATGCTTATCTACCAGCTTTTCACGAAGTTTTTCATGTTCCT / /// / / /// MboII ||| BccI TaqI ||TatI ||Csp6I |Csp6I |RsaI RsaI Hpy166II T K Q I Q S V R I D G R K V L Q K V Q G Q S R Y R V Y E * M V E K C F K K Y K E K A D T E C T N R W S K S A S K S T R R ----:----|----:----|----:----|----:----|----:----|----:----| V F C I C L T R I S P R F T S * F T C P W L A S V S H V F L H D F L A E F L V L C L L Y L T Y S Y I T S F H K L F Y L S BccI | AsuI* | DraII | |CviJI | |HaeIII | |BmgT120I | ||NlaIV TfiI | |||BseYI HinfI | |||| AluI TfiI | TaqI | |||| GsaI HinfI | |Hpy178III* MaeIII MnlI | |||| CviJI \ \ \\ \ \ \ \\\\ \ GAATCCCACATTGATTCGAGAAACAATACCCTGAATGTTACACCATCAAAGAGGCCCCAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGGTGTAACTAAGCTCTTTGTTATGGGACTTACAATGTGGTAGTTTCTCCGGGGTC / / // / / / /// / / HinfI | |Hpy178III* | MnlI | ||| | BseYI TfiI | TaqI MaeIII | ||| | CviJI HinfI | ||| | AluI TfiI | ||| BsiYI* | ||| SetI | ||DraII | ||AsuI* | ||GsaI | |BmgT120I | |NlaIV | HaeIII | CviJI BccI E S H I D S R N N T L N V T P S K R P Q N P T L I R E T I P * M L H H Q R G P S I P H * F E K Q Y P E C Y T I K E A P A ----:----|----:----|----:----|----:----|----:----|----:----| S D W M S E L F L V R F T V G D F L G W L I G C Q N S F C Y G S H * V M L S A G F G V N I R S V I G Q I N C W * L P G L CviJI |TspDTI MaeI |Hin4II* BsiYI* TfiI || EcoNI |SetI HinfI || | BsiYI* TspDTI \\ \ \\ \ \ \ CTAGGAGAAATACCGAATCCTATGAAAAAGCATAAGCCTAATGAAGGGCGAACTCCAAAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCTCTTTATGGCTTAGGATACTTTTTCGTATTCGGATTACTTCCCGCTTGAGGTTTA / / // / / / MaeI HinfI || | EcoNI TspDTI TfiI || BsiYI* |Hin4II* |CviJI TspDTI L G E I P N P M K K H K P N E G R T P N * E K Y R I L * K S I S L M K G E L Q I R R N T E S Y E K A * A * * R A N S K Y ----:----|----:----|----:----|----:----|----:----|----:----| S P S I G F G I F F C L G L S P R V G F A L L F V S D * S F A Y A * H L A F E L * S F Y R I R H F L M L R I F P S S W I FokI | Tsp4CI* CviJI | |Csp6I | DdeI | ||RsaI BseGI TspEI | SauI* TspEI \ \\\ \ \ \ \ \ ATCTCAAACGGTACAATAAACATCCAAAAGAAATTAGAGCCTAAGGAAATTGTGCGAGAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGTTTGCCATGTTATTTGTAGGTTTTCTTTAATCTCGGATTCCTTTAACACGCTCTA / /// / / / / / | ||| BseGI | | SauI* TspEI | ||Csp6I | | DdeI | |RsaI | CviJI | FokI TspEI Tsp4CI* I S N G T I N I Q K K L E P K E I V R D S Q T V Q * T S K R N * S L R K L C E I L K R Y N K H P K E I R A * G N C A R Y ----:----|----:----|----:----|----:----|----:----|----:----| I E F P V I F M W F F N S G L S I T R S Y R L R Y L L C G F S I L A * P F Q A L D * V T C Y V D L L F * L R L F N H S I TfiI HinfI CviJI MseI CviRI* | MnlI |DdeI |AhaIII* \ \ \ \\ \\ ATTTTGCATACGAAAGAATCATCAAATGAGGCTAAGAAAACTATTCAAAACCCTTTAAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAACGTATGCTTTCTTAGTAGTTTACTCCGATTCTTTTGATAAGTTTTGGGAAATTTA / // / / /// CviRI* |MnlI | DdeI ||TstI HinfI CviJI |MseI TfiI AhaIII* I L H T K E S S N E A K K T I Q N P L N F C I R K N H Q M R L R K L F K T L * I F A Y E R I I K * G * E N Y S K P F K * ----:----|----:----|----:----|----:----|----:----|----:----| I K C V F S D D F S A L F V I * F G K F Y K A Y S L I M L H P * S F * E F G K L N Q M R F F * * I L S L F S N L V R * I TspRI Hin4II* MboII | SapI | TstI TstI |BtsI | Ksp632I* | |MaeIII TspEI \ \\ \ \ \ \\ \ AAATCACAAAACACTGCTCTTCCTTCCACACATAAAGTTACACAAAAAAAAGATATAAAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTGTTTTGTGACGAGAAGGAAGGTGTGTATTTCAATGTGTTTTTTTTCTATATTTT / / // / / TspRI | |Hin4II* MaeIII BdaI MboII | TstI BdaI BtsI Ksp632I* SapI K S Q N T A L P S T H K V T Q K K D I K N H K T L L F L P H I K L H K K K I * K I T K H C S S F H T * S Y T K K R Y K N ----:----|----:----|----:----|----:----|----:----|----:----| L D C F V A R G E V C L T V C F F S I F Y I V F C Q E E K W V Y L * V F F L Y L F * L V S S K R G C M F N C L F F I Y F SetI | EcoNI DdeI | | BsiYI* | Hpy188I | | | SetI | | MnlI BdaI | | | | TfiI BdaI | | | BssKI BdaI | | | | HinfI BdaI | | | |HpaII \ \ \ \ \ \ \ \ \ \ \\ ATTGGAACTAATGACCTTTTTCAGGTTGAATCTGCTCCAAAAATATCCTCAGAGATTGAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCTTGATTACTGGAAAAAGTCCAACTTAGACGAGGTTTTTATAGGAGTCTCTAACTG / / / / / / / // / // TspEI SetI | | SetI | BdaI |DdeI | |BseMII | EcoNI | BdaI | | BspCNI BsiYI* HinfI | MnlI TfiI Hpy188I I G T N D L F Q V E S A P K I S S E I D L E L M T F F R L N L L Q K Y P Q R L T W N * * P F S G * I C S K N I L R D * P ----:----|----:----|----:----|----:----|----:----|----:----| I P V L S R K * T S D A G F I D E S I S F Q F * H G K E P Q I Q E L F I R L S Q N S S I V K K L N F R S W F Y G * L N V FokI |StyI AgeI |SecI* ScrFI BetI* || TspDTI CauII* BseGI || |FalI BspCNI Cfr10I || |FalI |BseMII MseI |HpaII || ||CviJI \\ \ \\ \\ \\\ CGGGAGAATGTTAAATCAAAGGATGAACCGGTTTCCAAGGCTGTTGAAAGCAAATCTTTA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GCCCTCTTACAATTTAGTTTCCTACTTGGCCAAAGGTTCCGACAACTTTCGTTTAGAAAT / / / / // / / /// | BssKI MseI | || | | ||CviJI CauII* | || | | |SecI* HpaII | || | | |StyI ScrFI | || | | FokI | || | TspDTI | || FalI | || FalI | |Cfr10I | |BetI* | |AgeI | HpaII BseGI R E N V K S K D E P V S K A V E S K S L G R M L N Q R M N R F P R L L K A N L Y G E C * I K G * T G F Q G C * K Q I F I ----:----|----:----|----:----|----:----|----:----|----:----| R S F T L D F S S G T E L A T S L L D K G P S H * I L P H V P K W P Q Q F C I K P L I N F * L I F R N G L S N F A F R * MaeII | Csp6I | |RsaI MseI | |SetI | ApoI | |TaiI | TspEI | || SmlI SetI | | Bce83I* | || | TspDTI MseI SfaNI | | | FalI | || | | CviJI |FalI |Hin4I | | | FalI | || | | |NlaIV |FalI |Hin4I \ \ \ \ \ \\ \ \ \\ \\ \\ TTAAATTTGTTTTCAAACGTACTCAAGGCTCCTTTCATTAAAAGTGAAAGCAAACCTTTT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTAAACAAAAGTTTGCATGAGTTCCGAGGAAAGTAATTTTCACTTTCGTTTGGAAAA / /// / //// / // / / / | ||TspEI | |||| | || FalI MseI Hin4I | ||ApoI | |||| | || FalI Hin4I | |FalI | |||| | |NlaIV SetI | |FalI | |||| | CviJI | Bce83I* | |||| SmlI MseI | |||TspDTI | ||Csp6I | |RsaI | MaeII TaiI SetI L N L F S N V L K A P F I K S E S K P F * I C F Q T Y S R L L S L K V K A N L F K F V F K R T Q G S F H * K * K Q T F F ----:----|----:----|----:----|----:----|----:----|----:----| N F K N E F T S L A G K M L L S L L G K I L N T K L R V * P E K * * F H F C V K * I Q K * V Y E L S R E N F T F A F R K CviJI | TspEI FalI | Hin4I MaeI FalI | Hin4I BstXI TspRI \ \ \ \ \ \ TCTAGTGATGCTCTGTCAAAAGAAAAAGCCAATTTTTTGGAAACTATCGCTTCCACTGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCACTACGAGACAGTTTTCTTTTTCGGTTAAAAAACCTTTGATAGCGAAGGTGACTT / / / / / / / / | | FalI | | | TspEI TspRI | | FalI | | BstXI | MaeI | CviJI SfaNI Hin4I Hin4I S S D A L S K E K A N F L E T I A S T E L V M L C Q K K K P I F W K L S L P L K * * C S V K R K S Q F F G N Y R F H * K ----:----|----:----|----:----|----:----|----:----|----:----| E L S A R D F S F A L K K S V I A E V S K * H H E T L L F L W N K P F * R K W Q R T I S Q * F F F G I K Q F S D S G S F BsmAI | DdeI | | CviJI | | |BsrI BspCNI Hin4I | | || Hin4I |CviRI* FatI CviJI Hin4I SetI | | || Hin4I |BseMII |CviAII \ \ \ \ \ \\ \ \\ \\ AAGCCAGAAAATAAGACTGATAAGGTGTCTCTATCTCAGCCAGTTAGTGCAAGTAAGCAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGTCTTTTATTCTGACTATTCCACAGAGATAGAGTCGGTCAATCACGTTCATTCGTA / / / //// // / / / | Hin4I SetI |||CviJI || CviRI* | CviAII | Hin4I ||DdeI |BseMII NlaIII CviJI ||BsrI BspCNI |Hin4I |Hin4I BsmAI K P E N K T D K V S L S Q P V S A S K H S Q K I R L I R C L Y L S Q L V Q V S M A R K * D * * G V S I S A S * C K * A * ----:----|----:----|----:----|----:----|----:----|----:----| F G S F L V S L T D R D * G T L A L L C F A L F Y S Q Y P T E I E A L * H L Y A L W F I L S I L H R * R L W N T C T L M Hin4II* NlaIII TspEI BsrI SetI | XmnI MnlI \ \ \ \ \ \ \ GAGTATAGCGATAATTTTCCAGTTTCTCTATCTCAACCTTCAAAGAAATCTTTCGCAAAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATATCGCTATTAAAAGGTCAAAGAGATAGAGTTGGAAGTTTCTTTAGAAAGCGTTTA / // / / / / FatI |BsrI SetI | XmnI MnlI TspEI Hin4II* E Y S D N F P V S L S Q P S K K S F A N S I A I I F Q F L Y L N L Q R N L S Q I V * R * F S S F S I S T F K E I F R K S ----:----|----:----|----:----|----:----|----:----|----:----| S Y L S L K G T E R D * G E F F D K A F H T Y R Y N E L K E I E V K L S I K R L L I A I I K W N R * R L R * L F R E C I MboI BglII XhoII | DpnI BseGI | |BstKTI | TspEI | || SecI* | | FokI | || DsaI* | | |BceAI | || | MboII Hin4I HphI \ \ \\ \ \\ \ \ \ \ CATACAGAGGATGAGCAAATTGAAAAAAAGAAGATCTGCCGTGGGAGAATGAATACGATA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGTCTCCTACTCGTTTAACTTTTTTTCTTCTAGACGGCACCCTCTTACTTATGCTAT / / // // / / / / BseGI | |FokI || | | DsaI* HphI | BceAI || | | SecI* TspEI || | | Hin4I || | MboII || XhoII || BglII || MboI |DpnI BstKTI H T E D E Q I E K K K I C R G R M N T I I Q R M S K L K K R R S A V G E * I R * Y R G * A N * K K E D L P W E N E Y D N ----:----|----:----|----:----|----:----|----:----|----:----| * V S S S C I S F F F I Q R P L I F V I D Y L P H A F Q F F S S R G H S F S Y S M C L I L L N F F L L D A T P S H I R Y Hin4I | AluI | CviJI | | SetI | | | AccI | | | |BssNAI | | | |Hpy166II | | | || MaeII | | | || AflIII | | | || |BsaAI | | | || ||MlyI TspDTI | | | || ||PleI | BssKI | | | || |||SetI | |AvaI | | | || |||TaiI | |BssKI | | | || |||| Hpy188I | |SecI* | | | || |||| |HinfI | |Cfr9I | | | || |||| ||Eco57I | ||HpaII | | | || |||| ||Eco57MI | ||ScrFI | | | || |||| |||DdeI | ||CauII* | | | || |||| |||| MboII | ||BmeT110I | | | || |||| |||| |Hpy188I | |||SmaI | | | || |||| |||| || MboII BspCNI | |||ScrFI | | | || |||| |||| || | TfiI |BseMII | |||CauII* | | | || |||| |||| || | HinfI || Hpy188I \ \\\\ \ \ \ \\ \\\\ \\\\ \\ \ \ \\ \ ATAACTCACCCGGGAAAAATGGAGCTGGTATACGTGTCCGACTCAGACGATTCTTCTTCA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGAGTGGGCCCTTTTTACCTCGACCATATGCACAGGCTGAGTCTGCTAAGAAGAAGT / ///// / / // //// // //// /// // TspDTI ||||Hin4I | CviJI || |||| || |||MboII ||| |MmeI |||BssKI | AluI || |||| || ||DdeI ||| Hpy188I ||Cfr9I SetI || |||| || |Hpy188I ||BseMII ||BssKI || |||| || HinfI |BspCNI ||SecI* || |||| || MboII HinfI ||AvaI || |||| |Eco57MI TfiI |BmeT110I || |||| |Eco57I |CauII* || |||| Hpy188I |HpaII || |||AflIII |ScrFI || ||PleI CauII* || |MaeII ScrFI || |MlyI SmaI || BsaAI |AccI |TaiI |SetI Hpy166II BssNAI I T H P G K M E L V Y V S D S D D S S S * L T R E K W S W Y T C P T Q T I L L Q N S P G K N G A G I R V R L R R F F F R ----:----|----:----|----:----|----:----|----:----|----:----| I V * G P F I S S T Y T D S E S S E E E L L E G P F F P A P I R T R S L R N K K Y S V R S F H L Q Y V H G V * V I R R * MseI | AluI | CviJI TfiI MmeI CviJI | | SetI HinfI HphI MaeIII \ \ \ \ \ \ \ \ GATAATGATAGCCTAACTGACTTGGAAAGTTTAAGCTCTGGTGAATCAAATGAAATCAAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTACTATCGGATTGACTGAACCTTTCAAATTCGAGACCACTTAGTTTACTTTAGTTT / / / / / CviJI | CviJI | HphI | AluI HinfI MseI TfiI SetI D N D S L T D L E S L S S G E S N E I K I M I A * L T W K V * A L V N Q M K S K * * * P N * L G K F K L W * I K * N Q S ----:----|----:----|----:----|----:----|----:----|----:----| S L S L R V S K S L K L E P S D F S I L L Y H Y G L Q S P F N L S Q H I L H F * I I I A * S V Q F T * A R T F * I F D F AsuI* AvaII |BmgT120I || ApoI || TspEI || | BsiYI* BinI* TspDTI || | | Cac8I | MboI \ \\ \ \ \ \ \ GTAACTAATGATTTAGATACAAGTGCTGAAAAGGACCAAATTCAGGCAGGCAAATGGTTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGATTACTAAATCTATGTTCACGACTTTTCCTGGTTTAAGTCCGTCCGTTTACCAAA / / // / / / / | MaeIII || | TspEI Cac8I BinI* TspDTI || | ApoI || BsiYI* |AvaII |AsuI* BmgT120I V T N D L D T S A E K D Q I Q A G K W F * L M I * I Q V L K R T K F R Q A N G L N * * F R Y K C * K G P N S G R Q M V * ----:----|----:----|----:----|----:----|----:----|----:----| T V L S K S V L A S F S W I * A P L H N L L * H N L Y L H Q F P G F E P L C I T Y S I I * I C T S F L V L N L C A F P K MboI Hpy188I | DpnI | |BstKTI DpnI | ||Hpy178III* |BstKTI | ||| TspEI MnlI \\ \ \\\ \ \ GATCCTGTATTGGATTGGCGAAAATCTGATCGTGAATTGACGAAAAACATTCTTTGGAGG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGACATAACCTAACCGCTTTTAGACTAGCACTTAACTGCTTTTTGTAAGAAACCTCC // / / // / / / / || MboI | || | | TspEI MnlI |DpnI | || | Hpy178III* BstKTI | || MboI | |DpnI | BstKTI Hpy188I D P V L D W R K S D R E L T K N I L W R I L Y W I G E N L I V N * R K T F F G G S C I G L A K I * S * I D E K H S L E D ----:----|----:----|----:----|----:----|----:----|----:----| S G T N S Q R F D S R S N V F F M R Q L Q D Q I P N A F I Q D H I S S F C E K S I R Y Q I P S F R I T F Q R F V N K P P BinI* | MboI | BamHI | XhoII AluI | | DpnI CviJI AloI | | NlaIV | SetI | SetI | | |BstKTI \ \ \ \ \ \ \\ ATAGCTGATAAAACGACATACGATAAAGAAACAATAACTGACCTTATTGAACAAGGGATC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGACTATTTTGCTGTATGCTATTTCTTTGTTATTGACTGGAATAACTTGTTCCCTAG / / / / / // / | CviJI | SetI | || XhoII | AluI AloI | || BamHI SetI | || MboI | |NlaIV | |DpnI | BstKTI BinI* I A D K T T Y D K E T I T D L I E Q G I * L I K R H T I K K Q * L T L L N K G S S * * N D I R * R N N N * P Y * T R D P ----:----|----:----|----:----|----:----|----:----|----:----| I A S L V V Y S L S V I V S R I S C P I S L Q Y F S M R Y L F L L Q G * Q V L S Y S I F R C V I F F C Y S V K N F L P D MseI | SpeI | |MaeI | || MaeIII AloI | || Tsp45I BinI* | MseI | || |Hin4I \ \ \ \ \\ \\ CCAAAACATAGTTATTTAAGTGGCAATCCATTAACTAGTGTGACTAACGACATTTGCTCT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTGTATCAATAAATTCACCGTTAGGTAATTGATCACACTGATTGCTGTAAACGAGA / / / / / // / | AloI MseI | | |SpeI Tsp45I BinI* | | MaeI MaeIII | Hin4I MseI P K H S Y L S G N P L T S V T N D I C S Q N I V I * V A I H * L V * L T T F A L K T * L F K W Q S I N * C D * R H L L C ----:----|----:----|----:----|----:----|----:----|----:----| G F C L * K L P L G N V L T V L S M Q E G L V Y N N L H C D M L * H S * R C K S W F M T I * T A I W * S T H S V V N A R ApaLI | CviRI* | Hin4II* | Hpy166II | | SduI | | BseSI Hin4I TspDTI | | HgiAI* \ \ \ \ \ GTTGAAAACTATGAAACATCAAGTGCTTTCTTTTACCAACAAGTGCACAAGAAGGACAGA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTTTGATACTTTGTAGTTCACGAAAGAAAATGGTTGTTCACGTGTTCTTCCTGTCT / / /// / Hin4I TspDTI ||| ApaLI ||Hpy166II ||CviRI* |Hin4II* HgiAI* BseSI SduI V E N Y E T S S A F F Y Q Q V H K K D R L K T M K H Q V L S F T N K C T R R T D * K L * N I K C F L L P T S A Q E G Q I ----:----|----:----|----:----|----:----|----:----|----:----| T S F * S V D L A K K * W C T C L F S L Q Q F S H F M L H K R K G V L A C S P C N F V I F C * T S E K V L L H V L L V S SspI CviRI* TspRI \ \ \ TTACAATATTTGCCATTATATGCAGTTTCTACATTTGAAAACACAAATAACACTGAAAAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTATAAACGGTAATATACGTCAAAGATGTAAACTTTTGTGTTTATTGTGACTTTTT / / / SspI CviRI* TspRI L Q Y L P L Y A V S T F E N T N N T E K Y N I C H Y M Q F L H L K T Q I T L K K T I F A I I C S F Y I * K H K * H * K K ----:----|----:----|----:----|----:----|----:----|----:----| N C Y K G N Y A T E V N S F V F L V S F I V I N A M I H L K * M Q F C L Y C Q F * L I Q W * I C N R C K F V C I V S F F MboII | MboII | |ApoI | |TspEI MaeIII | || TsoI Tsp45I CviJI | || | FokI \ \ \ \\ \ \ AATGATGTGACCAATAAAAATATCAATATAGGGAAACATAGCCAAGAACAAAATTCTTCT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACACTGGTTATTTTTATAGTTATATCCCTTTGTATCGGTTCTTGTTTTAAGAAGA / / / / / / Tsp45I | | | | TspEI MaeIII | | | | ApoI | | | TsoI | | MboII | MboII CviJI N D V T N K N I N I G K H S Q E Q N S S M M * P I K I S I * G N I A K N K I L L * C D Q * K Y Q Y R E T * P R T K F F F ----:----|----:----|----:----|----:----|----:----|----:----| F S T V L L F I L I P F C L W S C F E E F H H S W Y F Y * Y L S V Y G L V F N K I I H G I F I D I Y P F M A L F L I R R TfiI BseGI HinfI | AjuI | MmeI | | ApoI MboII | |TaqI | | TspEI BbvII* | |AjuI AluI AciI | | |BccI | Tsp4CI* | |AsuII CviJI \ \ \ \\ \ \ \ \\ \ TCCGCTAAACCATCCCAAATTCCAACCGTGTCTTCTCCATTAGGATTCGAAGAAACAAAG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGATTTGGTAGGGTTTAAGGTTGGCACAGAAGAGGTAATCCTAAGCTTCTTTGTTTC / / / / / // // / / / / / / | | | AjuI | || |BbvII* | | | AsuII | MboII | | BseGI | || Tsp4CI* | | | TaqI | CviJI | AciI | |MboII | | HinfI | AluI FokI | TspEI | | TfiI SetI | ApoI | MmeI BccI AjuI S A K P S Q I P T V S S P L G F E E T K P L N H P K F Q P C L L H * D S K K Q S R * T I P N S N R V F S I R I R R N K A ----:----|----:----|----:----|----:----|----:----|----:----| E A L G D W I G V T D E G N P N S S V F K R * V M G F E L R T K E M L I R L F L G S F W G L N W G H R R W * S E F F C L DdeI MboII |SetI || Csp6I TspEI || |RsaI Ksp632I* MboII | MaeI \\ \\ \ \ \ \ CTAAGTACCACGCCTACTAAAAGCAATAGAAGAGTGTCGCATAGTGATACTAATTCTAGC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCATGGTGCGGATGATTTTCGTTATCTTCTCACAGCGTATCACTATGATTAAGATCG / // / / / / | |Csp6I Ksp632I* MboII | MaeI | RsaI TspEI DdeI L S T T P T K S N R R V S H S D T N S S * V P R L L K A I E E C R I V I L I L A K Y H A Y * K Q * K S V A * * Y * F * Q ----:----|----:----|----:----|----:----|----:----|----:----| S L V V G V L L L L L T D C L S V L E L A L Y W A * * F C Y F L T A Y H Y * N * * T G R R S F A I S S H R M T I S I R A MnlI MwoI AluI | CviJI CviJI | | Cac8I | SetI | | | CviRI* | |FalI | | | | ApoI Hin4II* SetI | |FalI | | | | TspEI \ \ \ \\ \ \ \ \ \ AAACCCAAAAACACGAAGGAGAACCTTTCAAAAAGCTCTTGGAGGCAAGAATGGCTTGCA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGGTTTTTGTGCTTCCTCTTGGAAAGTTTTTCGAGAACCTCCGTTCTTACCGAACGT / / /// / / / / Hin4II* SetI ||CviJI MwoI | | CviRI* ||AluI | Cac8I |MnlI CviJI SetI FalI FalI K P K N T K E N L S K S S W R Q E W L A N P K T R R R T F Q K A L G G K N G L Q T Q K H E G E P F K K L L E A R M A C K ----:----|----:----|----:----|----:----|----:----|----:----| L G L F V F S F R E F L E Q L C S H S A C V W F C S P S G K L F S K S A L I A Q F G F V R L L V K * F A R P P L F P K C Hpy188I | AluI | CviJI | | SetI TspGWI | | Hin4II* | FalI | | | Hpy188I | FalI | | | | Tsp4CI* \ \ \ \ \ \ \ AATTTGAAACTTATTTCCGTTTCGTTGGTTGATGAGTTCCCTTCGGAGCTTTCCGACAGT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACTTTGAATAAAGGCAAAGCAACCAACTACTCAAGGGAAGCCTCGAAAGGCTGTCA // / / // // / |FalI | | || || Tsp4CI* |FalI | | || |TspRI TspGWI | | || Hpy188I TspEI | | |Hin4II* ApoI | | CviJI | | AluI | SetI Hpy188I N L K L I S V S L V D E F P S E L S D S I * N L F P F R W L M S S L R S F P T V F E T Y F R F V G * * V P F G A F R Q * ----:----|----:----|----:----|----:----|----:----|----:----| F K F S I E T E N T S S N G E S S E S L L N S V * K R K T P Q H T G K P A K R C I Q F K N G N R Q N I L E R R L K G V T TspEI CviRI* | MseI | MaeIII MseI TspRI | | MmeI | | MseI SetI \ \ \ \ \ \ \ \ GATAGACAAATAATTAACGAAAAAATGCAGTTACTTAAAGATATATTTGCTAACAACCTT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCTGTTTATTAATTGCTTTTTTACGTCAATGAATTTCTATATAAACGATTGTTGGAA // / / / / |MseI CviRI* | MseI SetI TspEI MaeIII MmeI D R Q I I N E K M Q L L K D I F A N N L I D K * L T K K C S Y L K I Y L L T T L * T N N * R K N A V T * R Y I C * Q P * ----:----|----:----|----:----|----:----|----:----|----:----| S L C I I L S F I C N S L S I N A L L R H Y V F L * R F F A T V * L Y I Q * C G I S L Y N V F F H L * K F I Y K S V V K MaeIII TspEI TspEI Tsp45I SetI \ \ \ \ AAATCAGCAATTTCCAATAATTTTAGAGAGAGTGACATCATTATACTGAAAGGTGAAATA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTCGTTAAAGGTTATTAAAATCTCTCTCACTGTAGTAATATGACTTTCCACTTTAT / / / / / MseI TspEI TspEI Tsp45I SetI MaeIII K S A I S N N F R E S D I I I L K G E I N Q Q F P I I L E R V T S L Y * K V K * I S N F Q * F * R E * H H Y T E R * N R ----:----|----:----|----:----|----:----|----:----|----:----| L D A I E L L K L S L S M M I S F P S I * I L L K W Y N * L S H C * * V S L H F F * C N G I I K S L T V D N Y Q F T F Y Hpy188I | TspEI HphI MboII | | MseI TspEI SfaNI CviJI \ \ \ \ \ \ \ \ GAAGATTACCCAATGAGTTCTGAAATTAAGATTTACTACAACGAATTACAGAACAAGCCT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTAATGGGTTACTCAAGACTTTAATTCTAAATGATGTTGCTTAATGTCTTGTTCGGA / / / // / / / HphI MboII | |MseI TspEI | CviJI | TspEI SfaNI Hpy188I E D Y P M S S E I K I Y Y N E L Q N K P K I T Q * V L K L R F T T T N Y R T S L R L P N E F * N * D L L Q R I T E Q A * ----:----|----:----|----:----|----:----|----:----|----:----| S S * G I L E S I L I * * L S N C F L G L L N G L S N Q F * S K S C R I V S C A F I V W H T R F N L N V V V F * L V L R HinfI | DdeI | | BbvII* | | |Hpy188I | | || MboII | | || |TspDTI | | || || BspCNI | | || || |BseMII CviRI* | | || || || FatI | MwoI PflMI MlyI | | || || || |CviAII | | CviJI BsiYI* PleI | | || || || || NlaIII \ \ \ \ \ \ \ \\ \\ \\ \\ \ GATGCAAAAAAAGCCAGATTTTGGTCATTTATGAAGACTCAGAGATTTGTTTCCAACATG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGTTTTTTTCGGTCTAAAACCAGTAAATACTTCTGAGTCTCTAAACAAAGGTTGTAC / / / / // /// / // / // | MwoI | BsiYI* |PleI ||| | || | |FatI CviRI* | PflMI MlyI ||| | || | CviAII CviJI ||| | || NlaIII ||| | |BseMII ||| | BspCNI ||| TspDTI ||| BbvII* ||| MboII ||DdeI |Hpy188I HinfI D A K K A R F W S F M K T Q R F V S N M M Q K K P D F G H L * R L R D L F P T W C K K S Q I L V I Y E D S E I C F Q H G ----:----|----:----|----:----|----:----|----:----|----:----| S A F F A L N Q D N I F V * L N T E L M Q H L F L W I K T M * S S E S I Q K W C I C F F G S K P * K H L S L S K N G V H MaeII |BtrI FatI || SetI AflIII Hpy188I Hpy166II || TaiI BspLU11I* | MmeI | SetI TaqII || | Hpy99I |CviAII \ \ \ \ \ \\ \ \ \\ GGATTTGATATTCAGAAGTCCTGTGAACCTGTTTCTATATCCACGTCGGTCAAACCACAT 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAACTATAAGTCTTCAGGACACTTGGACAAAGATATAGGTGCAGCCAGTTTGGTGTA / / // / //// / / | MmeI |SetI TaqII |||MaeII | CviAII Hpy188I Hpy166II ||BtrI NlaIII |Hpy99I NspI TaiI SetI G F D I Q K S C E P V S I S T S V K P H D L I F R S P V N L F L Y P R R S N H M I * Y S E V L * T C F Y I H V G Q T T C ----:----|----:----|----:----|----:----|----:----|----:----| P N S I * F D Q S G T E I D V D T L G C P I Q Y E S T R H V Q K * I W T P * V V S K I N L L G T F R N R Y G R R D F W M NspI NlaIII | TaqI | | CviJI | | |AvaI | | ||SduI | | ||HgiJII* | | ||BmeT110I | | ||| SfaNI DdeI CviRI* | | ||| | NdeI TspEI SauI* | TspEI \ \ \\\ \ \ \ \ \ \ GTGGTCGAGCCCGAGCATATGGCAGATGCCAAAATTATGCCTAAGGATATACTGCAAATT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CACCAGCTCGGGCTCGTATACCGTCTACGGTTTTAATACGGATTCCTATATGACGTTTAA / / / // / / / / / | | | |AvaI SfaNI TspEI SauI* | TspEI | | | | NdeI DdeI CviRI* | | | BmeT110I | | CviJI | HgiJII* | TaqI | SduI BspLU11I* AflIII FatI V V E P E H M A D A K I M P K D I L Q I W S S P S I W Q M P K L C L R I Y C K L G R A R A Y G R C Q N Y A * G Y T A N Y ----:----|----:----|----:----|----:----|----:----|----:----| T T S G S C I A S A L I I G L S I S C I H P R A R A Y P L H W F * A * P Y V A F H D L G L M H C I G F N H R L I Y Q L N Hin4I TsoI MboII Hin4I | Tsp4CI* | EciI | AciI | | MseI MseI | |CviJI | |Hin4II* \ \ \ \ \ \\ \ \\ ACAAAAAAACCGTTAATGGTTAAAAATGTGAAGCCTTCTTCTCCGCCAGATGTGAAGTCT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTTTTGGCAATTACCAATTTTTACACTTCGGAAGAAGAGGCGGTCTACACTTCAGA / / / / / / / / / / // TsoI | MseI MseI | | | Hin4I | AciI |BspCNI Tsp4CI* | | | Hin4I Hin4II* BseMII | | CviJI | EciI MboII T K K P L M V K N V K P S S P P D V K S Q K N R * W L K M * S L L L R Q M * S L K K T V N G * K C E A F F S A R C E V F ----:----|----:----|----:----|----:----|----:----|----:----| V F F G N I T L F T F G E E G G S T F D * L F V T L P * F H S A K K E A L H S T C F F R * H N F I H L R R R R W I H L R BseMII |BspCNI || TseI || CviRI* || |BisI || ||BlsI || |||AluI || |||CviJI || |||PvuII || |||NspBII* || ||||DdeI || ||||EspI* || |||||SetI || ||||||Hin4I || ||||||Hin4I || ||||||| SduI XmnI || ||||||| HgiAI* TspEI || ||||||| | BbvI BsgI | TaqI Tsp4CI* \\ \\\\\\\ \ \ \ \ \ \ TTGGTGCAGCTGAGCACAATGGAAACGAAAACCCTACCAGAAAAGAAGCAATTCGACAGT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACGTCGACTCGTGTTACCTTTGCTTTTGGGATGGTCTTTTCTTCGTTAAGCTGTCA //// // // / / / / |||| |EspI* |BsgI | | | Tsp4CI* |||| |DdeI BbvI | | TaqI |||| HgiAI* | TspEI |||| SduI XmnI |||NspBII* |||PvuII |||CviJI |||TseI |||AluI ||BisI |Hin4I |Hin4I |BlsI |SetI CviRI* L V Q L S T M E T K T L P E K K Q F D S W C S * A Q W K R K P Y Q K R S N S T V G A A E H N G N E N P T R K E A I R Q Y ----:----|----:----|----:----|----:----|----:----|----:----| K T C S L V I S V F V R G S F F C N S L K P A A S C L P F S F G V L F S A I R C Q H L Q A C H F R F G * W F L L L E V T BssKI SecI* EcoRII | ScrFI Hpy188I MseI | BseBI | SfaNI |TspEI | | BsiYI* Cac8I | | Bce83I* \\ \ \ \ \ \ \ \ ATTTTTAATTCTAACAAAGCAAAAATAATCCCTGGAAATGGGAAGCACGCATCAGAAAAC 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAATTAAGATTGTTTCGTTTTTATTAGGGACCTTTACCCTTCGTGCGTAGTCTTTTG / / /// / / / | TspEI ||EcoRII Cac8I | Bce83I* MseI ||BssKI Hpy188I |BsiYI* |SecI* BseBI ScrFI I F N S N K A K I I P G N G K H A S E N F L I L T K Q K * S L E M G S T H Q K T F * F * Q S K N N P W K W E A R I R K H ----:----|----:----|----:----|----:----|----:----|----:----| I K L E L L A F I I G P F P F C A D S F Y K * N * C L L F L G Q F H S A R M L F N K I R V F C F Y D R S I P L V C * F V HgaI |SmlI || Hpy178III* || | SetI || | PshAI || | | MmeI || | | | BspMI || | | | | CviJI AloI BceAI NlaIV \\ \ \ \ \ \ \ \ \ ATCTCACTCTCTTTCTCAAGACCTGCGTCCTACGGCTATTTTTCTGTTGGAAAAAGGGTT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGTGAGAGAAAGAGTTCTGGACGCAGGATGCCGATAAAAAGACAACCTTTTTCCCAA / // // /// / / SfaNI || |MmeI ||AloI BceAI NlaIV || PshAI |CviJI |SetI BspMI Hpy178III* SmlI HgaI I S L S F S R P A S Y G Y F S V G K R V S H S L S Q D L R P T A I F L L E K G F L T L F L K T C V L R L F F C W K K G S ----:----|----:----|----:----|----:----|----:----|----:----| M E S E K E L G A D * P * K E T P F L T C R V R K R L V Q T R R S N K Q Q F F P D * E R E * S R R G V A I K R N S F P N MboI |AloI ||DpnI |||BstKTI |||| TaqI |||| | Hpy99I |||| | | MboII TaqI Hpy99I Tsp4CI* \\\\ \ \ \ \ \ \ CCAATCGTTGAAGATCGTCGAGTGAAACAACTCGACGATATAACAGACAGTAATACAACA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGCAACTTCTAGCAGCTCACTTTGTTGAGCTGCTATATTGTCTGTCATTATGTTGT / //// // / / / AloI |||| |MboII | TaqI Tsp4CI* |||| TaqI Hpy99I |||MboI ||Hpy99I |DpnI BstKTI P I V E D R R V K Q L D D I T D S N T T Q S L K I V E * N N S T I * Q T V I Q Q N R * R S S S E T T R R Y N R Q * Y N R ----:----|----:----|----:----|----:----|----:----|----:----| G I T S S R R T F C S S S I V S L L V V E L R Q L D D L S V V R R Y L L C Y Y L W D N F I T S H F L E V I Y C V T I C C ApoI HindII TspEI Hpy166II | MseI | MaeII Csp6I | | SpeI | | SetI |RsaI | | |MaeI | | TaiI XmnI |BsrI \ \ \\ \ \ \ \ \\ GAAATTTTAACTAGTGTTGACGTTTTAGGAACACATTCACAAACTGGTACTCAACAATCA 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAAATTGATCACAACTGCAAAATCCTTGTGTAAGTGTTTGACCATGAGTTGTTAGT / / // // / / / // | | || || MaeII XmnI | |Csp6I | | || |TaiI | RsaI | | || |SetI BsrI | | || Hpy166II | | || HindII | | |SpeI | | MaeI | MseI TspEI ApoI E I L T S V D V L G T H S Q T G T Q Q S K F * L V L T F * E H I H K L V L N N Q N F N * C * R F R N T F T N W Y S T I K ----:----|----:----|----:----|----:----|----:----|----:----| S I K V L T S T K P V C E C V P V * C D L F K L * H Q R K L F V N V F Q Y E V I F N * S T N V N * S C M * L S T S L L * TatI Bsp1407I |Csp6I ||RsaI MaeIII |||Hpy166II TspEI HphI Tsp45I \\\\ \ \ \ AATATGTACACATCAACCCAAAAAACAGAACTTGAAATTGATAATAAGGATAGTGTCACC 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACATGTGTAGTTGGGTTTTTTGTCTTGAACTTTAACTATTATTCCTATCACAGTGG /// / / / ||Bsp1407I TspEI HphI Tsp45I ||TatI MaeIII |Hpy166II |Csp6I RsaI N M Y T S T Q K T E L E I D N K D S V T I C T H Q P K K Q N L K L I I R I V S P Y V H I N P K N R T * N * * * G * C H R ----:----|----:----|----:----|----:----|----:----|----:----| F I Y V D V W F V S S S I S L L S L T V L Y T C M L G F F L V Q F Q Y Y P Y H * I H V C * G L F C F K F N I I L I T D G FalI FalI FatI Hin4II* |CviAII EcoRV | TaqI || NlaIII TspDTI |FalI | AsuII || |BccI | MboII |FalI TaqI \ \ \\ \\ \ \ \\ \ GAATGTTCGAAGGACATGAAAGAAGATGGTCTTTCCTTTGTGGATATCGTTTTGTCGAAA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACAAGCTTCCTGTACTTTCTTCTACCAGAAAGGAAACACCTATAGCAAAACAGCTTT / / / // / / / / / / | | | || BccI | MboII | EcoRV TaqI | | | |FatI TspDTI FalI | | | CviAII FalI | | NlaIII | AsuII | TaqI | FalI | FalI Hin4II* E C S K D M K E D G L S F V D I V L S K N V R R T * K K M V F P L W I S F C R K M F E G H E R R W S F L C G Y R F V E S ----:----|----:----|----:----|----:----|----:----|----:----| S H E F S M F S S P R E K T S I T K D F R I N S P C S L L H D K R Q P Y R K T S F T R L V H F F I T K G K H I D N Q R F TseI |BisI ||BlsI ||| MwoI ||| | Hin6I ||| | |GlaI FokI ||| | ||HhaI | MfeI CviRI* ||| | |||BbvI | TspEI | TaqII ||| | |||HaeII | |TspDTI | | TspEI ||| | |||SfaNI BseGI | || CviJI | | | XmnI \\\ \ \\\\ \ \ \\ \ \ \ \ \ GCAGCATCGGCGCTGGATGAAAAGGAAAAACAATTGGCTGTTGCAAATGAAATTATTCGG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGTAGCCGCGACCTACTTTTCCTTTTTGTTAACCGACAACGTTTACTTTAATAAGCC /// //// / / / / / / / / // / ||MwoI |||| | BseGI | | | CviJI | TaqII |TspEI TspDTI ||TseI |||| SfaNI | | TspEI CviRI* XmnI |BisI |||| BbvI | | MfeI BlsI |||Hin6I | FokI ||GlaI TspDTI |HhaI HaeII A A S A L D E K E K Q L A V A N E I I R Q H R R W M K R K N N W L L Q M K L F G S I G A G * K G K T I G C C K * N Y S V ----:----|----:----|----:----|----:----|----:----|----:----| A A D A S S S F S F C N A T A F S I I R L L M P A P H F P F V I P Q Q L H F * E C C R R Q I F L F F L Q S N C I F N N P Hpy188I TspDTI XmnI SetI TspDTI | MnlI | TspEI | TspDTI | MseI \ \ \ \ \ \ \ \ \ TCTTTGTCAGATGAAGTTATGAGGAATGAAATTAGAATAACTTCACTTCAAGGTGATTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAACAGTCTACTTCAATACTCCTTACTTTAATCTTATTGAAGTGAAGTTCCACTAAAT / / / / / / / | MnlI TspDTI TspEI TspDTI SetI MseI Hpy188I XmnI S L S D E V M R N E I R I T S L Q G D L L C Q M K L * G M K L E * L H F K V I * F V R * S Y E E * N * N N F T S R * F N ----:----|----:----|----:----|----:----|----:----|----:----| D K D S S T I L F S I L I V E S * P S K T K T L H L * S S H F * F L K V E L H N R Q * I F N H P I F N S Y S * K L T I * SfaNI HphI Hpy178III* | Hpy188I TspEI \ \ \ \ \ ACTTTTACAAAGAAATGTCTTGAAAATGCGAGAAGTCAAATATCTGAAAAAGATGCTAAA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAATGTTTCTTTACAGAACTTTTACGCTCTTCAGTTTATAGACTTTTTCTACGATTT / / / / HphI Hpy178III* | SfaNI Hpy188I T F T K K C L E N A R S Q I S E K D A K L L Q R N V L K M R E V K Y L K K M L K F Y K E M S * K C E K S N I * K R C * N ----:----|----:----|----:----|----:----|----:----|----:----| V K V F F H R S F A L L * I D S F S A L L K * L S I D Q F H S F D F I Q F L H * S K C L F T K F I R S T L Y R F F I S F MseI | BccI | |TspEI Tsp4CI* \ \\ \ ATTAACAAATTGATGGAAAAAGATTTTCAAGTGAATAAGGAGATAAAACCGTATTGA 4030 4040 4050 4060 4070 ----:----|----:----|----:----|----:----|----:----|----:-- TAATTGTTTAACTACCTTTTTCTAAAAGTTCACTTATTCCTCTATTTTGGCATAACT // / / / || | TspEI Tsp4CI* || BccI |MseI TspEI I N K L M E K D F Q V N K E I K P Y * L T N * W K K I F K * I R R * N R I X * Q I D G K R F S S E * G D K T V L X ----:----|----:----|----:----|----:----|----:----|----:-- I L L N I S F S K * T F L S I F G Y Q F * C I S P F L N E L S Y P S L V T N N V F Q H F F I K L H I L L Y F R I S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AcyI 3 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AloI 2 AluI 11 AluBI ApaLI 1 Alw44I,VneI ApoI 9 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 4 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 4 BpuEI BceAI 3 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 2 BmgT120I 4 BmtI 1 BspOI BsaAI 3 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 5 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 2 BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 5 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrI 5 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 8 BstXI 1 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 5 BstC8I CauII* 4 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I Cfr9I 1 TspMI,XmaCI,XmaI Csp6I 11 CviQI,RsaNI CviAII 7 CviJI 40 CviKI-1 CviRI* 16 HpyCH4V DdeI 11 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 8 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoNI 2 BstENI,XagI EcoP15I 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 8 FatI 7 FokI 6 GlaI 3 GsaI 1 HaeII 2 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 11 Hin4II* 15 HpyAV Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 14 HpaII 6 HapII,BsiSI,MspI HphI 11 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 16 Hpy99I 3 KasI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 9 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 12 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 25 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 2 SchI MmeI 5 MnlI 19 MseI 19 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 4 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 2 PpsI PshAI 1 BstPAI,BoxI PvuII 2 RsaI 11 AfaI SapI 1 LguI,PciSI,BspQI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 44 SfaNI 9 LweI SmaI 1 SmlI 4 SmoI SnaBI 1 Eco105I,BstSNI SpeI 2 BcuI,AhlI SphI 1 PaeI,BbuI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 12 TaqII 4 TatI 2 TauI 1 TfiI 12 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 6 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 19 TspEI 39 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 8 TscAI TstI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 6 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AlfI AlwNI ApaI AscI Asp718I AvrII BalI BarI BbvCI BcgI BciVI BfiI BglI BplI Bpu10I BsaXI BsePI BsiI* Bsp120I BspMII* BsrBI BsrDI BstAPI BstEII BtgZI CfrI ClaI CspCI DraIII DrdI Eam1105I Ecl136II Eco47III EcoICRI EcoRI EcoT22I Esp3I FauI FnuDII* FseI FspAI GsuI HpaI KpnI MauBI MluI Mph1103I MroNI MslI NaeI NcoI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI ScaI SexAI SfeI* SfiI SgfI SgrAI SgrDI SplI* SrfI Sse232I* Sse8387I StuI SwaI Tth111I VspI XbaI XcmI XhoI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769