Restriction Map of CSN9/YDR179C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CSN9/YDR179C on chromosome IV from coordinates 819196 to 818708.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.31888

EMBOSS_001 MaeI BinI* | MboI | XhoII | | DpnI MnlI MboII | | |BstKTI MboII TsoI \ \ \ \ \\ \ \ ATGGTAATGAGGGAAGAAACAATAAAATCGCTAGAAGATCCTTACAAATATCACTACAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATTACTCCCTTCTTTGTTATTTTAGCGATCTTCTAGGAATGTTTATAGTGATGTTT / / // // / / / MnlI MboII || || | MboII TsoI || || XhoII || || MboI || |DpnI || BstKTI |MaeI BinI* M V M R E E T I K S L E D P Y K Y H Y K W * * G K K Q * N R * K I L T N I T T K G N E G R N N K I A R R S L Q I S L Q R ----:----|----:----|----:----|----:----|----:----|----:----| X T I L S S V I F D S S S G * L Y * * L X P L S P L F L L I A L L D K C I D S C H Y H P F F C Y F R * F I R V F I V V F MseI | MboII | | BinI* | | | MboI | | | XhoII | | | | DpnI | | | | |BstKTI TaqI | | | | ||Hpy178III* AsuII | | | | ||| BcgI TspDTI | | | | ||| | TspEI | SspI \ \ \ \ \\\ \ \ \ \ GAAGAATGGTTAAATACTAAAGATCCCGATGAACAACAATTATTCGAAATATTTGCCTTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTACCAATTTATGATTTCTAGGGCTACTTGTTGTTAATAAGCTTTATAAACGGAAA / / // / / / // / / | | || | | BcgI || | SspI | | || | Hpy178III* || AsuII | | || XhoII || TaqI | | || MboI |TspDTI | | |DpnI TspEI | | BstKTI | BinI* MboII MseI E E W L N T K D P D E Q Q L F E I F A F K N G * I L K I P M N N N Y S K Y L P L R M V K Y * R S R * T T I I R N I C L W ----:----|----:----|----:----|----:----|----:----|----:----| S S H N F V L S G S S C C N N S I N A K L L I T L Y * L D R H V V I I R F I Q R F F P * I S F I G I F L L * E F Y K G K MseI BcgI | MboI | BglII | XhoII | | DpnI MboI | | |BstKTI | DpnI | | || BetI* MseI | |BstKTI | | || |HpaII VspI | || AjuI \ \ \\ \\ \ \ \\ \ GGAAACATTAAAGATCTACCGGAAAACATAATCCTAACATCATTAATGCGATCAAAACTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTGTAATTTCTAGATGGCCTTTTGTATTAGGATTGTAGTAATTACGCTAGTTTTGAC / / // / // / // / / | | || | |BetI* VspI || MboI BsrI | | || | HpaII MseI |DpnI | | || XhoII BstKTI | | || BglII AjuI | | || MboI | | |DpnI | | BstKTI | MseI BcgI G N I K D L P E N I I L T S L M R S K L E T L K I Y R K T * S * H H * C D Q N W K H * R S T G K H N P N I I N A I K T G ----:----|----:----|----:----|----:----|----:----|----:----| P F M L S R G S F M I R V D N I R D F S Q F C * L D V P F C L G L M M L A I L V S V N F I * R F V Y D * C * * H S * F Q MaeIII MseI BsrI | GsuI |TspEI | TspEI | Eco57MI MseI || MseI | | MseI | | MseI AjuI | MaeIII || PacI \ \ \ \ \ \ \ \ \ \\ \ GAGAAATTAACATTGGTAACATTAAGCGAAATATATAATGAGTTAAGTTACGAGTTAATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTAATTGTAACCATTGTAATTCGCTTTATATATTACTCAATTCAATGCTCAATTAA // / / / / / / / / |MseI | | | MseI MseI | | TspEI TspEI | | AjuI | PacI | MaeIII | MseI Eco57MI MaeIII GsuI E K L T L V T L S E I Y N E L S Y E L I R N * H W * H * A K Y I M S * V T S * L E I N I G N I K R N I * * V K L R V N * ----:----|----:----|----:----|----:----|----:----|----:----| S F N V N T V N L S I Y L S N L * S N I P S I L M P L M L R F I Y H T L N R T L L F * C Q Y C * A F Y I I L * T V L * N BaeI CviJI AluI | TspEI BbvII* | BaeI CviJI | | MboII | MboII | |MseI |SfeI* | | | BccI | | TaqI | ||TspEI ||SetI \ \ \ \ \ \ \ \ \\\ \\\ AAAGAAGAATGTCAAATTGAAGACGATGGTATCATCGAAAGCCATTTAATTCAGCTACAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCTTACAGTTTAACTTCTGCTACCATAGTAGCTTTCGGTAAATTAAGTCGATGTC / / / / / / / // / // / / MseI BaeI | | BccI BbvII* | |CviJI | || | SfeI* | TspEI MboII | BaeI | || CviJI MboII TaqI | || AluI | |SetI | TspEI MseI K E E C Q I E D D G I I E S H L I Q L Q K K N V K L K T M V S S K A I * F S Y R R R M S N * R R W Y H R K P F N S A T E ----:----|----:----|----:----|----:----|----:----|----:----| L S S H * I S S S P I M S L W K I * S C * L L I D F Q L R H Y * R F G N L E A V F F F T L N F V I T D D F A M * N L * L MseI |AhaIII* TfiI ApoI Hpy178III* SspI || BccI HinfI TspEI | TspDTI \ \\ \ \ \ \ \ AATATTTTTAAAGCAGAGATGGATTCAGTCAGTAAATCTATGAAATTTTCAAGAAGATTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAAAATTTCGTCTCTACCTAAGTCAGTCATTTAGATACTTTAAAAGTTCTTCTAAA / // / / / // SspI || BccI HinfI | |TspDTI |MseI TfiI | Hpy178III* AhaIII* TspEI ApoI N I F K A E M D S V S K S M K F S R R F I F L K Q R W I Q S V N L * N F Q E D L Y F * S R D G F S Q * I Y E I F K K I * ----:----|----:----|----:----|----:----|----:----|----:----| F I K L A S I S E T L L D I F N E L L N S Y K * L L S P N L * Y I * S I K L F I I N K F C L H I * D T F R H F K * S S K TatI |Csp6I |Hpy166II ||RsaI ||| Tsp4CI* ||| | FatI ||| | BspHI AciI SfeI* ||| | |CviAII TspDTI | FnuDII* |Tsp4CI* ||| | |Hpy178III* | TspEI | | MaeIII ||MboII ||| | || NlaIII | | MseI | | Tsp45I \\\ \\\ \ \\ \ \ \ \ \ \ \ GACTGTAGAGATGTGTACTGTCATGAAAAGGAACTGACTATAATTAAAAATCCGCGAGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGACATCTCTACACATGACAGTACTTTTCCTTGACTGATATTAATTTTTAGGCGCTCAC // / //// / // / // / || SfeI* |||| | |BspHI TspDTI |MseI FnuDII* |MboII |||| | |FatI TspEI AciI Tsp4CI* |||| | Hpy178III* |||| | CviAII |||| NlaIII |||Tsp4CI* |||TatI ||Csp6I |RsaI Hpy166II D C R D V Y C H E K E L T I I K N P R V T V E M C T V M K R N * L * L K I R E * L * R C V L S * K G T D Y N * K S A S D ----:----|----:----|----:----|----:----|----:----|----:----| S Q L S T Y Q * S F S S V I I L F G R T Q S Y L H T S D H F P V S * L * F D A L V T S I H V T M F L F Q S Y N F I R S H Hpy188I | AluI | BseYI | CviJI AluI | | SetI CviJI MboII | | | GsaI | SetI \ \ \ \ \ \ \ ACGAAAGAGTATTTAGTTCAAAATCTTCGGAGCTGGGAAACAAAGCTCAAACAGAATATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTTTCTCATAAATCAAGTTTTAGAAGCCTCGACCCTTTGTTTCGAGTTTGTCTTATAT / / / / / / / / Tsp45I MboII | | | BseYI | CviJI MaeIII | | CviJI | AluI | | AluI SetI | | GsaI | SetI Hpy188I T K E Y L V Q N L R S W E T K L K Q N I R K S I * F K I F G A G K Q S S N R I Y E R V F S S K S S E L G N K A Q T E Y I ----:----|----:----|----:----|----:----|----:----|----:----| V F S Y K T * F R R L Q S V F S L C F I S S L T N L E F D E S S P F L A * V S Y R F L I * N L I K P A P F C L E F L I Y TTGGAGTAA ----:---- AACCTCATT L E * W S X G V X ----:---- N S Y I P T Q L L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AhaIII* 1 DraI AjuI 1 AluI 3 AluBI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BcgI 1 BetI* 1 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BseYI 1 BspHI 1 CciI,PagI,RcaI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 4 Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 4 CviKI-1 DpnI 4 MalI Eco57MI 1 FatI 1 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GsaI 1 GsuI 1 BpmI HinfI 1 HpaII 1 HapII,BsiSI,MspI Hpy166II 1 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 1 MaeI 1 FspBI,BfaI,XspI MaeIII 3 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MnlI 1 MseI 11 Tru1I,Tru9I NlaIII 1 Hin1II,Hsp92II,FaeI PacI 1 RsaI 1 AfaI SetI 3 SfeI* 2 BstSFI,SfcI,BfmI SspI 2 TaqI 2 TatI 1 TfiI 1 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 7 TasI,Tsp509I,Sse9I VspI 1 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AvaI AvaII AvrII BalI BamHI BarI BbvCI BbvI Bce83I* BceAI BciVI BclI BdaI BfiI BglI BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviRI* DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI Fnu4HI FokI FseI FspAI GlaI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinP1I HpaI HphI Hpy99I HspAI KasI KpnI Ksp632I* MaeII MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaiI TaqII TauI TseI TspGWI TspMI TspRI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769