Restriction Map of SEC7/YDR170C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SEC7/YDR170C on chromosome IV from coordinates 802222 to 796193.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26139

EMBOSS_001 Hpy188I | ApoI BsmAI | TspEI MboII |Eco57I | EcoRI BccI |BseGI FokI |Eco57MI \ \ \ \\ \ \\ ATGTCTGAACAGAATTCAGTAGTAAATGCTGAAAAAGGGGATGGCGAAATATCTTCAAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACTTGTCTTAAGTCATCATTTACGACTTTTTCCCCTACCGCTTTATAGAAGTTTA / / / / // Hpy188I EcoRI BccI BseGI |Eco57MI TspEI MboII |Eco57I ApoI FokI M S E Q N S V V N A E K G D G E I S S N C L N R I Q * * M L K K G M A K Y L Q M V * T E F S S K C * K R G W R N I F K C ----:----|----:----|----:----|----:----|----:----|----:----| X D S C F E T T F A S F P S P S I D E F X T Q V S N L L L H Q F L P H R F I K L H R F L I * Y Y I S F F P I A F Y R * I BsmI MboII TspGWI | MseI \ \ \ \ GTAGAGACTGCTTCTTCAGTCAATCCGTCTGTGAAACCACAGAATGCTATTAAAGAAGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTCTGACGAAGAAGTCAGTTAGGCAGACACTTTGGTGTCTTACGATAATTTCTTCTT / / / / / / | MboII TspGWI BsmI MseI SetI BsmAI V E T A S S V N P S V K P Q N A I K E E * R L L L Q S I R L * N H R M L L K K K R D C F F S Q S V C E T T E C Y * R R S ----:----|----:----|----:----|----:----|----:----|----:----| T S V A E E T L G D T F G C F A I L S S H L S Q K K L * D T Q S V V S H * * L L Y L S S R * D I R R H F W L I S N F F F MboI | DpnI | |BstKTI | || HphI | || | MboII AluI | || | |CviRI* BsmAI | || | || AsuI* CviJI | || | || |BmgT120I Cac8I | SetI | || | || ||CviJI | Csp6I | | MboII | || | || ||HaeIII | |RsaI \ \ \ \ \\ \ \\ \\\ \ \\ GCTAAAGAGACAAATGGTGAAGATCAAAAATGCAAAGGGCCAGAAAACGCTGGCAGTACG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTTCTCTGTTTACCACTTCTAGTTTTTACGTTTCCCGGTCTTTTGCGACCGTCATGC / // // / / / / // / // | |MboII || | | | CviRI* |AsuI* Cac8I |Csp6I | BsmAI || | | MboII BmgT120I RsaI CviJI || | HphI HaeIII AluI || MboI CviJI |DpnI BstKTI A K E T N G E D Q K C K G P E N A G S T L K R Q M V K I K N A K G Q K T L A V R * R D K W * R S K M Q R A R K R W Q Y G ----:----|----:----|----:----|----:----|----:----|----:----| A L S V F P S S * F H L P G S F A P L V L * L S L H H L D F I C L A L F R Q C Y S F L C I T F I L F A F P W F V S A T R BceAI Hpy99I TspGWI | MaeIII | HgaI | TspDTI \ \ \ \ \ \ GCAGAAACAAAAGAAACAAGTAACGACGCTACCAACGGAATGAAAACGCCCGAAGAAACG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTTGTTTTCTTTGTTCATTGCTGCGATGGTTGCCTTACTTTTGCGGGCTTCTTTGC / // / / / BceAI |MaeIII HgaI | TspDTI Hpy99I TspGWI A E T K E T S N D A T N G M K T P E E T Q K Q K K Q V T T L P T E * K R P K K R R N K R N K * R R Y Q R N E N A R R N G ----:----|----:----|----:----|----:----|----:----|----:----| A S V F S V L L S A V L P I F V G S S V P L F L L F L Y R R * W R F S F A R L F C F C F F C T V V S G V S H F R G F F R FatI |CviAII || NlaIII TspDTI MboII || Hin4II* BccI | HphI MboII TspGWI || |MslI | SetI | | MboII \ \ \\ \\ \ \ \ \ \ GAAGATACAAATGACAAACGCCATGACGATGAAGGTGAAGATGGAGATGAAGATGAAGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTATGTTTACTGTTTGCGGTACTGCTACTTCCACTTCTACCTCTACTTCTACTTCTA / // / /// / / / / / / MboII |MboII | ||MslI | BccI | | MboII TspDTI TspGWI | |FatI SetI | HphI MboII | Hin4II* TspDTI | CviAII NlaIII E D T N D K R H D D E G E D G D E D E D K I Q M T N A M T M K V K M E M K M K M R Y K * Q T P * R * R * R W R * R * R * ----:----|----:----|----:----|----:----|----:----|----:----| S S V F S L R W S S S P S S P S S S S S P L Y L H C V G H R H L H L H L H L H L F I C I V F A M V I F T F I S I F I F I MboII |TspDTI || MboII || |TspDTI || || MboII || || |TspDTI || || || MboII || || || |TspDTI || || || || MboII BseGI || || || || |BbvII* |BslFI || || || || |TspDTI || MaeII || || || || ||MnlI || |BtrI || || || || ||| MboII || ||FokI || || || || ||| |TspDTI || |||SetI || || || || ||| || MnlI || |||TaiI \\ \\ \\ \\ \\\ \\ \ \\ \\\\ GAAGATGAAGATGAAGATGAAGACAATGGGGACGAGGATGATGAGGACGTGGATAGCAGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACTTCTACTTCTACTTCTGTTACCCCTGCTCCTACTACTCCTGCACCTATCGTCA / / / / / / / / //// / | | | | | | MnlI BseGI |||| FokI | | | | | TspDTI |||MaeII | | | | | BbvII* ||BtrI | | | | | MboII |BslFI | | | | MnlI TaiI | | | TspDTI SetI | | | MboII | | TspDTI | | MboII | TspDTI | MboII TspDTI MboII E D E D E D E D N G D E D D E D V D S S K M K M K M K T M G T R M M R T W I A V R * R * R * R Q W G R G * * G R G * Q * ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S S S S L P S S S S S S T S L L H L H L H L H L C H P R P H H P R P Y C F I F I F I F V I P V L I I L V H I A T Hpy188I | Hin4I | Hin4I | |BsiYI* | || BbvII* | || | TfiI | || | HinfI | || | MboII | || | | Hpy188I | || | | |TfiI | || | | |HinfI | || | | || MboII | || | | || | DdeI | || | | || | | BsmAI | || | | || | | | BseMII | || | | || | | | |BspCNI | || | | || | | | ||BplI | || | | || | | | ||BplI | || | | || | | | ||| Hin4I | || | | || | | | ||| Hin4I | || | | || | | | ||| |TatI | || | | || | | | ||| ||Csp6I | || | | || | | | ||| |||RsaI | || | | || | | | ||| |||ScaI | || | | || | | | ||| ||||BspCNI Hpy188I | || | | || | | | ||| |||||DdeI | BsrI | || | | || | | | ||| |||||BseMII \ \ \ \\ \ \ \\ \ \ \ \\\ \\\\\\ AGTTCCGAAACCAGTTCCGAAGACGGGGAAGATTCTGAATCAGTCTCAGGGGAAAGTACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGGCTTTGGTCAAGGCTTCTGCCCCTTCTAAGACTTAGTCAGAGTCCCCTTTCATGA / / / / / // // /// / //// | BsrI | BsiYI* | || |HinfI ||| | |||TatI Hpy188I Hpy188I | || |TfiI ||| | ||Csp6I Hin4I | || MboII ||| | |BseMII Hin4I | |Hpy188I ||| | |ScaI | HinfI ||| | |RsaI | TfiI ||| | BspCNI BbvII* ||| BsmAI MboII ||BspCNI ||Hin4I ||Hin4I |BseMII |DdeI BplI BplI S S E T S S E D G E D S E S V S G E S T V P K P V P K T G K I L N Q S Q G K V L F R N Q F R R R G R F * I S L R G K Y * ----:----|----:----|----:----|----:----|----:----|----:----| L E S V L E S S P S S E S D T E P S L V Y N R F W N R L R P L N Q I L R L P F Y T G F G T G F V P F I R F * D * P F T S BplI BplI |TfiI |HinfI || MboII AluI || | Hpy188I CviJI || | | GsuI Hin4I | SetI || | | Eco57MI Hin4I | Hin4I || | | | BccI | TspDTI | Hin4I || | | | MboII | | BseRI AluI | |Hpy178III* || | | | |TspDTI | | | BtgZI CviJI \ \\ \\ \ \ \ \\ \ \ \ \ \ GAGAGTAGCTCTGGAGAAGATGAAGAATCTGATGAAAGCGATGGAAATACATCAAACAGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCATCGAGACCTCTTCTACTTCTTAGACTACTTTCGCTACCTTTATGTAGTTTGTCG / // / / / //// / / / / / / / | || | | BplI |||| | | Hin4I | BseRI | CviJI | || | | BplI |||| | | Hin4I TspDTI | AluI | || | Hpy178III* |||| | BccI BtgZI | || CviJI |||| TspDTI SetI | || AluI |||| MboII | |SetI |||Eco57MI | Hin4I |||GsuI | Hin4I ||Hpy188I DdeI |HinfI |TfiI MboII E S S S G E D E E S D E S D G N T S N S R V A L E K M K N L M K A M E I H Q T A E * L W R R * R I * * K R W K Y I K Q L ----:----|----:----|----:----|----:----|----:----|----:----| S L L E P S S S S D S S L S P F V D F L Q S Y S Q L L H L I Q H F R H F Y M L C L T A R S F I F F R I F A I S I C * V A MboII | MboII | | MboII | | | MboII | | | | MboII | | | | | MboII | | | | | |Ksp632I* | | | | | ||MnlI FauI AciI Hpy188I | | | | | |||MboII SetI | MnlI | HphI | TspDTI | | | | | |||| MboII \ \ \ \ \ \ \ \ \ \ \ \ \\\\ \ TCCTCTGGTGATGAAAGCGGGTCAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGACCACTACTTTCGCCCAGTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT // // // / / / / / / // // / |FauI || |TspDTI | | | | | | || || MboII MnlI || Hpy188I | | | | | | || |MboII |AciI | | | | | | || Ksp632I* HphI | | | | | | |MboII | | | | | | MnlI | | | | | MboII | | | | MboII | | | MboII | | MboII | MboII MboII S S G D E S G S E E E E E E E E E E E E P L V M K A G Q K K K K K K K K K K K K L W * * K R V R R R R R R R R R R R R R ----:----|----:----|----:----|----:----|----:----|----:----| E E P S S L P D S S S S S S S S S S S S S R Q H H F R T L L L L L L L L L L L L G R T I F A P * F F F F F F F F F F F F MboII | MboII | | MboII AluI | | | MboII CviJI Hpy178III* TfiI | | | | Cac8I | SetI | BcgI HinfI \ \ \ \ \ \ \ \ \ \ GAGGAAAATGCTGGCGAACCAGCTATCGCTCATCAAGATAGTGTTCCCACCAACGATTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTTTACGACCGCTTGGTCGATAGCGAGTAGTTCTATCACAAGGGTGGTTGCTAAGA / / / / / / / / / | | | Cac8I | CviJI | BcgI HinfI | | MboII | AluI Hpy178III* TfiI | MboII SetI MboII E E N A G E P A I A H Q D S V P T N D S R K M L A N Q L S L I K I V F P P T I L G K C W R T S Y R S S R * C S H Q R F Y ----:----|----:----|----:----|----:----|----:----|----:----| S S F A P S G A I A * * S L T G V L S E L P F H Q R V L * R E D L Y H E W W R N L F I S A F W S D S M L I T N G G V I R AccI SetI |Hpy166II StyI || MnlI TaqI SecI* || BcgI BsiYI* MboII PpiI AsuII \ \\ \ \ \ \ \ ACTGCCCCAAGGTCTACCCATACGAGGAACATATCACTATCTTCAAATGGTTCGAACACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGGGGTTCCAGATGGGTATGCTCCTTGTATAGTGATAGAAGTTTACCAAGCTTGTGT / / /// / / / / | | ||| BsiYI* MboII PpiI AsuII | | ||MnlI TaqI | | |BcgI | | |AccI | | Hpy166II | SecI* | StyI SetI T A P R S T H T R N I S L S S N G S N T L P Q G L P I R G T Y H Y L Q M V R T Q C P K V Y P Y E E H I T I F K W F E H K ----:----|----:----|----:----|----:----|----:----|----:----| V A G L D V W V L F M D S D E F P E F V * Q G L T * G Y S S C I V I K L H N S C S G W P R G M R P V Y * * R * I T R V C BsmAI TspEI MmeI MaeII | MseI TspEI | SetI | |AhaIII* | AjuI PpiI | TaiI | ||AjuI MseI \ \ \ \ \ \ \\\ \ AACTCAACCATAATTTTAGTGAAAACTACGTTGGAGACAATTTTAAATGATAAGGACATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTTGGTATTAAAATCACTTTTGATGCAACCTCTGTTAAAATTTACTATTCCTGTAA // / / / / / / / // || | TspEI | | BsmAI | | |MseI || PpiI | MaeII | | AhaIII* |MmeI TaiI | TspEI AjuI SetI AjuI N S T I I L V K T T L E T I L N D K D I T Q P * F * * K L R W R Q F * M I R T L L N H N F S E N Y V G D N F K * * G H * ----:----|----:----|----:----|----:----|----:----|----:----| F E V M I K T F V V N S V I K F S L S M L S L W L K L S F * T P S L K L H Y P C V * G Y N * H F S R Q L C N * I I L V N ApoI TspEI EcoRI | TaqI | AsuII | | Hin4II* | | | DdeI | | | |BsmI | | | || Hpy188I | | | || | MwoI | | | || | | CviJI ApoI | | | || | | | TaqI ApoI BinI* | | | || | | | |BspCNI TspEI TspEI | | | || | | | ||BseMII | MseI | MboI \ \ \ \\ \ \ \ \\\ \ \ \ \ AAAAAGAATTCGAATGCTCAGAAGGCTATCGAAAGGACATTACAAAAATTTAAGGAATTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCTTAAGCTTACGAGTCTTCCGATAGCTTTCCTGTAATGTTTTTAAATTCCTTAAA / / / / / // / // / / / / / MseI | | | | |DdeI | || TaqI | | | TspEI | | | | | | |BseMII | | | ApoI | | | | | | BspCNI | | BinI* | | | | | CviJI | MseI | | | | Hpy188I TspEI | | | | MwoI ApoI | | | BsmI | | Hin4II* | AsuII | TaqI EcoRI TspEI ApoI K K N S N A Q K A I E R T L Q K F K E F K R I R M L R R L S K G H Y K N L R N L K E F E C S E G Y R K D I T K I * G I * ----:----|----:----|----:----|----:----|----:----|----:----| L F F E F A * F A I S L V N C F N L S N * F S N S H E S P * R F S M V F I * P I F L I R I S L L S D F P C * L F K L F K MaeII |BsaAI || SetI DpnI || TaiI |BstKTI || | TfiI SpeI TaqI ||AciI || | HinfI |MaeI AsuII DdeI \\\ \\ \ \ \\ \ \ GATCCGCAAACCACGAATAACCCACATTACGTGGATTCAATACTAGTATTCGAAGCACTA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGCGTTTGGTGCTTATTGGGTGTAATGCACCTAAGTTATGATCATAAGCTTCGTGAT // / / / // / // / / || | AciI | |MaeII HinfI |SpeI AsuII MwoI || MboI | BsaAI TfiI MaeI TaqI |DpnI TaiI BstKTI SetI D P Q T T N N P H Y V D S I L V F E A L I R K P R I T H I T W I Q Y * Y S K H * S A N H E * P T L R G F N T S I R S T K ----:----|----:----|----:----|----:----|----:----|----:----| S G C V V F L G C * T S E I S T N S A S Q D A F W S Y G V N R P N L V L I R L V I R L G R I V W M V H I * Y * Y E F C * Cac8I | AluI | CviJI | | SetI Hin4I | | | Csp6I FalI Hin4I FalI MwoI | | | |RsaI FalI MnlI | CviJI FalI \ \ \ \ \\ \ \ \ \ \ AGGGCAAGCTGTCGTACCAAATCCTCCAAAGTTCAAAGTTTGGCTTTAGATTGCCTGTCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGTTCGACAGCATGGTTTAGGAGGTTTCAAGTTTCAAACCGAAATCTAACGGACAGT / / / // / / / / / DdeI | CviJI |Csp6I FalI | Hin4I CviJI FalI | AluI RsaI FalI | Hin4I FalI Cac8I MnlI SetI R A S C R T K S S K V Q S L A L D C L S G Q A V V P N P P K F K V W L * I A C Q G K L S Y Q I L Q S S K F G F R L P V K ----:----|----:----|----:----|----:----|----:----|----:----| L A L Q R V L D E L T * L K A K S Q R D L P L S D Y W I R W L E F N P K L N G T P C A T T G F G G F N L T Q S * I A Q * Hin4I Hin4I | MboI | | DpnI | | |BstKTI | | || MaeI | | || BsmAI TfiI TfiI TspEI | | || Eco31I HinfI HinfI \ \ \ \\ \ \ \ AAATTGTTTTCTTTTAGATCGCTAGACGAGACCCTGTTAGTGAATCCACCCGATTCTTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACAAAAGAAAATCTAGCGATCTGCTCTGGGACAATCACTTAGGTGGGCTAAGAAAT / / // / / / / / | Hin4I || | | Eco31I HinfI HinfI | Hin4I || | | BsmAI TfiI TfiI TspEI || | MaeI || MboI |DpnI BstKTI K L F S F R S L D E T L L V N P P D S L N C F L L D R * T R P C * * I H P I L * I V F F * I A R R D P V S E S T R F F S ----:----|----:----|----:----|----:----|----:----|----:----| F N N E K L D S S S V R N T F G G S E K L I T K K * I A L R S G T L S D V R N K F Q K R K S R * V L G Q * H I W G I R * MboI BclI | DpnI BccI | |BbvI TseI AciI MnlI | |MnlI |BisI BisI |BbvI | |SfaNI ||BlsI |BlsI || TspEI CviJI | |BstKTI ||| BsaXI ||TauI || |BsaXI \ \ \\ \\\ \ \\\ \\ \\ GCCTCTAATGATCAACGACAAGATGCTGCCGATGGAATAACGCCGCCTCCAAAACAAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGATTACTAGTTGCTGTTCTACGACGGCTACCTTATTGCGGCGGAGGTTTTGTTTTT / // / / /// //// / / CviJI || | SfaNI ||TseI |||AciI | BsaXI || | BbvI |BsaXI ||BisI MnlI || BclI |BisI |BlsI || MboI BlsI TauI |MnlI BccI |DpnI BstKTI A S N D Q R Q D A A D G I T P P P K Q K P L M I N D K M L P M E * R R L Q N K K L * * S T T R C C R W N N A A S K T K N ----:----|----:----|----:----|----:----|----:----|----:----| A E L S * R C S A A S P I V G G G F C F L R * H D V V L H Q R H F L A A E L V F G R I I L S L I S G I S Y R R R W F L F TseI |BisI ||BlsI |||CviRI* Hpy188I ||||MfeI | Tsp4CI* ||||TspEI | | Hin4II* HphI ||||| HgaI | | | SetI | TspRI \\\\\ \ \ \ \ \ \ \ ATTATAGACGCTGCAATTGATACTATTTCAGACTGTTTTCAAGGTGAAGGCACTGATGAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAATATCTGCGACGTTAACTATGATAAAGTCTGACAAAAGTTCCACTTCCGTGACTACTG / / /// / / / / / / / / / | TspEI ||| | HgaI | | | SetI TspRI HphI Tsp4CI* BbvI ||| TspEI | | Hin4II* ||| MfeI | Tsp4CI* ||CviRI* Hpy188I ||TseI |BisI BlsI I I D A A I D T I S D C F Q G E G T D D L * T L Q L I L F Q T V F K V K A L M T Y R R C N * Y Y F R L F S R * R H * * P ----:----|----:----|----:----|----:----|----:----|----:----| I I S A A I S V I E S Q K * P S P V S S F * L R Q L Q Y * K L S N E L H L C Q H N Y V S C N I S N * V T K L T F A S I V AluI CviRI* CviJI | Ksp632I* TfiI Tsp4CI* | SetI MaeI | |MnlI HinfI MboII \ \ \ \ \ \\ \ \ CGTGTGGAACTACAAATCGTTAGAGCTTTATCTAGTTGCATTTTAGAAGAGGATTCAAGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GCACACCTTGATGTTTAGCAATCTCGAAATAGATCAACGTAAAATCTTCTCCTAAGTTCA / / / / / / /// | CviJI | | | Ksp632I* ||MboII | AluI | | MnlI |TstI SetI | CviRI* HinfI MaeI TfiI R V E L Q I V R A L S S C I L E E D S S V W N Y K S L E L Y L V A F * K R I Q V C G T T N R * S F I * L H F R R G F K F ----:----|----:----|----:----|----:----|----:----|----:----| R T S S C I T L A K D L Q M K S S S E L G H P V V F R * L K I * N C K L L P N L T H F * L D N S S * R T A N * F L I * T AclI SecI* CviJI MaeII DsaI* | TstI | SetI TstI | Tsp4CI* | | Hpy188I | TaiI FokI \ \ \ \ \ \ \ \ \ TCTTTATGCCACGGTGCTTCCTTGCTAAAGGCTATCAGAACAATCTACAACGTTTTCGTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATACGGTGCCACGAAGGAACGATTTCCGATAGTCTTGTTAGATGTTGCAAAAGCAG // / / / / / |DsaI* | | Hpy188I | MaeII |SecI* | CviJI | AclI Tsp4CI* TstI TaiI SetI S L C H G A S L L K A I R T I Y N V F V L Y A T V L P C * R L S E Q S T T F S S F M P R C F L A K G Y Q N N L Q R F R L ----:----|----:----|----:----|----:----|----:----|----:----| E K H W P A E K S F A I L V I * L T K T N K I G R H K R A L P * * F L R C R K R R * A V T S G Q * L S D S C D V V N E D SetI BseGI BccI | CviRI* SetI TspEI \ \ \ \ \ \ TTTTCGTTGAACCCATCCAATCAAGGTATTGCACAGGCGACCTTGACACAAATTATTAGT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCAACTTGGGTAGGTTAGTTCCATAACGTGTCCGCTGGAACTGTGTTTAATAATCA / / // / / / FokI BseGI |SetI CviRI* SetI TspEI BccI F S L N P S N Q G I A Q A T L T Q I I S F R * T H P I K V L H R R P * H K L L V F V E P I Q S R Y C T G D L D T N Y * F ----:----|----:----|----:----|----:----|----:----|----:----| K E N F G D L * P I A C A V K V C I I L R K T S G M W D L Y Q V P S R S V F * * K R Q V W G I L T N C L R G Q C L N N T TaqI ClaI |MboI || DpnI || |FalI || |FalI Ksp632I* || |BstKTI | MnlI || || Eco57I | | Hin4I || || Eco57MI | | Hin4I || || | MboII | | | FalI || || | | Csp6I | | | FalI || || | | |RsaI | | | | TaqI || || | | || SetI | | | | | BciVI \\ \\ \ \ \\ \ \ \ \ \ \ \ TCGGTGTATGATAAAATCGATCTCAAACAAAGTACCTCTTCAGCAGTATCCTTATCGACA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCACATACTATTTTAGCTAGAGTTTGTTTCATGGAGAAGTCGTCATAGGAATAGCTGT / //// / // /// / // | |||MboI | |Csp6I ||| FalI |TaqI | ||| | RsaI ||| FalI BciVI | ||| | SetI ||Ksp632I* | ||| MboII |MnlI | ||Eco57MI Hin4I | ||Eco57I Hin4I | |DpnI | BstKTI | ClaI | TaqI FalI FalI S V Y D K I D L K Q S T S S A V S L S T R C M I K S I S N K V P L Q Q Y P Y R Q G V * * N R S Q T K Y L F S S I L I D K ----:----|----:----|----:----|----:----|----:----|----:----| E T Y S L I S R L C L V E E A T D K D V N P T H Y F R D * V F Y R K L L I R I S R H I I F D I E F L T G R * C Y G * R C SecI* |Hpy188I || CviJI AciI || | Hpy188I EciI Hin4I || | | BsaXI MroNI | EcoP15I Hin4I MnlI || | | | CviRI* Cfr10I \ \ \ \ \\ \ \ \ \ \ AAAAATCATCAACAACAATCCGCCATAGAACTTTCCGAGGCTTCTGAAAATGCAGAAACG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTAGTAGTTGTTGTTAGGCGGTATCTTGAAAGGCTCCGAAGACTTTTACGTCTTTGC / / / / / / // // / EciI | Hin4I AciI MnlI | || |BsaXI CviRI* | Hin4I | || Hpy188I EcoP15I | |CviJI | SecI* Hpy188I K N H Q Q Q S A I E L S E A S E N A E T K I I N N N P P * N F P R L L K M Q K R K S S T T I R H R T F R G F * K C R N A ----:----|----:----|----:----|----:----|----:----|----:----| F F * * C C D A M S S E S A E S F A S V L F D D V V I R W L V K R P K Q F H L F F I M L L L G G Y F K G L S R F I C F R HpaII |NaeI |Cac8I || CviJI || |NlaIV Hpy178III* || || MseI | BsaXI MnlI \\ \\ \ \ \ \ CCGGCTCCTTTAACTCTGGAAAATATGGATAAGTTGAATGACGATGAGGAAAGACTAATG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCGAGGAAATTGAGACCTTTTATACCTATTCAACTTACTGCTACTCCTTTCTGATTAC //// / / / / |||NlaIV | | Hpy178III* MnlI ||Cfr10I | BsaXI ||MroNI MseI ||CviJI |HpaII Cac8I NaeI P A P L T L E N M D K L N D D E E R L M R L L * L W K I W I S * M T M R K D * W G S F N S G K Y G * V E * R * G K T N G ----:----|----:----|----:----|----:----|----:----|----:----| G A G K V R S F I S L N F S S S S L S I A P E K L E P F Y P Y T S H R H P F V L R S R * S Q F I H I L Q I V I L F S * H MboI BglII XhoII | DpnI | |BstKTI | ||MaeI | ||| SfaNI | ||| |AluI HgaI | ||| |CviJI | CviJI | ||| || SetI | | TfiI | ||| || |TsoI | | HinfI | ||| || ||MseI \ \ \ \ \\\ \\ \\\ GACGCTCAACAGCCTGATTCTATCGCCATAACTAACCAAGATCTAGCTGTTAAAGATGCG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGAGTTGTCGGACTAAGATAGCGGTATTGATTGGTTCTAGATCGACAATTTCTACGC / / / // ///// / / | | HinfI || ||||| | MseI | | TfiI || ||||| SfaNI | HgaI || ||||TsoI CviJI || |||CviJI || |||AluI || ||MaeI || |SetI || XhoII || BglII || MboI |DpnI BstKTI D A Q Q P D S I A I T N Q D L A V K D A T L N S L I L S P * L T K I * L L K M R R S T A * F Y R H N * P R S S C * R C V ----:----|----:----|----:----|----:----|----:----|----:----| S A * C G S E I A M V L W S R A T L S A P R E V A Q N * R W L * G L D L Q * L H V S L L R I R D G Y S V L I * S N F I R HinfI | FatI MnlI | |CviAII TaqI | || NlaIII | BceAI | || |PleI Hin4I | |FatI DdeI | || ||MlyI SetI Hin4I | ||CviAII \ \ \\ \\\ \ \ \ \\\ TTCTTAGTGTTTAGAGTCATGGCGAAAATATGTGCTAAACCTTTGGAAACAGAACTCGAC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAATCACAAATCTCAGTACCGCTTTTATACACGATTTGGAAACCTTTGTCTTGAGCTG / / // / / / / /// DdeI | || PleI SetI Hin4I | ||BceAI | || MlyI Hin4I | |NlaIII | |FatI | TaqI | CviAII MnlI NlaIII HinfI F L V F R V M A K I C A K P L E T E L D S * C L E S W R K Y V L N L W K Q N S T L S V * S H G E N M C * T F G N R T R H ----:----|----:----|----:----|----:----|----:----|----:----| N K T N L T M A F I H A L G K S V S S S T R L T * L * P S F I H * V K P F L V R E * H K S D H R F Y T S F R Q F C F E V NlaIII Eam1105I Hin4I | MaeIII Hin4I | Tsp45I |SetI | | SetI || HindIII | | | FatI || | AluI | | | |CviAII || | CviJI | | | || NspI || | |MboII | | | || NlaIII || | ||SetI Ksp632I* \ \ \ \\ \ \\ \ \\\ \ ATGAGGTCACATGCCGTCAGGTCAAAGCTTTTATCTCTTCACATCATTTACTCTATTATC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCCAGTGTACGGCAGTCCAGTTTCGAAAATAGAGAAGTGTAGTAAATGAGATAATAG // // // / / / / / / |FatI || || | SetI | | HindIII Ksp632I* |SetI || || Hin4I | CviJI | || || Hin4I | MboII | || |FatI | AluI | || CviAII SetI | |Tsp45I | |MaeIII | NlaIII | NspI Eam1105I CviAII M R S H A V R S K L L S L H I I Y S I I * G H M P S G Q S F Y L F T S F T L L S E V T C R Q V K A F I S S H H L L Y Y Q ----:----|----:----|----:----|----:----|----:----|----:----| M L D C A T L D F S K D R * M M * E I I C S T V H R * T L A K I E E C * K S * * H P * M G D P * L K * R K V D N V R N D BssKI EcoRII |TstI MboI MaeII |BsaXI | DpnI | SetI ||ScrFI | |BstKTI | TaiI ||BseBI \ \\ \ \ \\\ AAAGATCATATTGACGTATTCCTTTCCCACAACATTTTTCTACCAGGAAAGGAGCGTGTG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTAGTATAACTGCATAAGGAAAGGGTGTTGTAAAAAGATGGTCCTTTCCTCGCACAC // / / / / / / / || MboI | MaeII | | | EcoRII |DpnI TaiI | | | BssKI BstKTI SetI | | BseBI | | ScrFI | BsaXI TstI K D H I D V F L S H N I F L P G K E R V K I I L T Y S F P T T F F Y Q E R S V C R S Y * R I P F P Q H F S T R K G A C V ----:----|----:----|----:----|----:----|----:----|----:----| L S * I S T N R E W L M K R G P F S R T * L D Y Q R I G K G C C K E V L F P A H F I M N V Y E K G V V N K * W S L L T H TaqI ClaI TseI | TfiI |GsuI | HinfI |BisI | | BsaXI MaeII |Eco57MI | | |TspEI | SetI ||BlsI | | ||TstI SspI | TaiI BbvI ||BsmI \ \ \\\ \ \ \ \ \\\ TGCTTTATCGATTCAATTAGACAATATTTACGTCTTGTTTTATCAAGGAATGCTGCCTCG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAAATAGCTAAGTTAATCTGTTATAAATGCAGAACAAAATAGTTCCTTACGACGGAGC / / / / / / / ///// | | TspEI | | MaeII BbvI ||||TseI | HinfI | TaiI |||BisI | TfiI | SetI ||BlsI BsaXI SspI |BsmI TstI Eco57MI ClaI GsuI TaqI C F I D S I R Q Y L R L V L S R N A A S A L S I Q L D N I Y V L F Y Q G M L P R L Y R F N * T I F T S C F I K E C C L A ----:----|----:----|----:----|----:----|----:----|----:----| H K I S E I L C Y K R R T K D L F A A E T S * R N L * V I N V D Q K I L S H Q R A K D I * N S L I * T K N * * P I S G R MaeI | MnlI | |AluI | |CviJI | || SetI | || |BsrI TaqI | || ||MnlI | MaeIII TsoI | || |||MnlI | | SetI | TspEI CviJI TspEI \ \\ \\\\ \ \ \ \ \ \ \ CCTCTAGCTCCAGTTTTCGAGGTTACTTTAGAAATTATGTGGCTATTGATTGCTAATTTG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGATCGAGGTCAAAAGCTCCAATGAAATCTTTAATACACCGATAACTAACGATTAAAC //// // / / / / / / |||| |MnlI TaqI | TsoI TspEI CviJI TspEI |||| MnlI SetI MaeIII |||BsrI ||CviJI ||AluI |MaeI MnlI SetI P L A P V F E V T L E I M W L L I A N L L * L Q F S R L L * K L C G Y * L L I * S S S S F R G Y F R N Y V A I D C * F E ----:----|----:----|----:----|----:----|----:----|----:----| G R A G T K S T V K S I I H S N I A L K A E L E L K R P * K L F * T A I S Q * N R * S W N E L N S * F N H P * Q N S I Q Hin4II* | Hpy178III* | | ApoI | | TspEI | | | BsrI MseI Hpy188I \ \ \ \ \ \ AGAGCAGATTTCGTGAAGGAAATTCCAGTTTTTTTAACAGAAATCTACTTCCCCATTTCA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGTCTAAAGCACTTCCTTTAAGGTCAAAAAAATTGTCTTTAGATGAAGGGGTAAAGT / / // / / | | |TspEI MseI Hpy188I | | |ApoI | | BsrI | Hpy178III* Hin4II* R A D F V K E I P V F L T E I Y F P I S E Q I S * R K F Q F F * Q K S T S P F Q S R F R E G N S S F F N R N L L P H F R ----:----|----:----|----:----|----:----|----:----|----:----| L A S K T F S I G T K K V S I * K G M E S L L N R S P F E L K K L L F R S G W K S C I E H L F N W N K * C F D V E G N * TspEI SetI ApoI | MseI | TsoI MnlI MseI TspEI \ \ \ \ \ \ \ GAATTAACCACTTCCACCTCCCAACAAAAGAGATATTTTTTAAGTGTTATTCAACGAATT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATTGGTGAAGGTGGAGGGTTGTTTTCTCTATAAAAAATTCACAATAAGTTGCTTAA // / / / / / |MseI | TsoI MnlI MseI TspEI TspEI SetI ApoI E L T T S T S Q Q K R Y F L S V I Q R I N * P L P P P N K R D I F * V L F N E F I N H F H L P T K E I F F K C Y S T N L ----:----|----:----|----:----|----:----|----:----|----:----| S N V V E V E W C F L Y K K L T I * R I L I L W K W R G V F S I N K L H * E V F F * G S G G G L L L S I K * T N N L S N MaeIII | BssKI | SecI* | EcoRII ApoI | | ScrFI MaeIII TspEI TspEI | | BseBI \ \ \ \ \ \ TGTAACGACCCAAGAACTTTAGTTGAATTTTACTTGAATTATGATTGTAACCCTGGAATG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTGCTGGGTTCTTGAAATCAACTTAAAATGAACTTAATACTAACATTGGGACCTTAC / / / / /// / MaeIII TspEI TspEI | ||| BsmI ApoI | ||EcoRII | ||BssKI | |SecI* | BseBI | ScrFI MaeIII C N D P R T L V E F Y L N Y D C N P G M V T T Q E L * L N F T * I M I V T L E C * R P K N F S * I L L E L * L * P W N A ----:----|----:----|----:----|----:----|----:----|----:----| Q L S G L V K T S N * K F * S Q L G P I K Y R G L F K L Q I K S S N H N Y G Q F T V V W S S * N F K V Q I I I T V R S H Tsp4CI* CviJI FalI | FalI | MseI FalI BsmI | FalI | | MaeI TspEI \ \ \ \ \ \ \ CCAAATGTAATGGAAATAACTGTTGATTATTTGACAAGATTGGCTTTAACTAGGGTGGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTACATTACCTTTATTGACAACTAATAAACTGTTCTAACCGAAATTGATCCCACCTT / / / / / / | FalI | | | FalI | FalI | | | FalI Tsp4CI* | | MaeI | MseI CviJI P N V M E I T V D Y L T R L A L T R V E Q M * W K * L L I I * Q D W L * L G W K K C N G N N C * L F D K I G F N * G G N ----:----|----:----|----:----|----:----|----:----|----:----| G F T I S I V T S * K V L N A K V L T S A L H L P F L Q Q N N S L I P K L * P P W I Y H F Y S N I I Q C S Q S * S P H F MlyI MboI PleI | DpnI | DdeI | BspCNI Hpy166II | | Hpy188I | |BstKTI | SetI | | |HinfI | |BseMII TspDTI | | TspEI \ \ \\ \ \\ \ \ \ \ ATTACTCAGACTCAAAGATCATACTACGATGAACAAATATCAAAATCCCTGTCCACCTAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGAGTCTGAGTTTCTAGTATGATGCTACTTGTTTATAGTTTTAGGGACAGGTGGATG // // / /// / / // || || | ||| MboI TspDTI |SetI || || | ||DpnI Hpy166II || || | |BseMII || || | |BstKTI || || | BspCNI || || HinfI || |DdeI || Hpy188I |PleI TspEI MlyI I T Q T Q R S Y Y D E Q I S K S L S T Y L L R L K D H T T M N K Y Q N P C P P T Y S D S K I I L R * T N I K I P V H L Q ----:----|----:----|----:----|----:----|----:----|----:----| I V * V * L D Y * S S C I D F D R D V * F * E S E F I M S R H V F I L I G T W R N S L S L S * V V I F L Y * F G Q G G V BdaI Hpy178III* MfeI MboII BdaI | BsiYI* TspEI MboII BbvII* | MaeI | |MmeI \ \ \ \ \ \ \\ AATTTCTCACAATTGCCCCTTTTGACTTCTTCCAACTTGTCTTCTAGTCCTGATGTTGGT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGAGTGTTAACGGGGAAAACTGAAGAAGGTTGAACAGAAGATCAGGACTACAACCA / / / / / / / // / TspEI | MboII | | BdaI MaeI || MmeI TspEI | | BdaI |BsiYI* MfeI | BbvII* Hpy178III* MboII N F S Q L P L L T S S N L S S S P D V G I S H N C P F * L L P T C L L V L M L V F L T I A P F D F F Q L V F * S * C W S ----:----|----:----|----:----|----:----|----:----|----:----| L K E C N G R K V E E L K D E L G S T P C N R V I A G K S K K W S T K * D Q H Q I E * L Q G K Q S R G V Q R R T R I N T BdaI MaeIII TspEI TspEI BdaI Tsp45I | CviRI* \ \ \ \ \ CAAGTCAATTTACTTTTTCCACTTGATTTTGCTCTCAAAATGGTGTCACTAAATTGCATT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAGTTAAATGAAAAAGGTGAACTAAAACGAGAGTTTTACCACAGTGATTTAACGTAA / / / // | BdaI | |CviRI* | BdaI | TspEI TspEI Tsp45I MaeIII Q V N L L F P L D F A L K M V S L N C I K S I Y F F H L I L L S K W C H * I A L S Q F T F S T * F C S Q N G V T K L H C ----:----|----:----|----:----|----:----|----:----|----:----| * T L K S K G S S K A R L I T D S F Q M D L * N V K E V Q N Q E * F P T V L N C L D I * K K W K I K S E F H H * * I A N SmlI AflII |MseI || AluI || CviJI || | FatI || | SetI || | |CviAII || | || NlaIII || | || | CviJI || | || | | SduI || | || | | HgiJII* || | || | | | MwoI || | || | | | |HindIII || | || | | | || AluI || | || | | | || CviJI || | || | | | || | SetI || | || | | | || | |MseI || | || | | | || | ||AhaIII* BtsI \\ \ \\ \ \ \ \\ \ \\\ \ GTGTCAGTTTTGCGTTCCTTAAGCTCATGGGCTCACAAAGCTTTAAATCCAAACACACAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGTCAAAACGCAAGGAATTCGAGTACCCGAGTGTTTCGAAATTTAGGTTTGTGTGTG /// / // / / / / / // / ||| | || | | | | | |MseI TspRI ||| | || | | | | | AhaIII* BtsI ||| | || | | | | HindIII ||| | || | | | CviJI ||| | || | | | AluI ||| | || | | SetI ||| | || | MwoI ||| | || CviJI ||| | |HgiJII* ||| | |FatI ||| | |SduI ||| | CviAII ||| NlaIII ||CviJI ||AluI |AflII |SmlI MseI SetI V S V L R S L S S W A H K A L N P N T H C Q F C V P * A H G L T K L * I Q T H T V S F A F L K L M G S Q S F K S K H T H ----:----|----:----|----:----|----:----|----:----|----:----| T D T K R E K L E H A * L A K F G F V C Q T L K A N R L S M P E C L K L D L C V H * N Q T G * A * P S V F S * I W V C V AluI CviJI | SetI | | Hpy178III* | | | TfiI | | | HinfI | | | | XbaI | | | | |MaeI SetI | | | | |Hpy178III* | Eco57I | | | | || MboI | Eco57MI | | | | || | DpnI TspRI | | MboII | | | | || | |BstKTI \ \ \ \ \ \ \ \ \\ \ \\ ACTGCTAATAAGGTATTACTAAACACAACATCTTCAGCTCGTCAAGAATCTAGATCATCT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGATTATTCCATAATGATTTGTGTTGTAGAAGTCGAGCAGTTCTTAGATCTAGTAGA / / / / / / / /// / SetI | MboII | CviJI | | ||| Hin4I Eco57MI | AluI | | ||| Hin4I Eco57I SetI | | ||| MboI | | ||DpnI | | |BstKTI | | |XbaI | | Hpy178III* | | MaeI | HinfI | TfiI Hpy178III* T A N K V L L N T T S S A R Q E S R S S L L I R Y Y * T Q H L Q L V K N L D H L C * * G I T K H N I F S S S R I * I I F ----:----|----:----|----:----|----:----|----:----|----:----| V A L L T N S F V V D E A R * S D L D D C Q * Y P I V L C L M K L E D L I * I M S S I L Y * * V C C R * S T L F R S * R MboII MaeII BbvII* | Hpy99I | |SetI Hin4I | |TaiI Hin4I | ||Eam1105I Hin4I | MaeIII | ||| SetI Hin4I NdeI \ \ \ \\\ \ \ \ TTGAGTAACGACGTAAGGTCTTCTATTATGACAAGTAATGATGACTTCAAACCAACATAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCATTGCTGCATTCCAGAAGATAATACTGTTCATTACTACTGAAGTTTGGTTGTATA /// /// / / ||| ||BbvII* Hin4I NdeI ||| ||SetI Hin4I ||| |Eam1105I ||| MaeII ||MboII ||TaiI ||SetI |MaeIII Hpy99I L S N D V R S S I M T S N D D F K P T Y * V T T * G L L L * Q V M M T S N Q H M E * R R K V F Y Y D K * * * L Q T N I * ----:----|----:----|----:----|----:----|----:----|----:----| K L L S T L D E I I V L L S S K L G V Y K S Y R R L T K * * S L Y H H S * V L M Q T V V Y P R R N H C T I I V E F W C I BbvII* | MboII | |TspDTI | || MboI | || | DpnI | || | |MboII | || | |BstKTI CspCI HgaI TspEI \ \\ \ \\ \ \ \ GAAGACGAAGAAAGCAGATCATTGAGCAGTCAAAACATTGACGCAGACGACCCCACACAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGCTTCTTTCGTCTAGTAACTCGTCAGTTTTGTAACTGCGTCTGCTGGGGTGTGTT / // / / / | || MboI CspCI HgaI | |MboII | |DpnI | BstKTI TspDTI BbvII* MboII E D E E S R S L S S Q N I D A D D P T Q K T K K A D H * A V K T L T Q T T P H N R R R K Q I I E Q S K H * R R R P H T I ----:----|----:----|----:----|----:----|----:----|----:----| S S S S L L D N L L * F M S A S S G V C H L R L F C I M S C D F C Q R L R G W V F V F F A S * Q A T L V N V C V V G C L ApoI DdeI TspEI |CspCI Hpy188I \ \\ \ TTTGAAAATTTGAAACTAAGGAAAACTGCTTTATCGGAATGTATTGCTATTTTCAACAAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTTTAAACTTTGATTCCTTTTGACGAAATAGCCTTACATAACGATAAAAGTTGTTA / / / / / TspEI | | DdeI Hpy188I | CspCI TspEI ApoI F E N L K L R K T A L S E C I A I F N N L K I * N * G K L L Y R N V L L F S T I * K F E T K E N C F I G M Y C Y F Q Q * ----:----|----:----|----:----|----:----|----:----|----:----| N S F K F S L F V A K D S H I A I K L L I Q F N S V L S F Q K I P I Y Q * K * C K F I Q F * P F S S * R F T N S N E V I AluI CviJI | SetI | | BsrI | | | TatI | | | |Csp6I | | | ||RsaI TfiI | | | ||ScaI MseI HinfI TspEI \ \ \ \\\ \ \ \ AAACCCAAGAAAGCTATTCCAGTACTTATTAAAAAAGGATTTTTGAAAGATGATTCTCCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGGTTCTTTCGATAAGGTCATGAATAATTTTTTCCTAAAAACTTTCTACTAAGAGGT / / / /// / / | | BsrI ||TatI MseI HinfI | CviJI |Csp6I TfiI | AluI ScaI SetI RsaI K P K K A I P V L I K K G F L K D D S P N P R K L F Q Y L L K K D F * K M I L Q T Q E S Y S S T Y * K R I F E R * F S N ----:----|----:----|----:----|----:----|----:----|----:----| L G L F A I G T S I L F P N K F S S E G Y V W S L * E L V * * F L I K S L H N E F G L F S N W Y K N F F S K Q F I I R W StuI CviJI HaeIII | TaqI | | FatI | | |CviAII | | |BsiYI* | | || CfrI | | || |NlaIII | | || ||MnlI | | || ||CviJI | | || ||HaeIII | | || |||AciI | | || |||BisI | | || ||||BlsI | | || |||||TauI BsrDI | | || |||||NspBII* |TsoI Hin4II* | | || |||||| BsiYI* \\ \ \ \ \\ \\\\\\ \ ATTTCCATTGCCAAGTGGTTATTAGAAACAGAAGGCCTCGACATGGCCGCTGTTGGGGAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGTAACGGTTCACCAATAATCTTTGTCTTCCGGAGCTGTACCGGCGACAACCCCTA // / / /// /////// |TsoI Hin4II* | ||| ||||||BsiYI* TspEI | ||| |||||NspBII* BsrDI | ||| |||||AciI | ||| ||||CfrI | ||| ||||BisI | ||| |||BlsI | ||| ||HaeIII | ||| ||CviJI | ||| ||TauI | ||| |MnlI | ||| |FatI | ||| CviAII | ||NlaIII | |TaqI | BsiYI* HaeIII CviJI StuI I S I A K W L L E T E G L D M A A V G D F P L P S G Y * K Q K A S T W P L L G I F H C Q V V I R N R R P R H G R C W G L ----:----|----:----|----:----|----:----|----:----|----:----| I E M A L H N N S V S P R S M A A T P S L K W Q W T T I L F L L G R C P R Q Q P N G N G L P * * F C F A E V H G S N P I MaeI Hin4II* | Esp3I | BsmAI CviRI* | | BtgZI | Cac8I \ \ \ \ \ TATCTAGGCGAAGGAGACGACAAGAACATCGCTATAATGCACGCATTTGTTGATGAGTTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGATCCGCTTCCTCTGCTGTTCTTGTAGCGATATTACGTGCGTAAACAACTACTCAAA / / / / / / | MaeI | BtgZI | Cac8I Hin4II* BsmAI CviRI* Esp3I Y L G E G D D K N I A I M H A F V D E F I * A K E T T R T S L * C T H L L M S L S R R R R R Q E H R Y N A R I C * * V * ----:----|----:----|----:----|----:----|----:----|----:----| * R P S P S S L F M A I I C A N T S S N N D L R L L R C S C R * L A R M Q Q H T I * A F S V V L V D S Y H V C K N I L K HindII Hpy166II MslI | MseI Hpy188I | BsrI | | HgaI | BssKI | TspRI | | | SetI | EcoRII \ \ \ \ \ \ \ \ GACTTCACTGGTATGTCCATTGTTGACGCATTAAGGTCATTTTTACAAAGTTTCAGATTG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGTGACCATACAGGTAACAACTGCGTAATTCCAGTAAAAATGTTTCAAAGTCTAAC / / / / / / / TspRI MslI Hpy166II MseI HgaI | Hin4II* BsrI HindII SetI Hpy188I D F T G M S I V D A L R S F L Q S F R L T S L V C P L L T H * G H F Y K V S D C L H W Y V H C * R I K V I F T K F Q I A ----:----|----:----|----:----|----:----|----:----|----:----| S K V P I D M T S A N L D N K C L K L N Q S * Q Y T W Q Q R M L T M K V F N * I V E S T H G N N V C * P * K * L T E S Q TspEI |TspDTI || GsuI || Eco57MI || | TfiI Hin4II* || | HinfI |ScrFI || | | FatI |BseBI || | | |CviAII AsuI* || EcoNI || | | || NlaIII AvaII || | BsiYI* || | | || | ApoI Hpy166II || | | SetI || | | || | TspEI AciI |BmgT120I \\ \ \ \ \\ \ \ \\ \ \ \ \\ CCTGGAGAAGGTCAAAAAATTGACAGATTCATGCTGAAATTTGCGGAAAGATTTGTGGAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCTCTTCCAGTTTTTTAACTGTCTAAGTACGACTTTAAACGCCTTTCTAAACACCTG //// / / / / // / / / // |||| SetI | Eco57MI | |FatI | AciI | |AvaII |||EcoNI | TspEI | CviAII TspEI | |AsuI* ||EcoRII | GsuI NlaIII ApoI | BmgT120I ||BssKI TspDTI HinfI Hpy166II |BsiYI* TfiI BseBI ScrFI P G E G Q K I D R F M L K F A E R F V D L E K V K K L T D S C * N L R K D L W T W R R S K N * Q I H A E I C G K I C G P ----:----|----:----|----:----|----:----|----:----|----:----| G P S P * F I S L N M S F N A S L N T S A Q L L D F F Q C I * A S I Q P F I Q P R S F T L F N V S E H Q F K R F S K H V BssKI MboI SecI* BclI | HpaII PleI MwoI | DpnI | ScrFI |MlyI | CviRI* | |FatI | CauII* ||BciVI | | NdeI | |BstKTI | | HinfI ||| AciI | | | EciI | ||CviAII \ \ \ \\\ \ \ \ \ \ \ \\\ CAAAACCCCGGAGTCTTTTCAAAGGCGGATACTGCATATGTGCTTTCGTATTCTTTGATC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGGGGCCTCAGAAAAGTTTCCGCCTATGACGTATACACGAAAGCATAAGAAACTAG /// / / // / / //// ||| HinfI BciVI |MwoI | EciI |||BclI ||BssKI PleI AciI | NdeI |||MboI |SecI* MlyI CviRI* ||NlaIII |HpaII |DpnI CauII* BstKTI ScrFI Q N P G V F S K A D T A Y V L S Y S L I K T P E S F Q R R I L H M C F R I L * S K P R S L F K G G Y C I C A F V F F D H ----:----|----:----|----:----|----:----|----:----|----:----| W F G P T K E F A S V A Y T S E Y E K I G F G R L R K L P P Y Q M H A K T N K S L V G S D K * L R I S C I H K R I R Q D MaeIII NlaIII Tsp45I \ \ ATGTTGAATACTGATTTACATTCGTCACAAATCAAAAATAAAATGTCTTTACAAGAGTTT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACTTATGACTAAATGTAAGCAGTGTTTAGTTTTTATTTTACAGAAATGTTCTCAAA // / |FatI Tsp45I CviAII MaeIII M L N T D L H S S Q I K N K M S L Q E F C * I L I Y I R H K S K I K C L Y K S F V E Y * F T F V T N Q K * N V F T R V F ----:----|----:----|----:----|----:----|----:----|----:----| M N F V S K C E D C I L F L I D K C S N * T S Y Q N V N T V F * F Y F T K V L T H Q I S I * M R * L D F I F H R * L L K BsmAI | MboII | TspGWI | | AloI Hin4II* SetI Ksp632I* | | | Hin4II* SetI \ \ \ \ \ \ \ \ TTAGAAAACAACGAAGGTATTGACAACGGAAGAGATTTACCAAGAGACTTCTTGGAAGGT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTGTTGCTTCCATAACTGTTGCCTTCTCTAAATGGTTCTCTGAAGAACCTTCCA / / / //// / / Hin4II* SetI Ksp632I* |||BsmAI Hin4II* SetI ||AloI |MboII TspGWI L E N N E G I D N G R D L P R D F L E G * K T T K V L T T E E I Y Q E T S W K V R K Q R R Y * Q R K R F T K R L L G R F ----:----|----:----|----:----|----:----|----:----|----:----| K S F L S P I S L P L S K G L S K K S P K L F C R L Y Q C R F L N V L L S R P L * F V V F T N V V S S I * W S V E Q F T BdaI BdaI | MseI | |TspEI | || TspDTI TspEI AloI | || | Hpy188I SfaNI \ \ \ \\ \ \ \ TTGTTCAACGAAATTGCTAACAATGAAATCAAGTTAATTTCTGAACAGCATCAGGCAATG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AACAAGTTGCTTTAACGATTGTTACTTTAGTTCAATTAAAGACTTGTCGTAGTCCGTTAC / / / / / / / | TspEI BdaI | | Hpy188I BsrDI AloI BdaI | TspEI TspDTI MseI L F N E I A N N E I K L I S E Q H Q A M C S T K L L T M K S S * F L N S I R Q C V Q R N C * Q * N Q V N F * T A S G N A ----:----|----:----|----:----|----:----|----:----|----:----| K N L S I A L L S I L N I E S C C * A I N T * R F Q * C H F * T L K Q V A D P L Q E V F N S V I F D L * N R F L M L C H BsrDI | BdaI MseI | BdaI BsaBI |TspEI | | SetI | HphI MmeI || BsiI* \ \ \ \ \ \ \\ \ CTTTCAGGTGATACCAATCTTGTCCAACAACAGCAATCTGCTTTCAACTTCTTTAATTCT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGTCCACTATGGTTAGAACAGGTTGTTGTCGTTAGACGAAAGTTGAAGAAATTAAGA / / / / / / / / | | SetI | HphI MmeI | TspEI | BdaI BsaBI MseI | BdaI SfaNI L S G D T N L V Q Q Q Q S A F N F F N S F Q V I P I L S N N S N L L S T S L I L F R * Y Q S C P T T A I C F Q L L * F S ----:----|----:----|----:----|----:----|----:----|----:----| S E P S V L R T W C C C D A K L K K L E A K L H Y W D Q G V V A I Q K * S R * N K * T I G I K D L L L L R S E V E K I R TspDTI |BsmAI Hpy178III* || ApoI | MnlI || TspEI TspEI \ \ \\ \ \ CGTGATTTGACAAGAGAGGCATATAATCAAGTCTCAAAAGAAATTTCATCTAAAACGGAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GCACTAAACTGTTCTCTCCGTATATTAGTTCAGAGTTTTCTTTAAAGTAGATTTTGCCTT / / / / / | MnlI TspDTI | TspEI Hpy178III* | ApoI BsiI* BsmAI R D L T R E A Y N Q V S K E I S S K T E V I * Q E R H I I K S Q K K F H L K R N * F D K R G I * S S L K R N F I * N G I ----:----|----:----|----:----|----:----|----:----|----:----| R S K V L S A Y L * T E F S I E D L V S E H N S L L P M Y D L R L L F K M * F P T I Q C S L C I I L D * F F N * R F R F AsuI* |CviJI |HaeIII |BmgT120I || BbvI MseI || | AcyI | TspGWI || | MaeII | | ApoI || | |ZraI | | TspEI || | || SetI TseI | | | MseI || | || TaiI |BisI | | | |AhaIII* MnlI || | || AatII ||BlsI \ \ \ \\ \ \\ \ \\ \ \\\ TTAGTCTTTAAGAATTTAAACAAAAATAAAGGAGGCCCAGACGTCTATTATGCTGCTTCC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAGAAATTCTTAAATTTGTTTTTATTTCCTCCGGGTCTGCAGATAATACGACGAAGG / / / /// / /// / // /// TspEI | MseI ||MseI MnlI ||| | |MaeII ||TseI TspGWI |AhaIII* ||| | |AcyI |BisI TspEI ||| | |BbvI BlsI ApoI ||| | ZraI ||| AatII ||| TaiI ||| SetI ||AsuI* |BmgT120I HaeIII CviJI L V F K N L N K N K G G P D V Y Y A A S * S L R I * T K I K E A Q T S I M L L P S L * E F K Q K * R R P R R L L C C F P ----:----|----:----|----:----|----:----|----:----|----:----| N T K L F K F L F L P P G S T * * A A E I L R * S N L C F Y L L G L R R N H Q K * D K L I * V F I F S A W V D I I S S G MaeII | SetI FokI | TaiI |TseI | | FatI ||BisI | | |CviAII TspEI |||BlsI | | || NspI | BsmAI ||||AluI | | || NlaIII | | TaqI ||||CviJI | | || |MseI | | |Hpy178III* BseGI ||||| SetI \ \ \\ \\ \ \ \\ \ \\\\\ \ CACGTTGAGCATGTTAAATCAATTTTCGAGACACTATGGATGTCCTTTTTAGCAGCTCTA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCAACTCGTACAATTTAGTTAAAAGCTCTGTGATACCTACAGGAAAAATCGTCGAGAT / / / // / / / // / /// | | | || MseI | | |Hpy178III* BseGI ||CviJI | | | |FatI | | TaqI ||FokI | | | CviAII | BsmAI ||TseI | | NlaIII TspEI ||AluI | | NspI |BisI | MaeII BlsI TaiI SetI SetI H V E H V K S I F E T L W M S F L A A L T L S M L N Q F S R H Y G C P F * Q L * R * A C * I N F R D T M D V L F S S S N ----:----|----:----|----:----|----:----|----:----|----:----| W T S C T L D I K S V S H I D K K A A R G R Q A H * I L K R S V I S T R K L L E V N L M N F * N E L C * P H G K * C S * MseI BbvI |BsiYI* Hin4II* CviJI \ \\ \ \ ACCCCCCCATTTAAGGATTATGATGACATTGACACAACCAATAAGTGTTTAGAAGGCTTG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGGGGGTAAATTCCTAATACTACTGTAACTGTGTTGGTTATTCACAAATCTTCCGAAC // / / / || MseI Hin4II* CviJI |BsiYI* BbvI T P P F K D Y D D I D T T N K C L E G L P P H L R I M M T L T Q P I S V * K A * P P I * G L * * H * H N Q * V F R R L E ----:----|----:----|----:----|----:----|----:----|----:----| V G G N L S * S S M S V V L L H K S P K L G G M * P N H H C Q C L W Y T N L L S G G W K L I I I V N V C G I L T * F A Q TspEI SfaNI | MseI | TfiI | | TspEI | HinfI MaeI SetI MnlI \ \ \ \ \ \ \ \ AAAATATCAATTAAAATTGCTTCTACTTTTAGAATCAATGATGCTAGAACCTCCTTTGTA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATAGTTAATTTTAACGAAGATGAAAATCTTAGTTACTACGATCTTGGAGGAAACAT // / // / / / |MseI TspEI |HinfI | SetI MnlI TspEI |TfiI MaeI SetI SfaNI K I S I K I A S T F R I N D A R T S F V K Y Q L K L L L L L E S M M L E P P L * N I N * N C F Y F * N Q * C * N L L C R ----:----|----:----|----:----|----:----|----:----|----:----| F I D I L I A E V K L I L S A L V E K T S F I L * F Q K * K * F * H H * F R R Q F Y * N F N S R S K S D I I S S G G K Y Hin4II* MboII SetI TspEI MaeIII SetI |SetI |MseI \ \ \ \ \\ \\ GGTGCGTTAGTCCAATTTTGTAACCTTCAAAACCTTGAAGAAATCAAAGTTAAAAATGTC 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGCAATCAGGTTAAAACATTGGAAGTTTTGGAACTTCTTTAGTTTCAATTTTTACAG / / / / / / / | | MaeIII | Hin4II* | MseI | SetI SetI MboII TspEI G A L V Q F C N L Q N L E E I K V K N V V R * S N F V T F K T L K K S K L K M S C V S P I L * P S K P * R N Q S * K C Q ----:----|----:----|----:----|----:----|----:----|----:----| P A N T W N Q L R * F R S S I L T L F T L H T L G I K Y G E F G Q L F * L * F H T R * D L K T V K L V K F F D F N F I D Hpy178III* | FnuDII* | | Hin4II* | | | Hpy188I CviRI* | | | | TspEI MboI | MboII | | | | |TstI | DpnI | | TspEI | | | | |BsaXI | Hin4II* | | BsrDI | | | | || MnlI | |BstKTI \ \ \ \ \ \ \ \\ \ \ \\ AATGCAATGGTAATTCTTCTTGAAGTCGCGTTATCAGAAGGAAATTACTTGGAGGGATCG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTTACCATTAAGAAGAACTTCAGCGCAATAGTCTTCCTTTAATGAACCTCCCTAGC / / / / / / / / / / / / // / | | BsrDI TspEI | | | | | | | TspEI || MboI | MboII | | | | | | MnlI |DpnI CviRI* | | | | | BsaXI Hin4II* | | | | TstI BstKTI | | | Hpy188I | | Hin4II* | FnuDII* Hpy178III* N A M V I L L E V A L S E G N Y L E G S M Q W * F F L K S R Y Q K E I T W R D R C N G N S S * S R V I R R K L L G G I V ----:----|----:----|----:----|----:----|----:----|----:----| L A I T I R R S T A N D S P F * K S P D * H L P L E E Q L R T I L L F N S P P I I C H Y N K K F D R * * F S I V Q L S R BsaXI MfeI PpiI BinI* | TstI BsmAI TspEI EcoRV |SetI \ \ \ \ \ \ \\ TGGAAGGACATTTTGCTGGTCGTGTCTCAAATGGAAAGACTACAATTGATATCCAAAGGT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTCCTGTAAAACGACCAGCACAGAGTTTACCTTTCTGATGTTAACTATAGGTTTCCA / / / / / / / BinI* BsaXI BsmAI | | | SetI TstI | | PpiI | EcoRV TspEI MfeI W K D I L L V V S Q M E R L Q L I S K G G R T F C W S C L K W K D Y N * Y P K V E G H F A G R V S N G K T T I D I Q R Y ----:----|----:----|----:----|----:----|----:----|----:----| H F S M K S T T D * I S L S C N I D L P T S P C K A P R T E F P F V V I S I W L P L V N Q Q D H R L H F S * L Q Y G F T Tsp4CI* | NlaIV | | Hpy178III* | | | CviRI* | | | | PpiI | | | | | AluI | | | | | CviJI | | | | | |BsiI* | | | | | ||SetI | | | | | ||| MwoI TaqI | | | | | ||| | CviRI* MaeI \ \ \ \ \ \ \\\ \ \ \ ATCGACAGAGATACGGTTCCAGATGTTGCACAAGCTCGTGTTGCAAACCCTAGAGTTTCT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTGTCTCTATGCCAAGGTCTACAACGTGTTCGAGCACAACGTTTGGGATCTCAAAGA / / / / / / / / / / / / TaqI | | | | | | | | | CviRI* MaeI | | | | | | | | BsiI* | | | | | | | MwoI | | | | | | CviJI | | | | | | AluI | | | | | SetI | | | | CviRI* | | | PpiI | | Hpy178III* | NlaIV Tsp4CI* I D R D T V P D V A Q A R V A N P R V S S T E I R F Q M L H K L V L Q T L E F L R Q R Y G S R C C T S S C C K P * S F L ----:----|----:----|----:----|----:----|----:----|----:----| I S L S V T G S T A C A R T A F G L T E Y R C L Y P E L H Q V L E H Q L G * L K D V S I R N W I N C L S T N C V R S N R TfiI HinfI | BinI* | | Hpy178III* | | | MboI | | | XhoII | | | | DpnI | | | | |BstKTI Hin4II* Bce83I* \ \ \ \ \\ \ \ TACGAATCATCAAGATCCAATAATACATCTTTCTTTGATGTTTGGGGCAAGAAGGCAACT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTAGTAGTTCTAGGTTATTATGTAGAAAGAAACTACAAACCCCGTTCTTCCGTTGA / / /// / / / | | ||| XhoII Hin4II* Bce83I* | | ||| MboI | | ||DpnI | | |BstKTI | | Hpy178III* | BinI* HinfI TfiI Y E S S R S N N T S F F D V W G K K A T T N H Q D P I I H L S L M F G A R R Q L R I I K I Q * Y I F L * C L G Q E G N S ----:----|----:----|----:----|----:----|----:----|----:----| * S D D L D L L V D K K S T Q P L F A V K R I M L I W Y Y M K R Q H K P C S P L V F * * S G I I C R E K I N P A L L C S TspEI TspDTI | BstXI | GsuI | | CviJI | Eco57MI | | |SmlI | | ApoI | | || Hpy178III* HphI SetI | | TspEI \ \ \\ \ \ \ \ \ \ CCCACAGAATTGGCTCAAGAAAAACACCATAATCAAACCTTATCACCCGAAATCTCTAAA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGTCTTAACCGAGTTCTTTTTGTGGTATTAGTTTGGAATAGTGGGCTTTAGAGATTT / / / / / / / / BstXI | | Hpy178III* | SetI | Eco57MI | | SmlI HphI | GsuI | CviJI TspDTI TspEI P T E L A Q E K H H N Q T L S P E I S K P Q N W L K K N T I I K P Y H P K S L N H R I G S R K T P * S N L I T R N L * I ----:----|----:----|----:----|----:----|----:----|----:----| G V S N A * S F C W L * V K D G S I E L E W L I P E L F V G Y D F R I V R F R * G C F Q S L F F V M I L G * * G F D R F TspEI | MnlI BsrI | TspRI BccI Hpy188I \ \ \ \ \ TTCATTTCCTCCAGTGAATTAGTCGTTTTGATGGACAATATATTTACCAAAAGTTCCGAG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAAAGGAGGTCACTTAATCAGCAAAACTACCTGTTATATAAATGGTTTTCAAGGCTC / / / / / / TspEI TspRI | | BccI Hpy188I ApoI BsrI | TspEI MnlI F I S S S E L V V L M D N I F T K S S E S F P P V N * S F * W T I Y L P K V P S H F L Q * I S R F D G Q Y I Y Q K F R V ----:----|----:----|----:----|----:----|----:----|----:----| N M E E L S N T T K I S L I N V L L E S I * K R W H I L R K S P C Y I * W F N R E N G G T F * D N Q H V I Y K G F T G L BaeI | HindIII | | AluI | | CviJI | | | SetI | | | |MseI | | | || MwoI | | | || |AciI SetI | | | || || NspBII* TspEI \ \ \ \ \\ \\ \ \ TTATCAGGTAATGCTATCGTTGATTTTATCAAAGCTTTAACCGCTGTATCTTTAGAAGAA 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGTCCATTACGATAGCAACTAAAATAGTTTCGAAATTGGCGACATAGAAATCTTCTT / / / / // / / / SetI BaeI | | || | NspBII* BaeI | | || | AciI | | || MseI | | |MwoI | | HindIII | CviJI | AluI SetI L S G N A I V D F I K A L T A V S L E E Y Q V M L S L I L S K L * P L Y L * K K I R * C Y R * F Y Q S F N R C I F R R N ----:----|----:----|----:----|----:----|----:----|----:----| N D P L A I T S K I L A K V A T D K S S T I L Y H * R Q N * * L K L R Q I K L L * * T I S D N I K D F S * G S Y R * F F BaeI | TfiI | HinfI | | MboII AjuI | | | Hpy188I AjuI XmnI CviRI* | TaqI \ \ \ \ \ \ \ \ \ ATTGAATCATCTGAAAATGCTTCCACACCAAGAATGTTTTCCTTGCAAAAAATGGTCGAT 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTAGTAGACTTTTACGAAGGTGTGGTTCTTACAAAAGGAACGTTTTTTACCAGCTA / // / / / / / / | || | AjuI XmnI | AjuI TaqI | || Hpy188I CviRI* | |HinfI | |TfiI | MboII TspEI I E S S E N A S T P R M F S L Q K M V D L N H L K M L P H Q E C F P C K K W S M * I I * K C F H T K N V F L A K N G R C ----:----|----:----|----:----|----:----|----:----|----:----| I S D D S F A E V G L I N E K C F I T S F Q I M Q F H K W V L F T K R A F F P R N F * R F I S G C W S H K G Q L F H D I AcyI | AciI MboI | BisI | DpnI | |BlsI | |BstKTI | ||TauI | || BinI* | ||| HgaI MaeIII | || | MaeI | ||| | CviJI \ \ \\ \ \ \ \\\ \ \ GTATGTTACTACAATATGGATCGTATCAAACTAGAATGGACGCCGCTTTGGGCTGTTATG 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CATACAATGATGTTATACCTAGCATAGTTTGATCTTACCTGCGGCGAAACCCGACAATAC / // / / / //// // MaeIII || MboI BinI* MaeI |||AciI |HgaI |DpnI ||BisI CviJI BstKTI |BlsI AcyI TauI V C Y Y N M D R I K L E W T P L W A V M Y V T T I W I V S N * N G R R F G L L W M L L Q Y G S Y Q T R M D A A L G C Y G ----:----|----:----|----:----|----:----|----:----|----:----| T H * * L I S R I L S S H V G S Q A T I H I N S C Y P D Y * V L I S A A K P Q * Y T V V I H I T D F * F P R R K P S N H HindIII | AluI HgaI | CviJI |TaqI | | SetI DdeI |ClaI \ \ \ \ \\ GGAAAAGCTTTCAACAAGATTGCTACAAACTCTAACTTAGCAGTAGTATTTTTCGCTATC 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTTCGAAAGTTGTTCTAACGATGTTTGAGATTGAATCGTCATCATAAAAAGCGATAG / / / / | | HindIII DdeI | CviJI | AluI SetI G K A F N K I A T N S N L A V V F F A I E K L S T R L L Q T L T * Q * Y F S L S K S F Q Q D C Y K L * L S S S I F R Y R ----:----|----:----|----:----|----:----|----:----|----:----| P F A K L L I A V F E L K A T T N K A I P F L K * C S Q * L S * S L L L I K R * S F S E V L N S C V R V * C Y Y K E S D SetI TfiI MfeI Hin4I | ApoI HinfI TspEI | MnlI TspEI | TspEI \ \ \ \ \ \ \ GATTCCCTGCGTCAATTGTCTATGAGATTTTTAGATATTGAGGAATTATCAGGTTTTGAA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGGGACGCAGTTAACAGATACTCTAAAAATCTATAACTCCTTAATAGTCCAAAACTT / // / / / / / / | |HinfI TspEI Hin4I MnlI | SetI Hin4I | |TfiI MfeI TspEI | HgaI ClaI TaqI D S L R Q L S M R F L D I E E L S G F E I P C V N C L * D F * I L R N Y Q V L N F P A S I V Y E I F R Y * G I I R F * I ----:----|----:----|----:----|----:----|----:----|----:----| S E R R * N D I L N K S I S S N D P K S R N G A D I T * S I K L Y Q P I I L N Q I G Q T L Q R H S K * I N L F * * T K F Hin4I | FatI | |CviAII | || NlaIII | || | MseI | || | |AhaIII* | || | || SetI Tsp4CI* TspRI \ \\ \ \\ \ \ \ TTTCAACATGATTTTTTAAAACCTTTTGAATACACGGTTCAAAATAGTGGCAACACTGAA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTTGTACTAAAAAATTTTGGAAAACTTATGTGCCAAGTTTTATCACCGTTGTGACTT / / // // / / / | | |FatI || SetI Tsp4CI* TspRI | | CviAII |MseI | NlaIII AhaIII* TspEI ApoI F Q H D F L K P F E Y T V Q N S G N T E F N M I F * N L L N T R F K I V A T L K S T * F F K T F * I H G S K * W Q H * S ----:----|----:----|----:----|----:----|----:----|----:----| N * C S K K F G K S Y V T * F L P L V S I E V H N K L V K Q I C P E F Y H C C Q K L M I K * F R K F V R N L I T A V S F Eco57I Eco57MI Hpy178III* | TspDTI Hpy188I \ \ \ \ GTTCAAGAAATGATTATTGAGTGTTTTAGGAACTTCATATTGACAAAATCGGAAAGTATC 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTTCTTTACTAATAACTCACAAAATCCTTGAAGTATAACTGTTTTAGCCTTTCATAG / / / / | | TspDTI Hpy188I | Eco57MI | Eco57I Hpy178III* V Q E M I I E C F R N F I L T K S E S I F K K * L L S V L G T S Y * Q N R K V S S R N D Y * V F * E L H I D K I G K Y Q ----:----|----:----|----:----|----:----|----:----|----:----| T * S I I I S H K L F K M N V F D S L I L E L F S * Q T N * S S * I S L I P F Y N L F H N N L T K P V E Y Q C F R F T D BceAI Hpy178III* CviJI | TfiI | TfiI | Cac8I | HinfI CviJI CviJI | HinfI Bce83I* | | SmlI | | TspRI \ \ \ \ \ \ \ \ \ \ \ AAATCTGGCTGGAAGCCTATTCTTGAATCCTTACAATATACGGCTCGCTCAAGCACTGAA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGACCGACCTTCGGATAAGAACTTAGGAATGTTATATGCCGAGCGAGTTCGTGACTT / / / / / / / // / CviJI CviJI | | Bce83I* | Cac8I |SmlI BceAI | HinfI CviJI TspRI | TfiI Hpy178III* K S G W K P I L E S L Q Y T A R S S T E N L A G S L F L N P Y N I R L A Q A L N I W L E A Y S * I L T I Y G S L K H * I ----:----|----:----|----:----|----:----|----:----|----:----| L D P Q F G I R S D K C Y V A R E L V S * I Q S S A * E Q I R V I Y P E S L C Q F R A P L R N K F G * L I R S A * A S F TsoI | MfeI BsrDI TaqI | TspEI | MaeIII AsuII MseI | | HgaI | Tsp45I Bce83I* \ \ \ \ \ \ \ TCCATTGTATTAAAGACGCAATTGCTGGTTAGCAATGATATTGTGACAAATCACTTCGAA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAACATAATTTCTGCGTTAACGACCAATCGTTACTATAACACTGTTTAGTGAAGCTT / / / / / / / / / HinfI | TsoI TspEI HgaI BsrDI Tsp45I | AsuII TfiI MseI MfeI MaeIII | TaqI Bce83I* S I V L K T Q L L V S N D I V T N H F E P L Y * R R N C W L A M I L * Q I T S K H C I K D A I A G * Q * Y C D K S L R K ----:----|----:----|----:----|----:----|----:----|----:----| D M T N F V C N S T L L S I T V F * K S I W Q I L S A I A P * C H Y Q S L D S R G N Y * L R L Q Q N A I I N H C I V E F MaeII | SetI MboII | TaiI |DdeI | | SfaNI ||Eco57I | | | SmlI ||Eco57MI | | | | Hpy178III* ||Hpy188I | | | | | BseMII ||| MboII HphI | | | | | |BspCNI ||| BbvII* |Hpy188I \ \ \ \ \ \\ \\\ \ \\ AACGTATTCTCTCAAGAAGATGCCTTTTCTGAGTTAGTTGGTGTCTTCAGAGAAATCACC 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCATAAGAGAGTTCTTCTACGGAAAAGACTCAATCAACCACAGAAGTCTCTTTAGTGG / / / / // /// / / / // | MaeII | | |BspCNI ||| | | BbvII* |Hpy188I TaiI | | BseMII ||| | MboII HphI SetI | Hpy178III* ||| DdeI | SmlI ||Hpy188I SfaNI |Eco57MI |Eco57I MboII N V F S Q E D A F S E L V G V F R E I T T Y S L K K M P F L S * L V S S E K S P R I L S R R C L F * V S W C L Q R N H Q ----:----|----:----|----:----|----:----|----:----|----:----| F T N E * S S A K E S N T P T K L S I V F R I R E L L H R K Q T L Q H R * L F * V Y E R L F I G K R L * N T D E S F D G DdeI FatI |BsmAI |CviAII ||PleI AluI || NspI |||MlyI TfiI CviJI || NlaIII |||| MlyI HinfI HinfI | SetI || | HinfI |||| PleI | DdeI \ \ \ \\ \ \ \\\\ \ \ \ AAAAATAAGAGATTCCAAAAGCTATCTCTACATGCTTTGGAGTCTCTAAGAAAGATGACT 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTATTCTCTAAGGTTTTCGATAGAGATGTACGAAACCTCAGAGATTCTTTCTACTGA / / / / // / / // / | | CviJI | |FatI HinfI | |PleI HinfI | | AluI | CviAII | BsmAI | SetI NlaIII | MlyI HinfI NspI PleI TfiI MlyI DdeI K N K R F Q K L S L H A L E S L R K M T K I R D S K S Y L Y M L W S L * E R * L K * E I P K A I S T C F G V S K K D D S ----:----|----:----|----:----|----:----|----:----|----:----| L F L L N W F S D R C A K S D R L F I V W F Y S I G F A I E V H K P T E L F S S F I L S E L L * R * M S Q L R * S L H S Hpy188I | MaeII | | SetI | | TaiI | | | Hpy99I SfaNI | | | | BspCNI |MboII | | | | |BseMII TspDTI || MboII \ \ \ \ \\ \ \\ \ CAGAACGTCGCAGACATCTGTTTTTACAATGAAAATAAGACTGAAGAAGAAAGAAAACAT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTGCAGCGTCTGTAGACAAAAATGTTACTTTTATTCTGACTTCTTCTTTCTTTTGTA // // / // / / // / || || | |BseMII TspDTI | || Eco57MI || || | BspCNI | || Eco57I || || MaeII | |SfaNI || |Hpy99I | MboII || TaiI MboII || SetI |DdeI Hpy188I Q N V A D I C F Y N E N K T E E E R K H R T S Q T S V F T M K I R L K K K E N I E R R R H L F L Q * K * D * R R K K T * ----:----|----:----|----:----|----:----|----:----|----:----| * F T A S M Q K * L S F L V S S S L F C E S R R L C R N K C H F Y S Q L L F F V L V D C V D T K V I F I L S F F F S F M AloI | PfoI | BssKI MslI | EcoRII BseGI Eco57I | | ScrFI | NlaIV Eco57MI | | BseBI | | FokI AloI \ \ \ \ \ \ \ \ AACGATGCTTTACTTCGTGGGAAAGACATATTCCAGGATGTGTGGTTCCCTATGTTATTC 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTACGAAATGAAGCACCCTTTCTGTATAAGGTCCTACACACCAAGGGATACAATAAG / / / / / / / / MslI AloI | | BseGI NlaIV | AloI | EcoRII FokI | BssKI | PfoI BseBI ScrFI N D A L L R G K D I F Q D V W F P M L F T M L Y F V G K T Y S R M C G S L C Y S R C F T S W E R H I P G C V V P Y V I L ----:----|----:----|----:----|----:----|----:----|----:----| L S A K S R P F S M N W S T H N G I N N Y R H K V E H S L C I G P H T T G * T I V I S * K T P F V Y E L I H P E R H * E DdeI | BbvII* MboI | | MboII | DpnI | | | MboI | |FatI | | | | DpnI | |BspHI | | | | |BstKTI | |BstKTI | | | | ||Eco57I | ||CviAII | | | | ||Eco57MI | ||Hpy178III* | | | | |||MaeII | ||| NlaIII | | | | ||||PmaCI | ||| | AluI | | | | ||||BsaAI | ||| | CviJI | | | | ||||| SetI | ||| | PvuII | | | | ||||| TaiI | ||| | NspBII* | | | | ||||| |CviRI* | ||| | | SetI | | | | ||||| || MseI SfaNI \ \\\ \ \ \ \ \ \ \ \\\\\ \\ \ \ TGCTTCAATGATACGATCATGACAGCTGAAGACTTAGAAGTTAGATCACGTGCATTAAAC 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAAGTTACTATGCTAGTACTGTCGACTTCTGAATCTTCAATCTAGTGCACGTAATTTG //// // / / / / // / // / / |||| || | NspBII* | | || | || | MseI |||| || | PvuII | | || | || CviRI* |||| || | CviJI | | || | |MaeII |||| || | AluI | | || | BsaAI |||| || SetI | | || | PmaCI |||| |BspHI | | || MboI |||| |FatI | | || TaiI |||| Hpy178III* | | || SetI |||| CviAII | | |Eco57MI |||MboI | | |Eco57I ||NlaIII | | |DpnI |DpnI | | BstKTI BstKTI | BbvII* | MboII DdeI C F N D T I M T A E D L E V R S R A L N A S M I R S * Q L K T * K L D H V H * T L Q * Y D H D S * R L R S * I T C I K L ----:----|----:----|----:----|----:----|----:----|----:----| Q K L S V I M V A S S K S T L D R A N F R S * H Y S * S L Q L S L L * I V H M L A E I I R D H C S F V * F N S * T C * V MaeI | BglI ApoI TaqI | MwoI NdeI TspEI \ \ \ \ \ TATATGTTCGATGCCCTAGTGGCATATGGTGGTAAATTCAATGATGATTTCTGGGAAAAG 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| ATATACAAGCTACGGGATCACCGTATACCACCATTTAAGTTACTACTAAAGACCCTTTTC / / / / / / SfaNI TaqI | MaeI NdeI TspEI MwoI ApoI BglI Y M F D A L V A Y G G K F N D D F W E K I C S M P * W H M V V N S M M I S G K R Y V R C P S G I W W * I Q * * F L G K D ----:----|----:----|----:----|----:----|----:----|----:----| * I N S A R T A Y P P L N L S S K Q S F S Y T R H G L P M H H Y I * H H N R P F I H E I G * H C I T T F E I I I E P F L PflMI HindII MaeIII BsiYI* BsiYI* Hpy166II \ \ \ \ ATTTGTAAGAAGTTACTATTTCCTATTTTCGGTGTATTATCCAAACATTGGGAAGTCAAC 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACATTCTTCAATGATAAAGGATAAAAGCCACATAATAGGTTTGTAACCCTTCAGTTG / / / / MaeIII BsiYI* BsiYI* Hpy166II PflMI HindII I C K K L L F P I F G V L S K H W E V N F V R S Y Y F L F S V Y Y P N I G K S T L * E V T I S Y F R C I I Q T L G S Q P ----:----|----:----|----:----|----:----|----:----|----:----| I Q L F N S N G I K P T N D L C Q S T L S K Y S T V I E * K R H I I W V N P L * N T L L * * K R N E T Y * G F M P F D V FatI BspHI MaeII |CviAII | MseI CviJI |Hpy178III* | SetI | SmlI || NlaIII CviJI | TaiI | AflII TspEI || | MseI | TaqI | |TspEI | |MseI \ \\ \ \ \ \ \ \\ \ \\ CAATTCAATAGTCATGATGATTTAAGTGTTTGGCTTTCGACCACGTTAATTCAAGCCTTA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAGTTATCAGTACTACTAAATTCACAAACCGAAAGCTGGTGCAATTAAGTTCGGAAT / / // / / / / / / / / / TspEI | |BspHI MseI CviJI | | | | | | MseI | |FatI | | | | | CviJI | Hpy178III* | | | | TspEI | CviAII | | | MseI NlaIII | | MaeII | TaiI | SetI TaqI Q F N S H D D L S V W L S T T L I Q A L N S I V M M I * V F G F R P R * F K P * I Q * S * * F K C L A F D H V N S S L K ----:----|----:----|----:----|----:----|----:----|----:----| W N L L * S S K L T Q S E V V N I * A K G I * Y D H H N L H K A K S W T L E L R L E I T M I I * T N P K R G R * N L G * EcoP15I | BccI TfiI | | TaqI HinfI | | BsmI \ \ \ \ AGGAACTTGATTGCCCTTTTTACGCATTACTTTGAATCGTTGAACAGAATGCTCGATGGA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTGAACTAACGGGAAAAATGCGTAATGAAACTTAGCAACTTGTCTTACGAGCTACCT / / / // / AflII HinfI | || TaqI SmlI TfiI | |BsmI | BccI EcoP15I R N L I A L F T H Y F E S L N R M L D G G T * L P F L R I T L N R * T E C S M D E L D C P F Y A L L * I V E Q N A R W I ----:----|----:----|----:----|----:----|----:----|----:----| L F K I A R K V C * K S D N F L I S S P L S S S Q G K * A N S Q I T S C F A R H P V Q N G K K R M V K F R Q V S H E I S MaeI BciVI | TspEI | Hpy178III* | | BinI* \ \ \ \ \ TTTTTGGGTCTGCTGGTATCCTGTATTTGTCAAGAAAATGACACTATTGCTAGAATTGGG 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACCCAGACGACCATAGGACATAAACAGTTCTTTTACTGTGATAACGATCTTAACCC / / / / BciVI Hpy178III* MaeI TspEI BinI* F L G L L V S C I C Q E N D T I A R I G F W V C W Y P V F V K K M T L L L E L G F G S A G I L Y L S R K * H Y C * N W E ----:----|----:----|----:----|----:----|----:----|----:----| N K P R S T D Q I Q * S F S V I A L I P I K P D A P I R Y K D L F H C * Q * F Q K Q T Q Q Y G T N T L F I V S N S S N P MboI XhoII | DpnI | |BstKTI | || Cac8I CviRI* | || | CviRI* | MaeII | || | | MfeI | | SetI ApoI Csp6I TfiI | || | | TspEI | | TaiI TspEI |RsaI HinfI \ \\ \ \ \ \ \ \ \ \\ \ AGATCCTGCCTGCAACAATTGATATTGCAAAACGTATCTAAATTCAATGAGTACCATTGG 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGGACGGACGTTGTTAACTATAACGTTTTGCATAGATTTAAGTTACTCATGGTAACC // / / / / / / / / // || | | CviRI* TspEI | | MaeII TspEI |Csp6I || | Cac8I MfeI | TaiI ApoI RsaI || XhoII | SetI || MboI CviRI* |DpnI BstKTI R S C L Q Q L I L Q N V S K F N E Y H W D P A C N N * Y C K T Y L N S M S T I G I L P A T I D I A K R I * I Q * V P L E ----:----|----:----|----:----|----:----|----:----|----:----| L D Q R C C N I N C F T D L N L S Y W Q S I R G A V I S I A F R I * I * H T G N S G A Q L L Q Y Q L V Y R F E I L V M P MaeIII Tsp45I | SetI | | MaeII | | | SetI | | | TaiI | | | | TaqI TspRI | | | | | HphI MseI | TspEI TaqI | | | | | | TspEI | BtsI | | TsoI TspGWI \ \ \ \ \ \ \ \ \ \ \ \ \ AATCAAATAGGTGACGTATTCGATAAATTGTTTGATTTAACCACTGCTAATGAATTGTTC 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTTATCCACTGCATAAGCTATTTAACAAACTAAATTGGTGACGATTACTTAACAAG / / / // // / / / // | SetI | || |TaqI TspEI TspRI | |TspGWI HinfI | || HphI MseI | TspEI TfiI | |MaeII BtsI TsoI | Tsp45I | MaeIII TaiI SetI N Q I G D V F D K L F D L T T A N E L F I K * V T Y S I N C L I * P L L M N C S S N R * R I R * I V * F N H C * * I V R ----:----|----:----|----:----|----:----|----:----|----:----| F * I P S T N S L N N S K V V A L S N N S D F L H R I R Y I T Q N L W Q * H I T I L Y T V Y E I F Q K I * G S S I F Q E BinI* | BsaBI | TspDTI | |MboI | || DpnI | || |BstKTI MboII | || || MaeIII | HphI \ \\ \\ \ \ \ GATTATGATCCGTTACAGCAAGGAAGAAAATCATCTGTATCTCATCACCAAACAACTAAT 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATACTAGGCAATGTCGTTCCTTCTTTTAGTAGACATAGAGTAGTGGTTTGTTGATTA /// / // / / / / ||| | || MboI MaeIII | HphI ||| | |DpnI MboII ||| | BstKTI ||| BsaBI ||TspDTI |BinI* TaqI D Y D P L Q Q G R K S S V S H H Q T T N I M I R Y S K E E N H L Y L I T K Q L M L * S V T A R K K I I C I S S P N N * * ----:----|----:----|----:----|----:----|----:----|----:----| S * S G N C C P L F D D T D * * W V V L R N H D T V A L F F I M Q I E D G F L * I I I R * L L S S F * R Y R M V L C S I DdeI BspCNI | MslI |BseMII TfiI Esp3I CviJI | |Hpy188I || Hin4II* HinfI BsmAI \ \ \\ \\ \ \ \ GATACCAGCCAACACTCAGATGATGATAGCAACGACAGAAGGGAGAACGATTCTAATATC 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGGTCGGTTGTGAGTCTACTACTATCGTTGCTGTCTTCCCTCTTGCTAAGATTATAG / // // / / / CviJI |DdeI || Hin4II* | TspRI Hpy188I |BseMII HinfI MslI BspCNI TfiI D T S Q H S D D D S N D R R E N D S N I I P A N T Q M M I A T T E G R T I L I S Y Q P T L R * * * Q R Q K G E R F * Y Q ----:----|----:----|----:----|----:----|----:----|----:----| S V L W C E S S S L L S L L S F S E L I H Y W G V S L H H Y C R C F P S R N * Y I G A L V * I I I A V V S P L V I R I D MboII | MaeII | | SetI | | TaiI Hin6I | | BbvII* |GlaI | | | MboII ||HhaI | | | MaeIII TspRI ||| Hpy178III* | | | Tsp45I | Tsp4CI* ||| | SfaNI | | | | FatI | | TaqI ||| | |TfiI | | | | |CviAII | | McrI* ||| | |HinfI | | | | || NlaIII \ \ \ \\\ \ \\ \ \ \ \ \\ \ AGTGAGACGGTCGAAAGAGCGCATCAAGAAGAATCCAGCGAAGACGTTGGTGGTGACATG 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTCTGCCAGCTTTCTCGCGTAGTTCTTCTTAGGTCGCTTCTGCAACCACCACTGTAC / // / /// / / / / / / // // BsmAI || TaqI ||Hin6I | | | | | | || |FatI Esp3I |McrI* |GlaI | | | | | | || CviAII Tsp4CI* HhaI | | | | | | |Tsp45I | | | | | | |MaeIII | | | | | | NlaIII | | | | | BbvII* | | | | | MboII | | | | MaeII | | | TaiI | | | SetI | | MboII | SfaNI | HinfI | TfiI Hpy178III* S E T V E R A H Q E E S S E D V G G D M V R R S K E R I K K N P A K T L V V T W * D G R K S A S R R I Q R R R W W * H G ----:----|----:----|----:----|----:----|----:----|----:----| L S V T S L A C * S S D L S S T P P S M * H S P R F L A D L L I W R L R Q H H C T L R D F S R M L F F G A F V N T T V H DdeI |MwoI ||HindIII ||| AluI ||| CviJI ||| | MseI ||| | SetI Hpy188I ||| | | TspGWI | Hpy99I HphI ||| | | | TspEI | Tsp4CI* \ \\\ \ \ \ \ \ \ GTTGAAACACTCAATGGGCAAACTAAGCTTAATAATGGCAATTCCGTTCCGACGGTAAAG 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTTGTGAGTTACCCGTTTGATTCGAATTATTACCGTTAAGGCAAGGCTGCCATTTC / / /// / / / / / HphI | ||| | TspGWI TspEI | Tsp4CI* | ||| | MseI Hpy188I | ||| HindIII Hpy99I | ||CviJI | ||AluI | |DdeI | SetI MwoI V E T L N G Q T K L N N G N S V P T V K L K H S M G K L S L I M A I P F R R * R * N T Q W A N * A * * W Q F R S D G K G ----:----|----:----|----:----|----:----|----:----|----:----| T S V S L P C V L S L L P L E T G V T F P Q F V * H A F * A * Y H C N R E S P L N F C E I P L S L K I I A I G N R R Y L CviJI | AciI TspEI | Cac8I | TfiI | | MaeI FatI | HinfI | | | FauI BciVI |CviAII | | MmeI | | | |DdeI | DdeI || NlaIII \ \ \ \ \ \ \\ \ \ \\ \ GACGAATTGAATCCAAAGCCCGCTAGTCTAAGTATCCCCAAGAAAACTAAGCACATGAAA 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTAACTTAGGTTTCGGGCGATCAGATTCATAGGGGTTCTTTTGATTCGTGTACTTT / // / / / / / / / / / // | |HinfI | | | | | DdeI BciVI | | |FatI | |TfiI | | | | FauI | | CviAII | MmeI | | | MaeI | NlaIII TspEI | | AciI DdeI | Cac8I CviJI D E L N P K P A S L S I P K K T K H M K T N * I Q S P L V * V S P R K L S T * N R I E S K A R * S K Y P Q E N * A H E T ----:----|----:----|----:----|----:----|----:----|----:----| S S N F G F G A L R L I G L F V L C M F P R I S D L A R * D L Y G W S F * A C S V F Q I W L G S T * T D G L F S L V H F MaeII |BsaAI |SnaBI Hpy178III* || SetI | ApoI MaeIII || TaiI | TspEI TspDTI || |MboII | EcoRI \ \\ \\ \ \ CGAAACGAAAGTAACGAAGATATACGTAGGAGAATAAACATCAAGAATTCTATTGTTGTC 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTTGCTTTCATTGCTTCTATATGCATCCTCTTATTTGTAGTTCTTAAGATAACAACAG / / / /// / / TspDTI MaeIII | ||MboII | EcoRI | |MaeII | TspEI | SnaBI | ApoI | BsaAI Hpy178III* TaiI SetI R N E S N E D I R R R I N I K N S I V V E T K V T K I Y V G E * T S R I L L L S K R K * R R Y T * E N K H Q E F Y C C Q ----:----|----:----|----:----|----:----|----:----|----:----| R F S L L S S I R L L I F M L F E I T T V F R F Y R L Y V Y S F L C * S N * Q Q S V F T V F I Y T P S Y V D L I R N N D TseI AluI AluI CviJI TspEI CviJI |BisI | BcgI | BbvI ||BlsI | | TaqI | SetI ||SetI | | |Hpy178III* \ \ \\\ \ \ \\ AAATGTGTTTTACAGCTTTTGATGATAGAGCTGCTCAACGAATTATTCGAGAACGAAGAT 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACACAAAATGTCGAAAACTACTATCTCGACGAGTTGCTTAATAAGCTCTTGCTTCTA / / / / //// / / // | CviJI BbvI | |||TseI | | |Hpy178III* | AluI | ||BisI | | TaqI SetI | |BlsI | TspEI | CviJI BcgI | AluI SetI K C V L Q L L M I E L L N E L F E N E D N V F Y S F * * * S C S T N Y S R T K I M C F T A F D D R A A Q R I I R E R R F ----:----|----:----|----:----|----:----|----:----|----:----| L H T K C S K I I S S S L S N N S F S S * I H K V A K S S L A A * R I I R S R L F T N * L K Q H Y L Q E V F * E L V F I MboII | Tsp4CI* | | TspRI | | | BcgI | | | | BsiYI* CviJI SplI* | | | | |BciVI |MmeI TspEI BsaXI |Csp6I \ \ \ \ \\ \\ \ \ \\ TTTGCCCACTGTATCCCTTACAAGGAAGCCATTAGAATTACAAGATTGTTGGAGAAATCG 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGGTGACATAGGGAATGTTCCTTCGGTAATCTTAATGTTCTAACAACCTCTTTAGC / / / / / / // // | | | | | BciVI |CviJI |BsaXI | | | | BsiYI* MmeI TspEI | | | BcgI | | Tsp4CI* | MboII TspRI F A H C I P Y K E A I R I T R L L E K S L P T V S L T R K P L E L Q D C W R N R C P L Y P L Q G S H * N Y K I V G E I V ----:----|----:----|----:----|----:----|----:----|----:----| K A W Q I G * L S A M L I V L N N S F D N Q G S Y G K C P L W * F * L I T P S I K G V T D R V L F G N S N C S Q Q L F R BsiI* | BsaXI | MaeIII RsaI | Tsp45I MseI MnlI | ApoI | Hpy178III* MboII SpeI CviJI | TspEI | | MseI |TspDTI |MaeI |BsiI* \ \ \ \ \ \\ \\ \\ TACGAATTTTCTCGTGACTTTAATGAAGATTATGGGTTAAGAACAAGACTAGTAGAGGCT 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTAAAAGAGCACTGAAATTACTTCTAATACCCAATTCTTGTTCTGATCATCTCCGA /// / / / / / / / / // / ||| | | | | MseI | MseI | |SpeI CviJI ||| | | | Tsp45I TspDTI | MaeI ||| | | | MaeIII MboII MnlI ||| | | Hpy178III* ||| | | BsiI* ||| | BsaXI ||| TspEI ||| ApoI ||SplI* |Csp6I RsaI Y E F S R D F N E D Y G L R T R L V E A T N F L V T L M K I M G * E Q D * * R L R I F S * L * * R L W V K N K T S R G S ----:----|----:----|----:----|----:----|----:----|----:----| Y S N E R S K L S S * P N L V L S T S A T R I K E H S * H L N H T L F L V L L P V F K R T V K I F I I P * S C S * Y L S TseI |BisI ||BlsI |||TseI ||||BisI ||||SfeI* |||||BlsI EcoP15I BbvI ||||||CviRI* | SetI | BbvI ||||||| PstI \ \ \ \ \\\\\\\ \ CGTGTAGTTGATAAAATACCAAACCTGTTGAAACAAGAAACGAGTGCTGCTGCAGTTCTC 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| GCACATCAACTATTTTATGGTTTGGACAACTTTGTTCTTTGCTCACGACGACGTCAAGAG / // / / ////// / BsiI* |SetI | BbvI |||||| SfeI* EcoP15I BbvI |||||CviRI* |||||TseI ||||BisI |||BlsI |||PstI ||TseI |BisI BlsI R V V D K I P N L L K Q E T S A A A V L V * L I K Y Q T C * N K K R V L L Q F S C S * * N T K P V E T R N E C C C S S P ----:----|----:----|----:----|----:----|----:----|----:----| R T T S L I G F R N F C S V L A A A T R E H L Q Y F V L G T S V L F S H Q Q L E T Y N I F Y W V Q Q F L F R T S S C N E CviJI | MboII Hpy188I Hin4II* | |MseI HphI \ \ \ \\ \ CTTGACATTATGTTTCAGTTGTATCTGAACGATGATGAGAAGAAGGCTGATTTAATAACT 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTGTAATACAAAGTCAACATAGACTTGCTACTACTCTTCTTCCGACTAAATTATTGA / / / / / / Hpy188I Hin4II* | | MseI HphI | MboII CviJI L D I M F Q L Y L N D D E K K A D L I T L T L C F S C I * T M M R R R L I * * L * H Y V S V V S E R * * E E G * F N N S ----:----|----:----|----:----|----:----|----:----|----:----| R S M I N * N Y R F S S S F F A S K I V G Q C * T E T T D S R H H S S P Q N L L K V N H K L Q I Q V I I L L L S I * Y S BseGI CviRI* FokI | BssKI BseGI |MboI | EcoRII | FatI |BclI | | ScrFI | NcoI |Hpy188I | | BseBI | StyI ||BcgI | | | MnlI | SecI* |||DpnI | | | | SetI | DsaI* ||||BstKTI | | | | SfaNI BcgI | |CviAII \\\\\ \ \ \ \ \ \ \ \\ CGTCTGATCACCATTTGCATCCAGGTCGTAGAGGGTTATGTTTCTTTGGATGATAGAACC 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGACTAGTGGTAAACGTAGGTCCAGCATCTCCCAATACAAAGAAACCTACTATCTTGG / //// / / // / / / / / | |||BclI | | || | SfaNI BcgI BseGI NlaIII | |||MboI | | || EcoRII | ||FokI | | || BssKI | |DpnI | | |BseBI | BstKTI | | |ScrFI Hpy188I | | |MnlI BcgI | | SetI | CviRI* BseGI R L I T I C I Q V V E G Y V S L D D R T V * S P F A S R S * R V M F L W M I E P S D H H L H P G R R G L C F F G * * N H ----:----|----:----|----:----|----:----|----:----|----:----| R R I V M Q M W T T S P * T E K S S L V E D S * W K C G P R L P N H K K P H Y F T Q D G N A D L D Y L T I N R Q I I S G FokI | NlaIII BssKI | | MaeII EcoRII | | | SetI | ScrFI MaeIII | | | TaiI | BseBI TspRI SspI | SetI \ \ \ \ \ \ \ \ \ \ ATGGAACGTAGTATCAATGCCTGGCGTTCAGTGATAGTTGAAATATTACAAGGTTACTAC 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTGCATCATAGTTACGGACCGCAAGTCACTATCAACTTTATAATGTTCCAATGATG // / / / / / / / / || | MaeII | | TspRI SspI SetI MaeIII || FokI | EcoRII || TaiI | BssKI || SetI BseBI |DsaI* ScrFI |SecI* |StyI |NcoI |FatI CviAII M E R S I N A W R S V I V E I L Q G Y Y W N V V S M P G V Q * * L K Y Y K V T T G T * Y Q C L A F S D S * N I T R L L R ----:----|----:----|----:----|----:----|----:----|----:----| M S R L I L A Q R E T I T S I N C P * * W P V Y Y * H R A N L S L Q F I V L N S H F T T D I G P T * H Y N F Y * L T V V BbvII* | MboII | |TspDTI ApoI | || DrdI TfiI TspEI | || | Tsp4CI* MwoI HinfI \ \ \\ \ \ \ \ GAATTTGATGATGAAGACTTTAGACTATACTGTCCTGCTATGTATGCTCTGGTGATTCAA 5890 5900 5910 5920 5930 5940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAACTACTACTTCTGAAATCTGATATGACAGGACGATACATACGAGACCACTAAGTT / / / / / / TspEI | | Tsp4CI* MwoI HinfI ApoI | DrdI TfiI TspDTI BbvII* MboII E F D D E D F R L Y C P A M Y A L V I Q N L M M K T L D Y T V L L C M L W * F K I * * * R L * T I L S C Y V C S G D S N ----:----|----:----|----:----|----:----|----:----|----:----| S N S S S S K L S Y Q G A I Y A R T I * R I Q H H L S * V I S D Q * T H E P S E F K I I F V K S * V T R S H I S Q H N L FatI |CviAII || NspI || NlaIII || TspGWI SspI || | MmeI |HphI BsmAI || | | TspEI DdeI \\ \ \\ \ \ \ \ ATATTAGATAAGAGCGTTCCAACGGAGTTGAGACATGCTATAAAACAATTTCTAAGCAGA 5950 5960 5970 5980 5990 6000 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATCTATTCTCGCAAGGTTGCCTCAACTCTGTACGATATTTTGTTAAAGATTCGTCT / / / /// / / / HphI | | ||| MmeI | DdeI SspI | | ||FatI TspEI | | |CviAII | | TspGWI | NlaIII | NspI BsmAI I L D K S V P T E L R H A I K Q F L S R Y * I R A F Q R S * D M L * N N F * A E I R * E R S N G V E T C Y K T I S K Q S ----:----|----:----|----:----|----:----|----:----|----:----| I N S L L T G V S N L C A I F C N R L L F I L Y S R E L P T S V H * L V I E L C Y * I L A N W R L Q S M S Y F L K * A S HphI TspEI |SetI MseI \ \\ \ GTTGGTGAATTATACCTTTCTACTGATTAA 6010 6020 6030 ----:----|----:----|----:----| CAACCACTTAATATGGAAAGATGACTAATT / / / / | | HphI MseI | SetI TspEI V G E L Y L S T D * L V N Y T F L L I X W * I I P F Y * L X ----:----|----:----|----:----| T P S N Y R E V S * L Q H I I G K * Q N N T F * V K R S I L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 10 BspACI,SsiI AclI 1 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 4 DraI AjuI 2 AloI 2 AluI 22 AluBI ApoI 18 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 4 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 9 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 3 BpuEI BceAI 3 BcgI 3 BciVI 5 BfuI BclI 3 FbaI,Ksp22I BdaI 4 BglI 1 BglII 1 BinI* 6 AlwI,BspPI,AclWI BisI 11 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 11 BmgT120I 3 BplI 2 BsaAI 3 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 5 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 7 BseRI 1 BsiI* 4 BssSI,Bst2BI,BauI BsiYI* 10 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 13 Alw26I,BstMAI BsmI 5 BsaMI,Mva1269I,PctI BspCNI 7 BspHI 2 CciI,PagI,RcaI BsrDI 4 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BstKTI 19 BstXI 1 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 8 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 3 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 7 CviQI,RsaNI CspCI 1 CviAII 17 CviJI 49 CviKI-1 CviRI* 17 HpyCH4V DdeI 17 BstDEI,HpyF3I DpnI 19 MalI DrdI 1 AasI,DseDI DsaI* 2 BtgI,BstDSI Eam1105I 2 AspEI,BmeRI,DriI,AhdI EciI 2 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 7 AcuI Eco57MI 11 EcoNI 1 BstENI,XagI EcoP15I 3 EcoRI 3 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 2 BsmBI FalI 6 FatI 17 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 1 GsuI 4 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 8 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 13 Hin4II* 16 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 5 HinfI 31 HpaII 2 HapII,BsiSI,MspI HphI 13 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 23 Hpy188III Hpy188I 27 Hpy99I 4 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 16 FspBI,BfaI,XspI MaeII 18 HpyCH4IV MaeIII 18 MboI 19 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 56 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 6 MunI MlyI 5 SchI MmeI 6 MnlI 26 MroNI 1 NgoMIV MseI 35 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 9 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 1 Bsp19I NdeI 3 FauNDI NlaIII 17 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 4 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 5 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpiI 2 PstI 1 PvuII 1 RsaI 7 AfaI ScaI 2 BmcAI,AssI,ZrmI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 73 SfaNI 9 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 5 SmoI SnaBI 1 Eco105I,BstSNI SpeI 2 BcuI,AhlI SplI* 1 Pfl23II,PspLI,BsiWI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 18 TaqI 22 TatI 2 TauI 3 TfiI 26 PfeI TseI 8 ApeKI TsoI 6 Tsp45I 7 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 23 TspEI 66 TasI,Tsp509I,Sse9I TspGWI 8 TspRI 10 TscAI TstI 3 XbaI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflIII AgeI AlfI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI BbvCI BetI* BfiI BmeT110I BmtI Bpu10I BsePI BseSI BseYI BsgI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I Cfr9I DinI DraII DraIII Ecl136II Eco47III EcoICRI EcoT22I EgeI EheI EspI* FseI FspAI GsaI HaeII HgiAI* HgiCI* HpaI KasI KpnI MauBI MluI Mph1103I MstI* NarI NheI NmeAIII NotI NruI NsiI OliI PacI PasI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SphI SrfI Sse232I* Sse8387I SwaI TaqII TspMI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769