Restriction Map of NUM1/YDR150W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NUM1/YDR150W on chromosome IV from coordinates 755628 to 763874.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.23897

AluI CviJI |DdeI |EspI* BspCNI ||SetI |BseMII \\\ \\ ATGTCCCACAACAACAGGCATAAAAAGAATAACGATAAAGACAGCTCAGCAGGGCAGTAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGGTGTTGTTGTCCGTATTTTTCTTATTGCTATTTCTGTCGAGTCGTCCCGTCATA / / / // | | EspI* |BseMII | | DdeI BspCNI | CviJI | AluI SetI M S H N N R H K K N N D K D S S A G Q Y C P T T T G I K R I T I K T A Q Q G S M V P Q Q Q A * K E * R * R Q L S R A V C ----:----|----:----|----:----|----:----|----:----|----:----| X D W L L L C L F F L S L S L E A P C Y X T G C C C A Y F S Y R Y L C S L L A T H G V V V P M F L I V I F V A * C P L I TspEI | EcoP15I | | MseI | | | HgaI | | | | BssKI | | | | CviJI | | | | EcoRII | | | | | ScrFI MaeIII | | | | | BseBI BsmAI |TsoI CviRI* TspDTI | | | | | | MwoI Esp3I || BccI \ \ \ \ \ \ \ \ \ \ \\ \ GCAAATAGCATTGACAATTCATTAAGCCAGGAAAGCGTCTCAACGAACGGCGTAACAAGG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTATCGTAACTGTTAAGTAATTCGGTCCTTTCGCAGAGTTGCTTGCCGCATTGTTCC / / / / / / / / / // | TspDTI | | | | EcoRII | TsoI |MaeIII CviRI* | | | | BssKI Esp3I BccI | | | BseBI BsmAI | | | ScrFI | | | MwoI | | | HgaI | | CviJI | MseI EcoP15I TspEI A N S I D N S L S Q E S V S T N G V T R Q I A L T I H * A R K A S Q R T A * Q G K * H * Q F I K P G K R L N E R R N K D ----:----|----:----|----:----|----:----|----:----|----:----| A F L M S L E N L W S L T E V F P T V L H L Y C Q C N M L G P F R R L S R R L L C I A N V I * * A L F A D * R V A Y C P BceAI |CviJI AciI ||BseGI |BisI Hin4II* ||| MseI ||BlsI |TspDTI ||| | FokI ||BsmI ||BtsI TspDTI ||| | | CviJI |||TauI ||TspRI HphI | AciI \\\ \ \ \ \\\\ \\\ \ \ \ ATGGCTAACTTAAAGGCTGATGAATGCGGCAGTGGTGATGAAGGAGATAAAACAAAGCGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATTGAATTTCCGACTACTTACGCCGTCACCACTACTTCCTCTATTTTGTTTCGCC /// / / /// // / / / ||BceAI | CviJI ||BisI |BtsI HphI TspDTI AciI |CviJI | FokI ||AciI Hin4II* BseGI MseI |TspRI TspDTI |BlsI BsmI TauI M A N L K A D E C G S G D E G D K T K R W L T * R L M N A A V V M K E I K Q S G G * L K G * * M R Q W * * R R * N K A V ----:----|----:----|----:----|----:----|----:----|----:----| I A L K F A S S H P L P S S P S L V F R S P * S L P Q H I R C H H H L L Y F L A H S V * L S I F A A T T I F S I F C L P MaeII |BtrI || SetI || TaiI || | BetI* || | BspMII* || | |HpaII BsmAI || | |Hpy178III* | FalI || | || ApoI CviRI* TaqI | FalI || | || TspEI | Cac8I \ \ \ \\ \ \\ \ \ \ TTTTCGATTTCAAGTATTTTGAGTAAAAGAGAGACAAAAGACGTGCTTCCGGAATTTGCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCTAAAGTTCATAAAACTCATTTTCTCTCTGTTTTCTGCACGAAGGCCTTAAACGT / / / / // // / / / TaqI FalI BsmAI | |MaeII || | | Cac8I FalI | BtrI || | CviRI* TaiI || TspEI SetI || FalI || FalI || ApoI |BspMII* |BetI* Hpy178III* HpaII F S I S S I L S K R E T K D V L P E F A F R F Q V F * V K E R Q K T C F R N L Q F D F K Y F E * K R D K R R A S G I C R ----:----|----:----|----:----|----:----|----:----|----:----| N E I E L I K L L L S V F S T S G S N A T K S K L Y K S Y F L S L L R A E P I Q K R N * T N Q T F S L C F V H K R F K C TatI |Csp6I ||RsaI ApoI FalI ||ScaI TspEI AjuI FalI ||| TspDTI EcoRI |BceAI \ \\\ \ \ \\ GGCAGTAGTTCCCACAATGGAGTACTCACGGCGAATTCATCAAAGGATATGAACTTTACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCATCAAGGGTGTTACCTCATGAGTGCCGCTTAAGTAGTTTCCTATACTTGAAATGA /// // / ||TatI |AjuI BceAI |TspDTI EcoRI |Csp6I TspEI ScaI ApoI RsaI G S S S H N G V L T A N S S K D M N F T A V V P T M E Y S R R I H Q R I * T L L Q * F P Q W S T H G E F I K G Y E L Y F ----:----|----:----|----:----|----:----|----:----|----:----| P L L E W L P T S V A F E D F S I F K V L C Y N G C H L V * P S N M L P Y S S * A T T G V I S Y E R R I * * L I H V K S MnlI ApoI |AluI TspDTI AjuI TspEI |CviJI | DdeI TspEI | CviRI* || SetI \ \ \ \ \ \\ \ TTGGAACTAAGCGAGAATTTGTTGGTTGAGTGTAGGAAATTGCAATCCTCTAATGAAGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTGATTCGCTCTTAAACAACCAACTCACATCCTTTAACGTTAGGAGATTACTTCGA / / / // / / TspDTI AjuI TspEI |CviRI* | CviJI DdeI ApoI TspEI | AluI MnlI SetI L E L S E N L L V E C R K L Q S S N E A W N * A R I C W L S V G N C N P L M K L G T K R E F V G * V * E I A I L * * S * ----:----|----:----|----:----|----:----|----:----|----:----| K S S L S F K N T S H L F N C D E L S A K P V L R S N T P Q T Y S I A I R * H L Q F * A L I Q Q N L T P F Q L G R I F S MseI | PleI | |MlyI | |MaeIII Bce83I* SmlI TspEI | |Tsp45I |TspDTI |BsmAI | MseI HinfI | || MnlI \\ \\ \ \ \ \ \\ \ AAAAATGAGCAAATCAAGTCTCTCAAGCAAATTAAAGAGTCATTAAGTGACAAGATTGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACTCGTTTAGTTCAGAGAGTTCGTTTAATTTCTCAGTAATTCACTGTTCTAACTC // // // / // // |TspDTI |BsmAI |MseI | || |Tsp45I Bce83I* SmlI TspEI | || |MaeIII | || MnlI | |PleI | |MlyI | MseI HinfI K N E Q I K S L K Q I K E S L S D K I E K M S K S S L S S K L K S H * V T R L R K * A N Q V S Q A N * R V I K * Q D * G ----:----|----:----|----:----|----:----|----:----|----:----| L F S C I L D R L C I L S D N L S L I S * F H A F * T E * A F * L T M L H C S Q F I L L D L R E L L N F L * * T V L N L TsoI |FatI AluI |BspHI CviJI ||CviAII Ecl136II ||Hpy178III* | SetI ||| NlaIII | SduI ||| | Hin4II* MseI | SacI BseRI ||| | | TfiI Hin4I | HgiAI* | TspDTI ||| | | HinfI Hin4I | HgiJII* | | MmeI ||| | | | TspDTI |AhaIII* \ \ \ \ \ \\\ \ \ \ \ \\ GAGCTCACTAACCAAAAAAAGTCCTTCATGAAAGAGTTGGATTCAACTAAAGATTTAAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAGTGATTGGTTTTTTTCAGGAAGTACTTTCTCAACCTAAGTTGATTTCTAAATTTG / / / / / / / // / / / / // | | | | MmeI | | || Hin4II* | HinfI Hin4I |MseI | | | TspDTI | | |BspHI | TfiI Hin4I AhaIII* | | BseRI | | |FatI TspDTI | Ecl136II | | Hpy178III* | CviJI | | CviAII | AluI | NlaIII HgiJII* TsoI HgiAI* SacI SduI SetI E L T N Q K K S F M K E L D S T K D L N S S L T K K S P S * K S W I Q L K I * T A H * P K K V L H E R V G F N * R F K L ----:----|----:----|----:----|----:----|----:----|----:----| S S V L W F F D K M F S N S E V L S K F P A * * G F F T R * S L T P N L * L N L L E S V L F L G E H F L Q I * S F I * V SmlI Hin4I Hin4I BfiI | FatI TspEI |TfiI TspEI | |CviAII | Bce83I* BsrI |HinfI | MseI | || NlaIII | |MseI TspEI \ \\ \ \ \ \\ \ \ \\ \ TGGGATTTAGAATCTAAATTAACAAACTTGAGCATGGAATGTAGGCAATTAAAAGAATTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTAAATCTTAGATTTAATTGTTTGAACTCGTACCTTACATCCGTTAATTTTCTTAAC / / / /// // // / // / BsrI BfiI HinfI ||Hin4I || |FatI | |MseI TspEI TfiI ||Hin4I || CviAII | TspEI |MseI |NlaIII Bce83I* TspEI SmlI W D L E S K L T N L S M E C R Q L K E L G I * N L N * Q T * A W N V G N * K N * G F R I * I N K L E H G M * A I K R I E ----:----|----:----|----:----|----:----|----:----|----:----| Q S K S D L N V F K L M S H L C N F S N S P N L I * I L L S S C P I Y A I L L I P I * F R F * C V Q A H F T P L * F F Q CviJI | TspDTI MboII | | AjuI Hpy188I \ \ \ \ \ AAGAAAAAGACTGAAAAATCTTGGAATGATGAAAAAGAAAGCCTGAAACTTCTGAAAACA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTTCTGACTTTTTAGAACCTTACTACTTTTTCTTTCGGACTTTGAAGACTTTTGT / // / MboII |TspDTI Hpy188I CviJI AjuI K K K T E K S W N D E K E S L K L L K T R K R L K N L G M M K K K A * N F * K Q E K D * K I L E * * K R K P E T S E N R ----:----|----:----|----:----|----:----|----:----|----:----| F F F V S F D Q F S S F S L R F S R F V S S F S Q F I K S H H F L F G S V E S F L F L S F F R P I I F F F A Q F K Q F C FatI |CviAII ||Hin4I ||| NlaIII ||| | MboI ||| | | DpnI ||| | | |BstKTI ||| | | ||DdeI ||| | | ||| AluI ApoI ||| | | ||| CviJI TspEI AjuI ||| | | ||| | SetI | MseI |MseI ||| | | ||| | TspDTI \ \ \\ \\\ \ \ \\\ \ \ GATTTGGAAATTTTAACATTAACAAAAAATGGCATGGAAAATGATCTTAGCTCTCAAAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAACCTTTAAAATTGTAATTGTTTTTTACCGTACCTTTTACTAGAATCGAGAGTTTTT // / / / / // // / /// || MseI MseI | | |FatI || | ||TspDTI |AjuI | | CviAII || | ||CviJI TspEI | NlaIII || | ||AluI ApoI Hin4I || | |DdeI || | SetI || MboI |DpnI BstKTI D L E I L T L T K N G M E N D L S S Q K I W K F * H * Q K M A W K M I L A L K N F G N F N I N K K W H G K * S * L S K T ----:----|----:----|----:----|----:----|----:----|----:----| S K S I K V N V F F P M S F S R L E * F L N P F K L M L L F H C P F H D * S E F I Q F N * C * C F I A H F I I K A R L F TspEI Hin4I | MseI MseI \ \ \ \ CTTCATTACGATAAAGAGATTAGTGAATTAAAGGAAAGGATTTTAGACTTAAATAATGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTAATGCTATTTCTCTAATCACTTAATTTCCTTTCCTAAAATCTGAATTTATTACTT / // / Hin4I |MseI MseI TspEI L H Y D K E I S E L K E R I L D L N N E F I T I K R L V N * R K G F * T * I M K S L R * R D * * I K G K D F R L K * * K ----:----|----:----|----:----|----:----|----:----|----:----| S * * S L S I L S N F S L I K S K F L S V E N R Y L S * H I L P F S K L S L Y H K M V I F L N T F * L F P N * V * I I F MboI TspEI Hpy188I | MseI | DpnI | VspI TspDTI | |BstKTI | |TspEI \ \ \\ \ \\ AACGACAGATTACTTATTAGTGTTTCTGATCTAACAAGTGAAATTAATTCCTTACAGAGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGTCTAATGAATAATCACAAAGACTAGATTGTTCACTTTAATTAAGGAATGTCTCG / / // / // / TspDTI | || MboI || TspEI | |DpnI |VspI | BstKTI |MseI Hpy188I TspEI N D R L L I S V S D L T S E I N S L Q S T T D Y L L V F L I * Q V K L I P Y R A R Q I T Y * C F * S N K * N * F L T E Q ----:----|----:----|----:----|----:----|----:----|----:----| F S L N S I L T E S R V L S I L E K C L F R C I V * * H K Q D L L H F * N R V S V V S * K N T N R I * C T F N I G * L A ApoI HgaI TspEI AcyI |MboII SfaNI \ \ \\ \ AATAGAACTGAAAGAATAAAAATTCAAAAGCAACTTGATGACGCCAAAGCATCTATTTCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTTGACTTTCTTATTTTTAAGTTTTCGTTGAACTACTGCGGTTTCGTAGATAAAGA / / / / TspEI AcyI | HgaI ApoI MboII N R T E R I K I Q K Q L D D A K A S I S I E L K E * K F K S N L M T P K H L F L * N * K N K N S K A T * * R Q S I Y F F ----:----|----:----|----:----|----:----|----:----|----:----| L L V S L I F I * F C S S S A L A D I E C Y F Q F F L F E F A V Q H R W L M * K I S S F S Y F N L L L K I V G F C R N R Hpy188I TatI | SfeI* |Csp6I | | MaeIII MseI ||RsaI BaeI | | Tsp4CI* \ \\\ \ \ \ \ TCGTTAAAAAGAAAAGTACAAAAGAAGTATTATCAAAAACAGCATACTTCCGATACTACA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAATTTTTCTTTTCATGTTTTCTTCATAATAGTTTTTGTCGTATGAAGGCTATGATGT / / /// / / // | MseI ||TatI BaeI Hpy188I |SfeI* SfaNI |Csp6I Tsp4CI* RsaI S L K R K V Q K K Y Y Q K Q H T S D T T R * K E K Y K R S I I K N S I L P I L Q V K K K S T K E V L S K T A Y F R Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| E N F L F T C F F Y * * F C C V E S V V K T L F F L V F S T N D F V A Y K R Y * R * F S F Y L L L I I L F L M S G I S C BinI* | MboI | Hpy188I | | DpnI | | BseMII | | |BspCNI | | |BstKTI | | ||Hpy178III* | | ||| MnlI | | ||| |TfiI | | ||| |HinfI | | ||| ||BaeI | | ||| |||TstI | | ||| |||| DdeI | | ||| |||| |Hpy188I | | ||| |||| || AsuI* | | ||| |||| || AvaII | | ||| |||| || |NlaIV BbvII* | | ||| |||| || |BmgT120I | MboII | | ||| |||| || || SpeI | |TstI | | ||| |||| || || |MaeI BslFI | || MboII MboI \ \ \\\ \\\\ \\ \\ \\ \ \ \\ \ \ GTAACATCTGATCCTGATTCTGAGGGGACCACTAGTGAAGAAGACATTTTTGATATAGTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGTAGACTAGGACTAAGACTCCCCTGGTGATCACTTCTTCTGTAAAAACTATATCAC / //////// // / /// // / / / / / | |||||||| || | ||| |SpeI | | | BbvII* BstKTI | |||||||| || | ||| MaeI | | | MboII | |||||||| || | ||AvaII | | MboII | |||||||| || | ||AsuI* | TstI | |||||||| || | |BmgT120I BslFI | |||||||| || | NlaIV | |||||||| || DdeI | |||||||| |Hpy188I | |||||||| HinfI | |||||||| TfiI | |||||||Hpy178III* | ||||||MnlI | |||||MboI | |||||TstI | ||||BaeI | |||DpnI | ||BstKTI | ||BspCNI | |BseMII | Hpy188I MaeIII BinI* V T S D P D S E G T T S E E D I F D I V * H L I L I L R G P L V K K T F L I * * N I * S * F * G D H * * R R H F * Y S D ----:----|----:----|----:----|----:----|----:----|----:----| T V D S G S E S P V V L S S S M K S I T L L M Q D Q N Q P S W * H L L C K Q Y L Y C R I R I R L P G S T F F V N K I Y H AsuI* DraII Hpy188I |CviJI | MboI DpnI |HaeIII | BglII |TaqI FatI |BmgT120I | XhoII |BstKTI |CviAII ||NlaIV TaqI | | DpnI || TspEI || NlaIII ||| MnlI | MnlI | | |BstKTI \\ \ \\ \ \\\ \ \ \ \ \ \\ ATCGAAATTGACCACATGATTGAAACAGGCCCCTCTGTCGAGGACATTTCTGAAGATCTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTTAACTGGTGTACTAACTTTGTCCGGGGAGACAGCTCCTGTAAAGACTTCTAGAA / // / / // //// // / // / | |TaqI | | |FatI |||MnlI |MnlI | || XhoII | MboI | | CviAII ||DraII TaqI | || BglII DpnI | NlaIII ||AsuI* | || MboI TspEI |BmgT120I | |DpnI |NlaIV | BstKTI HaeIII Hpy188I CviJI I E I D H M I E T G P S V E D I S E D L S K L T T * L K Q A P L S R T F L K I L R N * P H D * N R P L C R G H F * R S C ----:----|----:----|----:----|----:----|----:----|----:----| I S I S W M I S V P G E T S S M E S S R S R F Q G C S Q F L G R Q R P C K Q L D D F N V V H N F C A G R D L V N R F I K Hpy178III* | Eco57I | Eco57MI | |DdeI BspCNI TspDTI TfiI |MboII || Hpy188I |BseMII | TaqI HinfI \\ \\ \ \\ \ \ \ GTCAAGAAATACTCAGAAAAAAACAATATGATATTGTTATCGAATGATTCATATAAAAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCTTTATGAGTCTTTTTTTGTTATACTATAACAATAGCTTACTAAGTATATTTTTG / / / // // / / / | | | |DdeI |BseMII | TaqI HinfI | | | Hpy188I BspCNI TspDTI TfiI | | Eco57MI | | Eco57I | Hpy178III* MboII V K K Y S E K N N M I L L S N D S Y K N S R N T Q K K T I * Y C Y R M I H I K T Q E I L R K K Q Y D I V I E * F I * K L ----:----|----:----|----:----|----:----|----:----|----:----| T L F Y E S F F L I I N N D F S E Y L F Q * S I S L F F C Y S I T I S H N M Y F D L F V * F F V I H Y Q * R I I * I F V TspEI BseGI | MseI TspDTI FokI CviRI* SfaNI | VspI MnlI | BstXI \ \ \ \ \ \ \ \ TTACTACAAAAAAGTGAAAGTGCATCCAAACCAAAAGACGATGAATTAATGACCAAAGAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATGATGTTTTTTCACTTTCACGTAGGTTTGGTTTTCTGCTACTTAATTACTGGTTTCTC / / / / // / / / / FokI | CviRI* SfaNI || | | | SetI BseGI || | | BstXI || | TspDTI || MnlI |VspI |MseI TspEI L L Q K S E S A S K P K D D E L M T K E Y Y K K V K V H P N Q K T M N * * P K R T T K K * K C I Q T K R R * I N D Q R G ----:----|----:----|----:----|----:----|----:----|----:----| K S C F L S L A D L G F S S S N I V L S S V V F F H F H M W V L L R H I L S W L * * L F T F T C G F W F V I F * H G F L MboI | DpnI | |BstKTI SetI | || FnuDII* | CviJI SetI | || |MaeIII TspEI \ \ \ \ \\ \\ \ GTGGCTGAAAACCTGAATATGATCGCGTTACCAAATGATGACAATTACAGCAAAAAAGAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGACTTTTGGACTTATACTAGCGCAATGGTTTACTACTGTTAATGTCGTTTTTTCTC / / // // / / CviJI SetI || || MaeIII TspEI || |FnuDII* || MboI |DpnI BstKTI V A E N L N M I A L P N D D N Y S K K E W L K T * I * S R Y Q M M T I T A K K S G * K P E Y D R V T K * * Q L Q Q K R V ----:----|----:----|----:----|----:----|----:----|----:----| T A S F R F I I A N G F S S L * L L F S P P Q F G S Y S R T V L H H C N C C F L H S F V Q I H D R * W I I V I V A F F L SspI | TsoI | | HindIII MnlI | | | AluI | XbaI TfiI | | | CviJI CviJI | |MaeI HinfI MseI | | | | SetI | MboII | |Hpy178III* \ \ \ \ \ \ \ \ \ \ \\ TTTTCGTTAGAATCTCATATTAAATATTTAGAAGCTTCTGGCTATAAAGTTCTTCCTCTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCAATCTTAGAGTATAATTTATAAATCTTCGAAGACCGATATTTCAAGAAGGAGAT / / / / / / / // / / HinfI | | TsoI | | | |MboII MnlI Hpy178III* TfiI | SspI | | | CviJI MaeI MseI | | HindIII | CviJI | AluI SetI F S L E S H I K Y L E A S G Y K V L P L F R * N L I L N I * K L L A I K F F L * F V R I S Y * I F R S F W L * S S S S R ----:----|----:----|----:----|----:----|----:----|----:----| N E N S D * I L Y K S A E P * L T R G R T K T L I E Y * I N L L K Q S Y L E E E K R * F R M N F I * F S R A I F N K R * BccI | Eco57I BseRI TfiI | Eco57MI MnlI |SetI HinfI Bce83I* | | SmlI \ \\ \ \ \ \ \ GAGGAGTTTGAGAACCTAAACGAATCCCTATCAAATCCATCATATAACTATCTCAAGGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCAAACTCTTGGATTTGCTTAGGGATAGTTTAGGTAGTATATTGATAGAGTTCCTT / / // / / // / | MnlI |BseRI HinfI Bce83I* |Eco57MI SmlI XbaI SetI TfiI |Eco57I BccI E E F E N L N E S L S N P S Y N Y L K E R S L R T * T N P Y Q I H H I T I S R K G V * E P K R I P I K S I I * L S Q G K ----:----|----:----|----:----|----:----|----:----|----:----| S S N S F R F S D R D F G D Y L * R L S L P T Q S G L R I G I L D M M Y S D * P L L K L V * V F G * * I W * I V I E L F BsaBI | TaqI | ClaI | |MboI | || DpnI | || |BstKTI | || ||BccI | || ||| Csp6I | || ||| |RsaI | || ||| ||MaeII | || ||| ||| SetI | || ||| ||| TaiI XmnI CviJI | || ||| ||| |MseI MseI CviJI \ \ \ \\ \\\ \\\ \\ \ \ AAACTTCAGGCTTTGAAAAAGATACCCATCGATCAAAGTACGTTTAACTTGTTAAAAGAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAAGTCCGAAACTTTTTCTATGGGTAGCTAGTTTCATGCAAATTGAACAATTTTCTC / / / // // // / / / / XmnI CviJI BsaBI || || || | MseI MseI CviJI || || || MaeII || || |Csp6I || || RsaI || || TaiI || || SetI || |BccI || MboI |DpnI BstKTI ClaI TaqI K L Q A L K K I P I D Q S T F N L L K E N F R L * K R Y P S I K V R L T C * K S T S G F E K D T H R S K Y V * L V K R A ----:----|----:----|----:----|----:----|----:----|----:----| F S * A K F F I G M S * L V N L K N F S F V E P K S F S V W R D F Y T * S T L L F K L S Q F L Y G D I L T R K V Q * F L MseI FokI | BseGI TspEI SetI \ \ \ \ \ CCTACTATTGATTTTTTACTGCCTTTAACATCCAAAATTGATTGCCTGATAATACCTACC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGATAACTAAAAAATGACGGAAATTGTAGGTTTTAACTAACGGACTATTATGGATGG / // / / FokI |MseI TspEI SetI BseGI P T I D F L L P L T S K I D C L I I P T L L L I F Y C L * H P K L I A * * Y L P Y Y * F F T A F N I Q N * L P D N T Y Q ----:----|----:----|----:----|----:----|----:----|----:----| G V I S K K S G K V D L I S Q R I I G V A * * Q N K V A K L M W F Q N G S L V * R S N I K * Q R * C G F N I A Q Y Y R G Hpy178III* MfeI | TfiI TspEI PsiI SetI | HinfI | BccI \ \ \ \ \ \ AAAGATTATAATGACCTTTTTGAGAGTGTCAAGAATCCATCAATTGAACAAATGAAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTAATATTACTGGAAAAACTCTCACAGTTCTTAGGTAGTTAACTTGTTTACTTTTTT / / / / // / PsiI SetI | HinfI |BccI FalI | TfiI TspEI FalI Hpy178III* MfeI K D Y N D L F E S V K N P S I E Q M K K K I I M T F L R V S R I H Q L N K * K N R L * * P F * E C Q E S I N * T N E K M ----:----|----:----|----:----|----:----|----:----|----:----| L S * L S R K S L T L F G D I S C I F F W L N Y H G K Q S H * S D M L Q V F S F F I I I V K K L T D L I W * N F L H F F BssKI EcoRII | FalI | FalI | ScrFI | BseBI MnlI | | TspDTI SspI Hin4I | | | Hin4I | FalI Hin4I | | | Hin4I TaqI | FalI | CviJI TsoI \ \ \ \ \ \ \ \ \ \ TGCCTGGAAGCAAAGAACGACTTACAATCGAATATTTGTAAATGGCTGGAGGAGAGAAAC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ACGGACCTTCGTTTCTTGCTGAATGTTAGCTTATAAACATTTACCGACCTCCTCTCTTTG / / // / / / / / | EcoRII || | | | CviJI TsoI | BssKI || | | MnlI TspDTI || | Hin4I BseBI || | Hin4I ScrFI || SspI Hin4I |FalI Hin4I |FalI TaqI C L E A K N D L Q S N I C K W L E E R N A W K Q R T T Y N R I F V N G W R R E T P G S K E R L T I E Y L * M A G G E K R ----:----|----:----|----:----|----:----|----:----|----:----| H R S A F F S K C D F I Q L H S S S L F I G P L L S R S V I S Y K Y I A P P S F A Q F C L V V * L R I N T F P Q L L S V CviJI | BseRI | | GsuI | | Eco57MI MboI | | | CviJI | DpnI | | | |DdeI | |BstKTI | | | || BceAI | || TsoI MseI SetI \ \ \ \\ \ \ \\ \ \ \ GGCTGTAAATGGCTAAGTAATGATCTGTATTTTTCAATGGTTAATAAGATAGAAACACCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCGACATTTACCGATTCATTACTAGACATAAAAAGTTACCAATTATTCTATCTTTGTGGA / / / // // // / / | | | || || |TsoI MseI SetI | | | || || MboI | | | || |DpnI | | | || BstKTI | | | |BceAI | | | DdeI | | CviJI | Eco57MI | GsuI BseRI CviJI G C K W L S N D L Y F S M V N K I E T P A V N G * V M I C I F Q W L I R * K H L L * M A K * * S V F F N G * * D R N T F ----:----|----:----|----:----|----:----|----:----|----:----| P Q L H S L L S R Y K E I T L L I S V G R S Y I A L Y H D T N K L P * Y S L F V A T F P * T I I Q I K * H N I L Y F C R Hin4II* TaqI | SetI AsuII | | Hpy188I \ \ \ \ TCGAAACAATACCTGTCAGATAAGGCAAAAGAATACGACCAAGTGCTGATTGATACTAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTTGTTATGGACAGTCTATTCCGTTTTCTTATGCTGGTTCACGACTAACTATGATTT / / / / / | | SetI Hpy188I Hin4II* | Hin4II* AsuII TaqI S K Q Y L S D K A K E Y D Q V L I D T K R N N T C Q I R Q K N T T K C * L I L K E T I P V R * G K R I R P S A D * Y * S ----:----|----:----|----:----|----:----|----:----|----:----| E F C Y R D S L A F S Y S W T S I S V L K S V I G T L Y P L L I R G L A S Q Y * R F L V Q * I L C F F V V L H Q N I S F HindIII | AluI | CviJI CviJI SetI | | SetI Hin4II* |MseI | | | CviRI* | DdeI ||AhaIII* DdeI | | | | Hpy188I \ \ \\\ \ \ \ \ \ \ GCCTTAGAAGGTTTAAAGAACCCAACGATAGACTTTCTAAGAGAAAAAGCTTCTGCATCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAATCTTCCAAATTTCTTGGGTTGCTATCTGAAAGATTCTCTTTTTCGAAGACGTAGT / / / // / / / / / / | | SetI |MseI DdeI | | | | Hpy188I | DdeI AhaIII* | | | CviRI* CviJI | | HindIII | CviJI | AluI SetI A L E G L K N P T I D F L R E K A S A S P * K V * R T Q R * T F * E K K L L H Q L R R F K E P N D R L S K R K S F C I R ----:----|----:----|----:----|----:----|----:----|----:----| A K S P K F F G V I S K R L S F A E A D L R L L N L S G L S L S E L L F L K Q M G * F T * L V W R Y V K * S F F S R C * MaeII BbvII* |BsaAI || SetI || TaiI || | MboII || | |CviJI || | || SduI || | || HgiJII* || | || | BsiYI* || | || | | BccI || | || | | | BsrI || | || | | | TspRI || | || | | | | MaeI SfaNI || | || | | | | |SetI FatI \ \\ \ \\ \ \ \ \ \\ \ GATTATTTATTACTCAAAAAAGAAGACTACGTGAGCCCATCACTGGAATACCTAGTTGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATAAATAATGAGTTTTTTCTTCTGATGCACTCGGGTAGTGACCTTATGGATCAACTT / / // / / // // / / / SfaNI | || | | || || SetI MaeI NlaIII | || | | || |BccI NspI | || | | || BsrI | || | | |BsiYI* | || | | TspRI | || | CviJI | || HgiJII* | || BbvII* | || MboII | || SduI | |MaeII | BsaAI TaiI SetI D Y L L L K K E D Y V S P S L E Y L V E I I Y Y S K K K T T * A H H W N T * L N L F I T Q K R R L R E P I T G I P S * T ----:----|----:----|----:----|----:----|----:----|----:----| S * K N S L F S S * T L G D S S Y R T S L N N I V * F L L S R S G M V P I G L Q I I * * E F F F V V H A W * Q F V * N F CviAII | NspI | NlaIII | |StyI MaeI | |SecI* Tth111I | || HphI |SetI | || CviJI Hpy188I |BbvII* | || HaeIII | CviRI* || MboII \ \\ \ \ \ \\ \ CATGCCAAGGCCACCAATCACCATTTACTATCGGATAGTGCATACGAAGACCTAGTCAAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGGTTCCGGTGGTTAGTGGTAAATGATAGCCTATCACGTATGCTTCTGGATCAGTTC // // / / / // / |FatI |HaeIII Hpy188I CviRI* | || BbvII* | |CviJI | || MboII | SecI* | |MaeI | StyI | Tth111I | HphI SetI CviAII H A K A T N H H L L S D S A Y E D L V K M P R P P I T I Y Y R I V H T K T * S S C Q G H Q S P F T I G * C I R R P S Q V ----:----|----:----|----:----|----:----|----:----|----:----| C A L A V L * W K S D S L A Y S S R T L V H W P W W D G N V I P Y H M R L G L * M G L G G I V M * * R I T C V F V * D L TfiI HinfI | Hpy178III* | | ApoI | | TspEI BaeI PflMI | | EcoRI | MaeI DraIII | | | Hin4II* | | CviJI BsiYI* CviRI* | | | | Hpy178III* | | HaeIII Tsp4CI* \ \ \ \ \ \ \ \ \ \ TGCAAGGAGAATCCTGATATGGAATTCTTGAAGGAGAAGTCTGCCAAACTAGGCCACACT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTTCCTCTTAGGACTATACCTTAAGAACTTCCTCTTCAGACGGTTTGATCCGGTGTGA / / / / / / / / // / / CviRI* | | | | Hpy178III* BaeI | || | Tsp4CI* | | | EcoRI | || BsiYI* | | | TspEI | || DraIII | | | ApoI | || PflMI | | Hin4II* | |TspRI | Hpy178III* | HaeIII HinfI | CviJI TfiI MaeI C K E N P D M E F L K E K S A K L G H T A R R I L I W N S * R R S L P N * A T L Q G E S * Y G I L E G E V C Q T R P H C ----:----|----:----|----:----|----:----|----:----|----:----| H L S F G S I S N K F S F D A L S P W V T C P S D Q Y P I R S P S T Q W V L G C A L L I R I H F E Q L L L R G F * A V S BciVI | BaeI BccI TspRI | | Hpy188I | BsrI | MnlI | | |TspEI MmeI MaeI | TspRI \ \ \ \ \\ \ \ \ \ GTGGTATCCAACGAGGCATATTCTGAATTGGAAAAGAAACTAGAACAACCATCACTGGAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATAGGTTGCTCCGTATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGTGACCTT / // / // / / // MnlI |BaeI | |MmeI MaeI TspRI |BccI BciVI | TspEI BsrI Hpy188I V V S N E A Y S E L E K K L E Q P S L E W Y P T R H I L N W K R N * N N H H W N G I Q R G I F * I G K E T R T T I T G I ----:----|----:----|----:----|----:----|----:----|----:----| T T D L S A Y E S N S F F S S C G D S S Q P I W R P M N Q I P F S V L V V M V P H Y G V L C I R F Q F L F * F L W * Q F FatI |CviAII || NspI || NlaIII || |StyI MaeI || |SecI* Hpy188I |SetI || || HphI | CviRI* \\ \\ \\ \ \ \ TACCTAGTTGAACATGCCAAGGCGACCAATCACCATTTACTATCGGATAGTGCATACGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGATCAACTTGTACGGTTCCGCTGGTTAGTGGTAAATGATAGCCTATCACGTATGCTT / / / // / / / SetI MaeI | |FatI SecI* Hpy188I CviRI* | | StyI | | HphI | CviAII NlaIII NspI Y L V E H A K A T N H H L L S D S A Y E T * L N M P R R P I T I Y Y R I V H T K P S * T C Q G D Q S P F T I G * C I R R ----:----|----:----|----:----|----:----|----:----|----:----| Y R T S C A L A V L * W K S D S L A Y S I G L Q V H W P S W D G N V I P Y H M R V * N F M G L R G I V M * * R I T C V F TfiI HinfI MaeI | Hpy178III* Tth111I | | ApoI |SetI | | TspEI |BbvII* | | EcoRI || MboII | | | Hin4II* || | CviRI* | | | | Hpy178III* BaeI \\ \ \ \ \ \ \ \ \ GACCTAGTCAAGTGCAAGGAGAATCCTGATATGGAATTCTTGAAGGAGAAGTCTGCCAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGATCAGTTCACGTTCCTCTTAGGACTATACCTTAAGAACTTCCTCTTCAGACGGTTT / // / / / / / / / / | || | CviRI* | | | | Hpy178III* BaeI | || BbvII* | | | EcoRI | || MboII | | | TspEI | |MaeI | | | ApoI | Tth111I | | Hin4II* SetI | Hpy178III* HinfI TfiI D L V K C K E N P D M E F L K E K S A K T * S S A R R I L I W N S * R R S L P N P S Q V Q G E S * Y G I L E G E V C Q T ----:----|----:----|----:----|----:----|----:----|----:----| S R T L H L S F G S I S N K F S F D A L L G L * T C P S D Q Y P I R S P S T Q W V * D L A L L I R I H F E Q L L L R G F BciVI | BaeI PflMI | | Hpy188I DdeI MaeI BsiYI* | | |TspEI | Hpy188I | CviJI Tsp4CI* | | || CviRI* | |TspEI | HaeIII | MnlI | | || | MmeI | || Hin4II* \ \ \ \ \ \ \\ \ \ \ \\ \ CTAGGCCATACTGTGGTATCCAACGAGGCATATTCTGAATTGCAACGCAAATACTCAGAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCGGTATGACACCATAGGTTGCTCCGTATAAGACTTAACGTTGCGTTTATGAGTCTT / / / / / // / // // / | | | | MnlI |BaeI | |CviRI* || Hin4II* | | | Tsp4CI* BciVI | |MmeI |DdeI | | BsiYI* | TspEI Hpy188I | | PflMI Hpy188I | HaeIII | CviJI MaeI L G H T V V S N E A Y S E L Q R K Y S E * A I L W Y P T R H I L N C N A N T Q N R P Y C G I Q R G I F * I A T Q I L R I ----:----|----:----|----:----|----:----|----:----|----:----| S P W V T T D L S A Y E S N C R L Y E S V L G Y Q P I W R P M N Q I A V C I S L * A M S H Y G V L C I R F Q L A F V * F StyI SecI* | HphI BspCNI MaeI | CviJI |BseMII | BccI DdeI | | MboI \\ \ \ \ \ \ \ TTGGAGAAGGAAGTAGAACAACCATCTCTAGCATACTTAGTTGAACACGCCAAGGCTACC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTCTTCCTTCATCTTGTTGGTAGAGATCGTATGAATCAACTTGTGCGGTTCCGATGG / // // / // | |BseMII |BccI DdeI |CviJI | BspCNI MaeI SecI* TspEI StyI HphI L E K E V E Q P S L A Y L V E H A K A T W R R K * N N H L * H T * L N T P R L P G E G S R T T I S S I L S * T R Q G Y R ----:----|----:----|----:----|----:----|----:----|----:----| N S F S T S C G D R A Y K T S C A L A V I P S P L L V V M E L M S L Q V R W P * Q L L F Y F L W R * C V * N F V G L S G MaeI Tth111I |SetI |BbvII* TfiI DpnI Hpy188I || MboII HinfI |BstKTI | CviRI* || | CviRI* | Hpy178III* \\ \ \ \\ \ \ \ \ GATCACCATTTACTATCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAGGAGAATCCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTGGTAAATGATAGCCTATCACGTATGCTTCTGGATCAGTTCACGTTCCTCTTAGGA // / / / / // / / / / || MboI Hpy188I CviRI* | || | CviRI* | Hpy178III* |DpnI | || BbvII* HinfI BstKTI | || MboII TfiI | |MaeI | Tth111I SetI D H H L L S D S A Y E D L V K C K E N P I T I Y Y R I V H T K T * S S A R R I L S P F T I G * C I R R P S Q V Q G E S * ----:----|----:----|----:----|----:----|----:----|----:----| S * W K S D S L A Y S S R T L H L S F G R D G N V I P Y H M R L G L * T C P S D I V M * * R I T C V F V * D L A L L I R ApoI PflMI TspEI BaeI BsiYI* EcoRI | MaeI Tsp4CI* | Hin4II* | | CviJI | MnlI | | Hpy178III* | | HaeIII | | MaeI \ \ \ \ \ \ \ \ \ GATGTGGAATTCTTGAAGGAGAAGTCTGCTAAACTAGGCCATACTGTGGTATCTAGCGAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACCTTAAGAACTTCCTCTTCAGACGATTTGATCCGGTATGACACCATAGATCGCTC / / / / / / / / / / / | | Hpy178III* BaeI | | | | MnlI MaeI BaeI | EcoRI | | | Tsp4CI* | TspEI | | BsiYI* | ApoI | | PflMI Hin4II* | HaeIII | CviJI MaeI D V E F L K E K S A K L G H T V V S S E M W N S * R R S L L N * A I L W Y L A R C G I L E G E V C * T R P Y C G I * R G ----:----|----:----|----:----|----:----|----:----|----:----| S T S N K F S F D A L S P W V T T D L S Q H P I R S P S T Q * V L G Y Q P I * R I H F E Q L L L R S F * A M S H Y R A L DdeI SspI | Hpy188I |BaeI | |TspEI || Hpy188I | || Hin4II* || |TspEI | || | BspCNI || || CviRI* | || | |BseMII \\ \\ \ \ \\ \ \\ GAATATTCTGAATTGCAACGCAAATACTCAGAATTGGAGAAGGAAGTAGAACAACCATCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATAAGACTTAACGTTGCGTTTATGAGTCTTAACCTCTTCCTTCATCTTGTTGGTAGT / / // // / / // | | |CviRI* || | | |BseMII | | TspEI || | | BspCNI | Hpy188I || | TspEI SspI || Hin4II* |DdeI Hpy188I E Y S E L Q R K Y S E L E K E V E Q P S N I L N C N A N T Q N W R R K * N N H H I F * I A T Q I L R I G E G S R T T I T ----:----|----:----|----:----|----:----|----:----|----:----| S Y E S N C R L Y E S N S F S T S C G D P I N Q I A V C I S L I P S P L L V V M F I R F Q L A F V * F Q L L F Y F L W * StyI SecI* | HphI | CviJI MaeI | | MboI MaeI |SetI | | | DpnI Hpy188I | BccI || TaqI | | | |BstKTI | CviRI* \ \ \\ \ \ \ \ \\ \ \ CTAGCATACCTAGTCGAACACGCCAAGGCTACCGATCACCATTTACTATCGGATAGTGCA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGTATGGATCAGCTTGTGCGGTTCCGATGGCTAGTGGTAAATGATAGCCTATCACGT // / / / // // / / / || SetI | TaqI |CviJI || MboI Hpy188I CviRI* |BccI MaeI SecI* |DpnI MaeI StyI BstKTI HphI L A Y L V E H A K A T D H H L L S D S A * H T * S N T P R L P I T I Y Y R I V H S I P S R T R Q G Y R S P F T I G * C I ----:----|----:----|----:----|----:----|----:----|----:----| S A Y R T S C A L A V S * W K S D S L A V L M G L R V R W P * R D G N V I P Y H * C V * D F V G L S G I V M * * R I T C TfiI HinfI | Hpy178III* | | ApoI | | TspEI | | EcoRI SpeI MboII | | | Hin4II* |MaeI | CviRI* | | | | Hpy178III* \\ \ \ \ \ \ \ \ TACGAAGAACTAGTCAAGTGCAAGGAGAATCCTGATATGGAATTCTTGAAGGAGAAGTCT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTCTTGATCAGTTCACGTTCCTCTTAGGACTATACCTTAAGAACTTCCTCTTCAGA // / / / / / / / / || | CviRI* | | | | Hpy178III* BaeI || MboII | | | EcoRI |SpeI | | | TspEI MaeI | | | ApoI | | Hin4II* | Hpy178III* HinfI TfiI Y E E L V K C K E N P D M E F L K E K S T K N * S S A R R I L I W N S * R R S L R R T S Q V Q G E S * Y G I L E G E V C ----:----|----:----|----:----|----:----|----:----|----:----| Y S S S T L H L S F G S I S N K F S F D M R L V L * T C P S D Q Y P I R S P S T V F F * D L A L L I R I H F E Q L L L R PflMI DraIII BaeI BsiYI* BciVI | MaeI Tsp4CI* | BaeI | | CviJI | TspRI | | Hpy188I | | HaeIII | | MnlI | | |TspEI MmeI MaeI \ \ \ \ \ \ \ \ \\ \ \ GCCAAACTAGGCCACACTGTGGTATCCAACGAGGCATATTCTGAATTGGAAAAGAAACTA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTGATCCGGTGTGACACCATAGGTTGCTCCGTATAAGACTTAACCTTTTCTTTGAT / // / / / // / // / | || | | MnlI |BaeI | |MmeI MaeI | || | Tsp4CI* BciVI | TspEI | || BsiYI* Hpy188I | || DraIII | || PflMI | |TspRI | HaeIII | CviJI MaeI A K L G H T V V S N E A Y S E L E K K L P N * A T L W Y P T R H I L N W K R N * Q T R P H C G I Q R G I F * I G K E T R ----:----|----:----|----:----|----:----|----:----|----:----| A L S P W V T T D L S A Y E S N S F F S Q W V L G C Q P I W R P M N Q I P F S V G F * A V S H Y G V L C I R F Q F L F * MaeI |SetI || TaqI || | FatI || | |CviAII || | || NspI || | || NlaIII || | || |StyI || | || |SecI* || | || || HphI || | || || CviJI || | || || | MboI || | || || | | DpnI MaeI || | || || | | |BstKTI | BccI || | || || | | || BsaBI BccI \ \ \\ \ \\ \\ \ \ \\ \ \ GAACAACCATCACTAGCATACCTAGTCGAACATGCCAAGGCTACCGATCACCATCTGCTA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTGGTAGTGATCGTATGGATCAGCTTGTACGGTTCCGATGGCTAGTGGTAGACGAT // / / / / // // // // / || SetI | | | |FatI |CviJI || |BsaBI BccI |BccI | | | | SecI* || MboI MaeI | | | | StyI |DpnI | | | | HphI BstKTI | | | CviAII | | NlaIII | | NspI | TaqI MaeI E Q P S L A Y L V E H A K A T D H H L L N N H H * H T * S N M P R L P I T I C Y T T I T S I P S R T C Q G Y R S P S A I ----:----|----:----|----:----|----:----|----:----|----:----| S C G D S A Y R T S C A L A V S * W R S L V V M V L M G L R V H W P * R D G D A F L W * * C V * D F M G L S G I V M Q * MaeI Hpy188I Tth111I | ApoI |SetI | TspEI |BbvII* | EcoRI Hpy188I || MboII ApoI | | Hin4II* | CviRI* || | CviRI* TspEI | | | Hpy178III* \ \ \\ \ \ \ \ \ \ \ TCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAGGAAAATTCTGATGTAGAATTCTTG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTATCACGTATGCTTCTGGATCAGTTCACGTTCCTTTTAAGACTACATCTTAAGAAC / / / // / / // / / / Hpy188I CviRI* | || | CviRI* |Hpy188I | | Hpy178III* | || BbvII* TspEI | EcoRI | || MboII ApoI | TspEI | |MaeI | ApoI | Tth111I Hin4II* SetI S D S A Y E D L V K C K E N S D V E F L R I V H T K T * S S A R K I L M * N S * G * C I R R P S Q V Q G K F * C R I L E ----:----|----:----|----:----|----:----|----:----|----:----| D S L A Y S S R T L H L S F E S T S N K I P Y H M R L G L * T C P F N Q H L I R R I T C V F V * D L A L F I R I Y F E Q BaeI BciVI | MaeI PflMI | BaeI | | CviJI BsiYI* | | Hpy188I | | HaeIII Tsp4CI* | | |TspEI \ \ \ \ \ \ \\ AAGGAGAAGTCTGCTAAACTAGGCCATACTGTGGTATCCAACGAAGCATATTCTGAATTG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTCTTCAGACGATTTGATCCGGTATGACACCATAGGTTGCTTCGTATAAGACTTAAC / / / / / // / // BaeI | | | Tsp4CI* |BaeI | |MmeI | | BsiYI* BciVI | TspEI | | PflMI Hpy188I | HaeIII | CviJI MaeI K E K S A K L G H T V V S N E A Y S E L R R S L L N * A I L W Y P T K H I L N W G E V C * T R P Y C G I Q R S I F * I G ----:----|----:----|----:----|----:----|----:----|----:----| F S F D A L S P W V T T D L S A Y E S N S P S T Q * V L G Y Q P I W R L M N Q I L L L R S F * A M S H Y G V F C I R F Q MaeI |SetI || TaqI || | FatI || | |CviAII || | || NspI || | || NlaIII || | || |StyI || | || |SecI* || | || || HphI || | || || CviJI || | || || | MboI MaeI || | || || | | DpnI MmeI MaeI | BccI || | || || | | |BstKTI \ \ \ \ \\ \ \\ \\ \ \ \\ GAAAAGAAACTAGAACAACCATCACTAGCATACCTAGTCGAACATGCCAAGGCTACCGAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTTGATCTTGTTGGTAGTGATCGTATGGATCAGCTTGTACGGTTCCGATGGCTA / // / / / / // // // MaeI || SetI | | | |FatI |CviJI |DpnI |BccI | | | | SecI* BstKTI MaeI | | | | StyI | | | | HphI | | | CviAII | | NlaIII | | NspI | TaqI MaeI E K K L E Q P S L A Y L V E H A K A T D K R N * N N H H * H T * S N M P R L P I K E T R T T I T S I P S R T C Q G Y R S ----:----|----:----|----:----|----:----|----:----|----:----| S F F S S C G D S A Y R T S C A L A V S P F S V L V V M V L M G L R V H W P * R F L F * F L W * * C V * D F M G L S G I MaeI Tth111I |SetI BccI |BbvII* TfiI | Hpy188I || MboII HinfI BsaBI | | CviRI* || | CviRI* | Hpy178III* \ \ \ \ \\ \ \ \ \ CACCATCTGCTATCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAGGAGAATCCTGAT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTAGACGATAGCCTATCACGTATGCTTCTGGATCAGTTCACGTTCCTCTTAGGACTA // / / / / // / / / / |BsaBI | Hpy188I CviRI* | || | CviRI* | Hpy178III* MboI BccI | || BbvII* HinfI | || MboII TfiI | |MaeI | Tth111I SetI H H L L S D S A Y E D L V K C K E N P D T I C Y R I V H T K T * S S A R R I L I P S A I G * C I R R P S Q V Q G E S * Y ----:----|----:----|----:----|----:----|----:----|----:----| * W R S D S L A Y S S R T L H L S F G S D G D A I P Y H M R L G L * T C P S D Q V M Q * R I T C V F V * D L A L L I R I PflMI ApoI DraIII TspEI BaeI BsiYI* EcoRI | MaeI Tsp4CI* | Hin4II* | | CviJI | TspRI | | Hpy178III* | | HaeIII | | MnlI BciVI \ \ \ \ \ \ \ \ \ \ ATGGAATTCTTGAAGGAGAAGTCTGCCAAACTAGGCCACACTGTGGTATCCAACGAGGCA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAAGAACTTCCTCTTCAGACGGTTTGATCCGGTGTGACACCATAGGTTGCTCCGT / / / / / // / / / // | | Hpy178III* BaeI | || | | MnlI |BaeI | EcoRI | || | Tsp4CI* BciVI | TspEI | || BsiYI* | ApoI | || DraIII Hin4II* | || PflMI | |TspRI | HaeIII | CviJI MaeI M E F L K E K S A K L G H T V V S N E A W N S * R R S L P N * A T L W Y P T R H G I L E G E V C Q T R P H C G I Q R G I ----:----|----:----|----:----|----:----|----:----|----:----| I S N K F S F D A L S P W V T T D L S A Y P I R S P S T Q W V L G C Q P I W R P H F E Q L L L R G F * A V S H Y G V L C FatI BccI |CviAII | BsrI || NspI BaeI | TspRI || NlaIII | Hpy188I | | MaeI || |StyI | |TspEI MmeI MaeI | | |SetI || |SecI* \ \\ \ \ \ \ \\ \\ \\ TATTCTGAATTGGAAAAGAAACTAGAACAACCATCACTGGAATACCTAGTTGAACATGCC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGTGACCTTATGGATCAACTTGTACGG / // / / // / / / // | |MmeI MaeI TspRI || SetI MaeI | |FatI | TspEI |BccI | CviAII Hpy188I BsrI NlaIII NspI Y S E L E K K L E Q P S L E Y L V E H A I L N W K R N * N N H H W N T * L N M P F * I G K E T R T T I T G I P S * T C Q ----:----|----:----|----:----|----:----|----:----|----:----| Y E S N S F F S S C G D S S Y R T S C A M N Q I P F S V L V V M V P I G L Q V H I R F Q F L F * F L W * Q F V * N F M G MaeI Tth111I |SetI HphI |BbvII* CviJI Hpy188I || MboII HaeIII | CviRI* || | CviRI* \ \ \ \\ \ \ AAGGCCACCAATCACCATTTACTATCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGGTGGTTAGTGGTAAATGATAGCCTATCACGTATGCTTCTGGATCAGTTCACGTTC // / / / // / / |HaeIII Hpy188I CviRI* | || | CviRI* |CviJI | || BbvII* SecI* | || MboII StyI | |MaeI HphI | Tth111I SetI K A T N H H L L S D S A Y E D L V K C K R P P I T I Y Y R I V H T K T * S S A R G H Q S P F T I G * C I R R P S Q V Q G ----:----|----:----|----:----|----:----|----:----|----:----| L A V L * W K S D S L A Y S S R T L H L W P W W D G N V I P Y H M R L G L * T C L G G I V M * * R I T C V F V * D L A L TfiI HinfI | Hpy178III* PflMI | | ApoI DraIII | | TspEI BaeI BsiYI* | | EcoRI | MaeI Tsp4CI* | | | Hin4II* | | CviJI | TspRI | | | | Hpy178III* | | HaeIII | | MnlI \ \ \ \ \ \ \ \ \ \ \ GAGAATCCTGATATGGAATTCTTGAAGGAGAAGTCTGCCAAACTAGGCCACACTGTGGTA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTAGGACTATACCTTAAGAACTTCCTCTTCAGACGGTTTGATCCGGTGTGACACCAT / / / / / / / // / / / | | | | Hpy178III* BaeI | || | | MnlI | | | EcoRI | || | Tsp4CI* | | | TspEI | || BsiYI* | | | ApoI | || DraIII | | Hin4II* | || PflMI | Hpy178III* | |TspRI HinfI | HaeIII TfiI | CviJI MaeI E N P D M E F L K E K S A K L G H T V V R I L I W N S * R R S L P N * A T L W Y E S * Y G I L E G E V C Q T R P H C G I ----:----|----:----|----:----|----:----|----:----|----:----| S F G S I S N K F S F D A L S P W V T T P S D Q Y P I R S P S T Q W V L G C Q P L I R I H F E Q L L L R G F * A V S H Y BccI BciVI | BsrI | BaeI | TspRI | | Hpy188I | | MaeI | | |TspEI MmeI MaeI | | |SetI \ \ \\ \ \ \ \ \\ TCCAACGAGGCATATTCTGAATTGGAAAAGAAACTAGAACAACCATCACTGGAATACCTA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGCTCCGTATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGTGACCTTATGGAT // / // / / // / / |BaeI | |MmeI MaeI TspRI || SetI MaeI BciVI | TspEI |BccI Hpy188I BsrI S N E A Y S E L E K K L E Q P S L E Y L P T R H I L N W K R N * N N H H W N T * Q R G I F * I G K E T R T T I T G I P S ----:----|----:----|----:----|----:----|----:----|----:----| D L S A Y E S N S F F S S C G D S S Y R I W R P M N Q I P F S V L V V M V P I G G V L C I R F Q F L F * F L W * Q F V * FatI |CviAII || NspI || NlaIII || |StyI || |SecI* || || HphI BccI || || CviJI | Hpy188I SpeI || || HaeIII | | CviRI* |MaeI \\ \\ \ \ \ \ \\ GTTGAACATGCCAAGGCCACCAATCACCATCTGCTATCGGATAGTGCATACGAAGAACTA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTGTACGGTTCCGGTGGTTAGTGGTAGACGATAGCCTATCACGTATGCTTCTTGAT / // // / / / / | |FatI |HaeIII | Hpy188I CviRI* MaeI | | |CviJI BccI | | SecI* | | StyI | | HphI | CviAII NlaIII NspI V E H A K A T N H H L L S D S A Y E E L L N M P R P P I T I C Y R I V H T K N * * T C Q G H Q S P S A I G * C I R R T S ----:----|----:----|----:----|----:----|----:----|----:----| T S C A L A V L * W R S D S L A Y S S S L Q V H W P W W D G D A I P Y H M R L V N F M G L G G I V M Q * R I T C V F F * Hpy178III* | ApoI | TspEI BaeI | EcoRI | MaeI MboII | | Hin4II* | | CviJI | CviRI* | | | Hpy178III* | | HaeIII \ \ \ \ \ \ \ \ \ GTCAAGTGCAAGGAAAATCCTGATGTAGAATTCTTGAAGGAGAAGTCTGCTAAACTAGGC 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCACGTTCCTTTTAGGACTACATCTTAAGAACTTCCTCTTCAGACGATTTGATCCG / / / / / / / / / / | | CviRI* | | | Hpy178III* BaeI | HaeIII | MboII | | EcoRI | CviJI SpeI | | TspEI MaeI | | ApoI | Hin4II* Hpy178III* V K C K E N P D V E F L K E K S A K L G S S A R K I L M * N S * R R S L L N * A Q V Q G K S * C R I L E G E V C * T R P ----:----|----:----|----:----|----:----|----:----|----:----| T L H L S F G S T S N K F S F D A L S P L * T C P F D Q H L I R S P S T Q * V L D L A L F I R I Y F E Q L L L R S F * A BciVI PflMI | BaeI BsiYI* | | Hpy188I Tsp4CI* | | |TspEI MmeI MaeI \ \ \ \\ \ \ CATACTGTGGTATCCAACGAAGCATATTCTGAATTGGAAAAGAAACTAGAACAACCATCA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGACACCATAGGTTGCTTCGTATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGT / / // / // / / | Tsp4CI* |BaeI | |MmeI MaeI TspRI BsiYI* BciVI | TspEI PflMI Hpy188I H T V V S N E A Y S E L E K K L E Q P S I L W Y P T K H I L N W K R N * N N H H Y C G I Q R S I F * I G K E T R T T I T ----:----|----:----|----:----|----:----|----:----|----:----| W V T T D L S A Y E S N S F F S S C G D G Y Q P I W R L M N Q I P F S V L V V M M S H Y G V F C I R F Q F L F * F L W * FatI |CviAII || NspI || NlaIII BccI || |StyI | BsrI || |SecI* | TspRI || || HphI BccI | | MaeI || || CviJI | Hpy188I | | |SetI || || HaeIII | | CviRI* \ \ \\ \\ \\ \ \ \ \ CTGGAATACCTAGTTGAACATGCCAAGGCCACCAATCACCATCTGCTATCGGATAGTGCA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTTATGGATCAACTTGTACGGTTCCGGTGGTTAGTGGTAGACGATAGCCTATCACGT // / / / // // / / / || SetI MaeI | |FatI |HaeIII | Hpy188I CviRI* |BccI | | |CviJI BccI BsrI | | SecI* | | StyI | | HphI | CviAII NlaIII NspI L E Y L V E H A K A T N H H L L S D S A W N T * L N M P R P P I T I C Y R I V H G I P S * T C Q G H Q S P S A I G * C I ----:----|----:----|----:----|----:----|----:----|----:----| S S Y R T S C A L A V L * W R S D S L A V P I G L Q V H W P W W D G D A I P Y H Q F V * N F M G L G G I V M Q * R I T C Hpy178III* | ApoI | TspEI | EcoRI SpeI MboII | | Hin4II* |MaeI | CviRI* | | | Hpy178III* \\ \ \ \ \ \ \ TACGAAGAACTAGTCAAGTGCAAGGAAAATCCTGATGTAGAATTCTTGAAGGAGAAGTCT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTTCTTGATCAGTTCACGTTCCTTTTAGGACTACATCTTAAGAACTTCCTCTTCAGA // / / / / / / / || | CviRI* | | | Hpy178III* BaeI || MboII | | EcoRI |SpeI | | TspEI MaeI | | ApoI | Hin4II* Hpy178III* Y E E L V K C K E N P D V E F L K E K S T K N * S S A R K I L M * N S * R R S L R R T S Q V Q G K S * C R I L E G E V C ----:----|----:----|----:----|----:----|----:----|----:----| Y S S S T L H L S F G S T S N K F S F D M R L V L * T C P F D Q H L I R S P S T V F F * D L A L F I R I Y F E Q L L L R BaeI BciVI | MaeI PflMI | BaeI | | CviJI BsiYI* | | Hpy188I | | HaeIII Tsp4CI* | | |TspEI MmeI MaeI \ \ \ \ \ \ \\ \ \ GCTAAACTAGGCCATACTGTGGTATCCAACGAAGCATATTCTGAATTGGAAAAGAAACTA 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTTGATCCGGTATGACACCATAGGTTGCTTCGTATAAGACTTAACCTTTTCTTTGAT / / / / // / // / | | | Tsp4CI* |BaeI | |MmeI MaeI | | BsiYI* BciVI | TspEI | | PflMI Hpy188I | HaeIII | CviJI MaeI A K L G H T V V S N E A Y S E L E K K L L N * A I L W Y P T K H I L N W K R N * * T R P Y C G I Q R S I F * I G K E T R ----:----|----:----|----:----|----:----|----:----|----:----| A L S P W V T T D L S A Y E S N S F F S Q * V L G Y Q P I W R L M N Q I P F S V S F * A M S H Y G V F C I R F Q F L F * MaeI |SetI || TaqI || | FatI || | |CviAII || | || NspI || | || NlaIII || | || |StyI || | || |SecI* || | || || HphI || | || || CviJI || | || || | MboI || | || || | | DpnI MaeI || | || || | | |BstKTI | BccI || | || || | | || BsaBI BccI \ \ \\ \ \\ \\ \ \ \\ \ \ GAACAACCATCACTAGCATACCTAGTCGAACATGCCAAGGCTACCGATCACCATCTGCTA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTGGTAGTGATCGTATGGATCAGCTTGTACGGTTCCGATGGCTAGTGGTAGACGAT // / / / / // // // // / || SetI | | | |FatI |CviJI || |BsaBI BccI |BccI | | | | SecI* || MboI MaeI | | | | StyI |DpnI | | | | HphI BstKTI | | | CviAII | | NlaIII | | NspI | TaqI MaeI E Q P S L A Y L V E H A K A T D H H L L N N H H * H T * S N M P R L P I T I C Y T T I T S I P S R T C Q G Y R S P S A I ----:----|----:----|----:----|----:----|----:----|----:----| S C G D S A Y R T S C A L A V S * W R S L V V M V L M G L R V H W P * R D G D A F L W * * C V * D F M G L S G I V M Q * MaeI Hpy178III* Tth111I | ApoI |SetI | TspEI |BbvII* | EcoRI Hpy188I || MboII | | Hin4II* | CviRI* || | CviRI* | | | Hpy178III* \ \ \\ \ \ \ \ \ \ TCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAGGAAAATCCTGATGTAGAATTCTTG 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTATCACGTATGCTTCTGGATCAGTTCACGTTCCTTTTAGGACTACATCTTAAGAAC / / / // / / / / / / Hpy188I CviRI* | || | CviRI* | | | Hpy178III* | || BbvII* | | EcoRI | || MboII | | TspEI | |MaeI | | ApoI | Tth111I | Hin4II* SetI Hpy178III* S D S A Y E D L V K C K E N P D V E F L R I V H T K T * S S A R K I L M * N S * G * C I R R P S Q V Q G K S * C R I L E ----:----|----:----|----:----|----:----|----:----|----:----| D S L A Y S S R T L H L S F G S T S N K I P Y H M R L G L * T C P F D Q H L I R R I T C V F V * D L A L F I R I Y F E Q BaeI BciVI | MaeI PflMI | BaeI | | CviJI BsiYI* | | Hpy188I | | HaeIII Tsp4CI* | | |TspEI \ \ \ \ \ \ \\ AAGGAGAAGTCTGCTAAACTAGGCCATACTGTGGTATCCAACGAAGCATATTCTGAATTG 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTCTTCAGACGATTTGATCCGGTATGACACCATAGGTTGCTTCGTATAAGACTTAAC / / / / / // / // BaeI | | | Tsp4CI* |BaeI | |MmeI | | BsiYI* BciVI | TspEI | | PflMI Hpy188I | HaeIII | CviJI MaeI K E K S A K L G H T V V S N E A Y S E L R R S L L N * A I L W Y P T K H I L N W G E V C * T R P Y C G I Q R S I F * I G ----:----|----:----|----:----|----:----|----:----|----:----| F S F D A L S P W V T T D L S A Y E S N S P S T Q * V L G Y Q P I W R L M N Q I L L L R S F * A M S H Y G V F C I R F Q MaeI |SetI || TaqI || | FatI || | |CviAII || | || NspI || | || NlaIII || | || |StyI || | || |SecI* || | || || HphI || | || || CviJI || | || || | MboI MaeI || | || || | | DpnI MmeI MaeI | BccI || | || || | | |BstKTI \ \ \ \ \\ \ \\ \\ \ \ \\ GAAAAGAAACTAGAACAACCATCACTAGCATACCTAGTCGAACATGCCAAGGCTACCGAT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTTGATCTTGTTGGTAGTGATCGTATGGATCAGCTTGTACGGTTCCGATGGCTA / // / / / / // // // MaeI || SetI | | | |FatI |CviJI |DpnI |BccI | | | | SecI* BstKTI MaeI | | | | StyI | | | | HphI | | | CviAII | | NlaIII | | NspI | TaqI MaeI E K K L E Q P S L A Y L V E H A K A T D K R N * N N H H * H T * S N M P R L P I K E T R T T I T S I P S R T C Q G Y R S ----:----|----:----|----:----|----:----|----:----|----:----| S F F S S C G D S A Y R T S C A L A V S P F S V L V V M V L M G L R V H W P * R F L F * F L W * * C V * D F M G L S G I MaeI Tth111I |SetI BccI |BbvII* TfiI | Hpy188I || MboII HinfI BsaBI | | CviRI* || | CviRI* | Hpy178III* \ \ \ \ \\ \ \ \ \ CACCATCTGCTATCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAGGAGAATCCTGAT 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGTAGACGATAGCCTATCACGTATGCTTCTGGATCAGTTCACGTTCCTCTTAGGACTA // / / / / // / / / / |BsaBI | Hpy188I CviRI* | || | CviRI* | Hpy178III* MboI BccI | || BbvII* HinfI | || MboII TfiI | |MaeI | Tth111I SetI H H L L S D S A Y E D L V K C K E N P D T I C Y R I V H T K T * S S A R R I L I P S A I G * C I R R P S Q V Q G E S * Y ----:----|----:----|----:----|----:----|----:----|----:----| * W R S D S L A Y S S R T L H L S F G S D G D A I P Y H M R L G L * T C P S D Q V M Q * R I T C V F V * D L A L L I R I PflMI ApoI DraIII TspEI BaeI BsiYI* EcoRI | MaeI Tsp4CI* | Hin4II* | | CviJI | TspRI | | Hpy178III* | | HaeIII | | MnlI BciVI \ \ \ \ \ \ \ \ \ \ ATGGAATTCTTGAAGGAGAAGTCTGCCAAACTAGGCCACACTGTGGTATCCAACGAGGCA 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTAAGAACTTCCTCTTCAGACGGTTTGATCCGGTGTGACACCATAGGTTGCTCCGT / / / / / // / / / // | | Hpy178III* BaeI | || | | MnlI |BaeI | EcoRI | || | Tsp4CI* BciVI | TspEI | || BsiYI* | ApoI | || DraIII Hin4II* | || PflMI | |TspRI | HaeIII | CviJI MaeI M E F L K E K S A K L G H T V V S N E A W N S * R R S L P N * A T L W Y P T R H G I L E G E V C Q T R P H C G I Q R G I ----:----|----:----|----:----|----:----|----:----|----:----| I S N K F S F D A L S P W V T T D L S A Y P I R S P S T Q W V L G C Q P I W R P H F E Q L L L R G F * A V S H Y G V L C FatI BccI |CviAII | BsrI || NspI BaeI | TspRI || NlaIII | Hpy188I | | MaeI || |StyI | |TspEI MmeI MaeI | | |SetI || |SecI* \ \\ \ \ \ \ \\ \\ \\ TATTCTGAATTGGAAAAGAAACTAGAACAACCATCACTGGAATACCTAGTTGAACATGCC 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGTGACCTTATGGATCAACTTGTACGG / // / / // / / / // | |MmeI MaeI TspRI || SetI MaeI | |FatI | TspEI |BccI | CviAII Hpy188I BsrI NlaIII NspI Y S E L E K K L E Q P S L E Y L V E H A I L N W K R N * N N H H W N T * L N M P F * I G K E T R T T I T G I P S * T C Q ----:----|----:----|----:----|----:----|----:----|----:----| Y E S N S F F S S C G D S S Y R T S C A M N Q I P F S V L V V M V P I G L Q V H I R F Q F L F * F L W * Q F V * N F M G MaeI Tth111I |SetI HphI BccI |BbvII* CviJI | Hpy188I || MboII HaeIII | | CviRI* || | CviRI* \ \ \ \ \\ \ \ AAGGCCACCAATCACCATCTGCTATCGGATAGTGCATACGAAGACCTAGTCAAGTGCAAG 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGGTGGTTAGTGGTAGACGATAGCCTATCACGTATGCTTCTGGATCAGTTCACGTTC // / / / / // / / |HaeIII | Hpy188I CviRI* | || | CviRI* |CviJI BccI | || BbvII* SecI* | || MboII StyI | |MaeI HphI | Tth111I SetI K A T N H H L L S D S A Y E D L V K C K R P P I T I C Y R I V H T K T * S S A R G H Q S P S A I G * C I R R P S Q V Q G ----:----|----:----|----:----|----:----|----:----|----:----| L A V L * W R S D S L A Y S S R T L H L W P W W D G D A I P Y H M R L G L * T C L G G I V M Q * R I T C V F V * D L A L BaeI | AsuI* TfiI | |BmgT120I HinfI | ||BsrI | Hpy178III* | ||CviJI | | ApoI | ||HaeIII | | TspEI | ||| BfiI | | EcoRI | ||| | PflMI | | | Hin4II* | ||| | BsiYI* | | | | Hpy178III* | ||| | Tsp4CI* \ \ \ \ \ \ \\\ \ \ GAGAATCCTGATATGGAATTCTTGAAGGAGAAGTCTGCTAAACTGGGCCATACTGTGGTA 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTAGGACTATACCTTAAGAACTTCCTCTTCAGACGATTTGACCCGGTATGACACCAT / / / / / / / // / / | | | | Hpy178III* BaeI | || | Tsp4CI* | | | EcoRI | || BsiYI* | | | TspEI | || PflMI | | | ApoI | || BfiI | | Hin4II* | |AsuI* | Hpy178III* | BmgT120I HinfI | HaeIII TfiI | CviJI BsrI E N P D M E F L K E K S A K L G H T V V R I L I W N S * R R S L L N W A I L W Y E S * Y G I L E G E V C * T G P Y C G I ----:----|----:----|----:----|----:----|----:----|----:----| S F G S I S N K F S F D A L S P W V T T P S D Q Y P I R S P S T Q * V P G Y Q P L I R I H F E Q L L L R S F Q A M S H Y BciVI | SspI BccI | |BaeI | BsrI | || Hpy188I | TspRI | || |TspEI MmeI MaeI | | DdeI \ \\ \\ \ \ \ \ \ TCCAACAAGGAATATTCTGAATTGGAAAAGAAACTAGAACAACCATCACTGGAATACTTA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGTTCCTTATAAGACTTAACCTTTTCTTTGATCTTGTTGGTAGTGACCTTATGAAT // / / // / / // / || | | |MmeI MaeI TspRI |BccI DdeI || | | TspEI BsrI || | Hpy188I || SspI |BaeI BciVI S N K E Y S E L E K K L E Q P S L E Y L P T R N I L N W K R N * N N H H W N T * Q Q G I F * I G K E T R T T I T G I L S ----:----|----:----|----:----|----:----|----:----|----:----| D L L S Y E S N S F F S S C G D S S Y K I W C P I N Q I P F S V L V V M V P I S G V L F I R F Q F L F * F L W * Q F V * TaqI ClaI FatI |MboI |CviAII || DpnI DdeI || NspI || |BstKTI Bpu10I || NlaIII TspEI || || Hpy188I |SetI \\ \ \ \\ \\ \ \\ GTCAAACATGCCGAACAAATACAATCAAAAATTATATCGATCTCGGACTTCAACACCTTA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTGTACGGCTTGTTTATGTTAGTTTTTAATATAGCTAGAGCCTGAAGTTGTGGAAT / // / // / / / // | |FatI TspEI || | Hpy188I SetI |Bpu10I | CviAII || MboI |DdeI NlaIII |DpnI SetI NspI BstKTI ClaI TaqI V K H A E Q I Q S K I I S I S D F N T L S N M P N K Y N Q K L Y R S R T S T P * Q T C R T N T I K N Y I D L G L Q H L S ----:----|----:----|----:----|----:----|----:----|----:----| T L C A S C I C D F I I D I E S K L V K L * V H R V F V I L F * I S R P S * C R D F M G F L Y L * F N Y R D R V E V G * CviJI AluI | MboII CviJI | | TspEI | SetI BccI | | | CviRI* PsrI \ \ \ \ \ \ \ \ GCTAATCCATCTATGGAAGATATGGCTTCAAAATTGCAAAAGTTAGAATACCAGATTGTT 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTAGGTAGATACCTTCTATACCGAAGTTTTAACGTTTTCAATCTTATGGTCTAACAA / / / / // / CviJI BccI | MboII |CviRI* PsrI AluI CviJI TspEI A N P S M E D M A S K L Q K L E Y Q I V L I H L W K I W L Q N C K S * N T R L F * S I Y G R Y G F K I A K V R I P D C F ----:----|----:----|----:----|----:----|----:----|----:----| A L G D I S S I A E F N C F N S Y W I T L * D M * P L Y P K L I A F T L I G S Q S I W R H F I H S * F Q L L * F V L N N CviJI |HpaII || MaeII TatI || | SetI |Csp6I || | TaiI ||RsaI || | | MaeIII TaqI |||BsrDI BccI || | | | BinI* AsuII |||| CviRI* PsrI || | | | | DdeI \ \\\\ \ \ \\ \ \ \ \ \ TCGAACGATGAGTACATTGCATTGAAAAATACGATGGAAAAGCCGGACGTTGAGTTACTA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTGCTACTCATGTAACGTAACTTTTTATGCTACCTTTTCGGCCTGCAACTCAATGAT / //// / / / / // / // AsuII |||| | PsrI BccI | || MaeII |MaeIII TaqI |||| CviRI* | |TaiI BinI* |||TatI | |SetI ||Csp6I | HpaII |RsaI CviJI BsrDI S N D E Y I A L K N T M E K P D V E L L R T M S T L H * K I R W K S R T L S Y * E R * V H C I E K Y D G K A G R * V T K ----:----|----:----|----:----|----:----|----:----|----:----| E F S S Y M A N F F V I S F G S T S N S K S R H T C Q M S F Y S P F A P R Q T V R V I L V N C Q F I R H F L R V N L * * MaeII MboI | Csp6I AluI XhoII MaeIII | |RsaI CviJI | DpnI BstEII | |SetI |MaeI | |BstKTI | SetI TspEI | |TaiI ||SetI TspEI \ \\ \ \ \ \ \\ \\\ \ AGATCCAAGTTGAAAGGTTACCATATAATTGATACAACAACGTACAATGAGCTAGTCAGC 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGGTTCAACTTTCCAATGGTATATTAACTATGTTGTTGCATGTTACTCGATCAGTCG /// / / / / / /// / / / ||| XhoII SetI BstEII TspEI | ||| | | MaeI ||| MboI MaeIII | ||| | CviJI ||DpnI | ||| | AluI |BstKTI | ||| SetI DdeI | ||Csp6I | |RsaI | MaeII TaiI SetI R S K L K G Y H I I D T T T Y N E L V S D P S * K V T I * L I Q Q R T M S * S A I Q V E R L P Y N * Y N N V Q * A S Q Q ----:----|----:----|----:----|----:----|----:----|----:----| L D L N F P * W I I S V V V Y L S S T L L I W T S L N G Y L Q Y L L T C H A L * S G L Q F T V M Y N I C C R V I L * D A MaeII | SetI CviJI TspEI | TaiI Ksp632I* | MboII SetI \ \ \ \ \ \ \ AATTTCAATTCTCCTACGTTGAAGTTTATTGAAGAGAAAGCCAAAAGCAAAGGTTATAGA 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAGTTAAGAGGATGCAACTTCAAATAACTTCTCTTTCGGTTTTCGTTTCCAATATCT / / / / / / / / TspEI | | MaeII Ksp632I* | MboII SetI | TaiI CviJI | SetI TspEI N F N S P T L K F I E E K A K S K G Y R I S I L L R * S L L K R K P K A K V I D F Q F S Y V E V Y * R E S Q K Q R L * I ----:----|----:----|----:----|----:----|----:----|----:----| L K L E G V N F N I S S F A L L L P * L C N * N E * T S T * Q L S L W F C L N Y I E I R R R Q L K N F L F G F A F T I S SetI MseI | Ksp632I* VspI SetI SetI TspDTI CviJI | |TsoI Hin4II* \ \ \ \ \ \ \\ \ TTAATAGAACCTAATGAATACCTTGACTTGAATAGGATAGCCACTACACCTTCTAAAGAA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| AATTATCTTGGATTACTTATGGAACTGAACTTATCCTATCGGTGATGTGGAAGATTTCTT / / / / / / / / / VspI SetI SetI TspDTI CviJI SetI | | Hin4II* MseI | Ksp632I* TsoI L I E P N E Y L D L N R I A T T P S K E * * N L M N T L T * I G * P L H L L K K N R T * * I P * L E * D S H Y T F * R R ----:----|----:----|----:----|----:----|----:----|----:----| N I S G L S Y R S K F L I A V V G E L S I L L V * H I G Q S S Y S L W * V K * L * Y F R I F V K V Q I P Y G S C R R F F TaqII MaeIII CviRI* | MlyI MboII | TspEI | PleI HinfI \ \ \ \ \ \ GAGATTGATAACTTCTGCAAACAAATTGGGTGTTACGCTTTGGACTCTAAAGAATATGAA 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAACTATTGAAGACGTTTGTTTAACCCACAATGCGAAACCTGAGATTTCTTATACTT / / / / /// / MboII | CviRI* TspEI ||PleI HinfI TaqII |MlyI MaeIII E I D N F C K Q I G C Y A L D S K E Y E R L I T S A N K L G V T L W T L K N M K D * * L L Q T N W V L R F G L * R I * K ----:----|----:----|----:----|----:----|----:----|----:----| S I S L K Q L C I P H * A K S E L S Y S L S Q Y S R C V F Q T N R K P S * L I H L N I V E A F L N P T V S Q V R F F I F ApoI TspEI ApoI |BplI TspEI |BplI | MnlI AciI ||TspDTI | |GsuI BisI ||| Hpy178III* | |Eco57MI |BlsI ||| | TfiI | || BplI ||TauI ||| | HinfI | || BplI ||MboII \\\ \ \ \ \\ \ \\\ AGACTAAAAAATTCTCTGGAGAATCCCTCCAAGAAATTTATAGAAGAAAATGCCGCATTA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATTTTTTAAGAGACCTCTTAGGGAGGTTCTTTAAATATCTTCTTTTACGGCGTAAT / / / / / / // //// | | | | HinfI | |TspEI |||AciI | | | | TfiI | |ApoI ||MboII | | | Hpy178III* | BplI ||BisI | | TspEI | BplI |BlsI | | ApoI Eco57MI TauI | TspDTI GsuI BplI MnlI BplI R L K N S L E N P S K K F I E E N A A L D * K I L W R I P P R N L * K K M P H Y T K K F S G E S L Q E I Y R R K C R I T ----:----|----:----|----:----|----:----|----:----|----:----| L S F F E R S F G E L F N I S S F A A N F V L F N E P S D R W S I * L L F H R M S * F I R Q L I G G L F K Y F F I G C * MboI CviRI* | DpnI Csp6I TspGWI | Cac8I | |BstKTI MaeI Hpy166II |RsaI | BsrDI | |TspDTI \ \\ \ \ \\ \ \ \ \\ CTTGATCTTGTGCTAGTGGACAAAACGGAGTACCAAGCAATGAAAGATAATGCAAGCAAC 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTAGAACACGATCACCTGTTTTGCCTCATGGTTCGTTACTTTCTATTACGTTCGTTG // / / / // / / /// || MboI | Hpy166II |Csp6I | BsrDI ||Cac8I |DpnI MaeI RsaI TspGWI |TspDTI BstKTI CviRI* L D L V L V D K T E Y Q A M K D N A S N L I L C * W T K R S T K Q * K I M Q A T * S C A S G Q N G V P S N E R * C K Q Q ----:----|----:----|----:----|----:----|----:----|----:----| S S R T S T S L V S Y W A I F S L A L L V Q D Q A L P C F P T G L L S L Y H L C K I K H * H V F R L V L C H F I I C A V StyI SecI* AluI | Hin4II* MaeIII Cac8I CviJI \ \ \ \ \ AAGAAATCACTTATTCCTTCAACCAAGGCACTTGATTTCGTTACAATGCCTGCCCCACAG 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTAGTGAATAAGGAAGTTGGTTCCGTGAACTAAAGCAATGTTACGGACGGGGTGTC / / / / /// | SecI* | Cac8I ||CviJI | StyI MaeIII ||AluI Hin4II* |Hin4I SetI K K S L I P S T K A L D F V T M P A P Q R N H L F L Q P R H L I S L Q C L P H S E I T Y S F N Q G T * F R Y N A C P T A ----:----|----:----|----:----|----:----|----:----|----:----| L F D S I G E V L A S S K T V I G A G C C S I V * E K L W P V Q N R * L A Q G V L F * K N R * G L C K I E N C H R G W L SetI Cac8I | Hin4I | | SfeI* | | | CviRI* | | | | PstI Hin4I Hpy188I \ \ \ \ \ \ \ CTTGCTTCTGCAGAGAAGTCATCACTACAAAAAAGAACTTTATCTGATATTGAAAATGAG 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGAAGACGTCTCTTCAGTAGTGATGTTTTTTCTTGAAATAGACTATAACTTTTACTC / / / / / / Cac8I | | SfeI* Hin4I Hpy188I | CviRI* PstI L A S A E K S S L Q K R T L S D I E N E L L L Q R S H H Y K K E L Y L I L K M S C F C R E V I T T K K N F I * Y * K * V ----:----|----:----|----:----|----:----|----:----|----:----| S A E A S F D D S C F L V K D S I S F S A Q K Q L S T M V V F F F K I Q Y Q F H K S R C L L * * * L F S S * R I N F I L StuI CviJI HaeIII | DdeI | SauI* | | CviJI | | | MaeII | | | | SetI BsaXI | | | | TaiI BspMI Hin4I | | | | | Hpy99I | MaeI |MfeI MseI | | | | | |TspEI SetI | |SetI |TspEI \ \ \ \ \ \ \\ \ \ \\ \\ TTAAAGGCCTTAGGCTACGTCGCAATTCGTAAAGAAAACCTGCCAAACCTAGAGAAACCA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCCGGAATCCGATGCAGCGTTAAGCATTTCTTTTGGACGGTTTGGATCTCTTTGGT / / / / // / / / / / / / | | | | || MaeII TspEI SetI SetI | | BsaXI | | | | |Hpy99I | Hin4I | | | | TaiI BspMI | | | | SetI MaeI | | | CviJI | | SauI* | | DdeI | HaeIII | CviJI | StuI MseI L K A L G Y V A I R K E N L P N L E K P * R P * A T S Q F V K K T C Q T * R N Q K G L R L R R N S * R K P A K P R E T N ----:----|----:----|----:----|----:----|----:----|----:----| N F A K P * T A I R L S F R G F R S F G T L P R L S R R L E Y L F G A L G L S V * L G * A V D C N T F F V Q W V * L F W MnlI | BsaXI TaqI | | Hin4I AsuII HindII | | Hpy178III* | ApoI Csp6I Hpy166II | | | SetI | TspEI |RsaI \ \ \ \ \ \ \ \\ ATTGTTGACAATGCCTCCAAAAATGATGTCTTGAACCTATGTTCGAAATTCAGTTTAGTA 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAACTGTTACGGAGGTTTTTACTACAGAACTTGGATACAAGCTTTAAGTCAAATCAT / / / / / / / / // | Hpy166II | Hin4I | SetI | TspEI |Csp6I | HindII | BsaXI Hpy178III* | ApoI RsaI TspEI MnlI AsuII MfeI TaqI I V D N A S K N D V L N L C S K F S L V L L T M P P K M M S * T Y V R N S V * Y C * Q C L Q K * C L E P M F E I Q F S T ----:----|----:----|----:----|----:----|----:----|----:----| I T S L A E L F S T K F R H E F N L K T L Q Q C H R W F H H R S G I N S I * N L N N V I G G F I I D Q V * T R F E T * Y AccI Eco57I |Hpy166II MboII Eco57MI MseI SspI \\ \ \ \ \ CCATTGTCTACTGAAGAATATGATAATATGAGAAAGGAACACACTAAAATCTTAAATATT 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAACAGATGACTTCTTATACTATTATACTCTTTCCTTGTGTGATTTTAGAATTTATAA // / / / / |AccI MboII Eco57MI | SspI Hpy166II Eco57I MseI P L S T E E Y D N M R K E H T K I L N I H C L L K N M I I * E R N T L K S * I F I V Y * R I * * Y E K G T H * N L K Y S ----:----|----:----|----:----|----:----|----:----|----:----| G N D V S S Y S L I L F S C V L I K F I V M T * Q L I H Y Y S F P V C * F R L Y W Q R S F F I I I H S L F V S F D * I N HphI | BccI BinI* | | Hin4II* | MboI | | | Hpy178III* | | DpnI | | | | BdaI Eco57I | | |BstKTI | | | | BdaI Eco57MI TspEI \ \ \\ \ \ \ \ \ \ \ CTCGGTGATCCATCTATTGATTTCCTGAAGGAAAAATGTGAAAAATATCAAATGCTCATA 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCCACTAGGTAGATAACTAAAGGACTTCCTTTTTACACTTTTTATAGTTTACGAGTAT / // / / // / / / | || MboI | || Hpy178III* Eco57MI BdaI | |DpnI | || BdaI Eco57I BdaI | BstKTI | || BdaI BinI* | |Hin4II* | BccI HphI L G D P S I D F L K E K C E K Y Q M L I S V I H L L I S * R K N V K N I K C S * R * S I Y * F P E G K M * K I S N A H N ----:----|----:----|----:----|----:----|----:----|----:----| R P S G D I S K R F S F H S F Y * I S M E R H D M * Q N G S P F I H F I D F A * E T I W R N I E Q L F F T F F I L H E Y BssKI EcoRII | ScrFI Hpy166II | BseBI | FatI | | CviJI BdaI | |CviAII MboII | | | ApoI BdaI | || NlaIII | CviJI | | | TspEI \ \ \\ \ \ \ \ \ \ \ ATTAGTAAACATGATTACGAAGAAAAGCAAGAAGCCATTGAAAATCCAGGCTACGAATTT 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCATTTGTACTAATGCTTCTTTTCGTTCTTCGGTAACTTTTAGGTCCGATGCTTAAA / / / // / / / / / | | | |FatI | CviJI | EcoRII TspEI | | | CviAII MboII | BssKI ApoI | | NlaIII | CviJI | Hpy166II BseBI TspEI ScrFI I S K H D Y E E K Q E A I E N P G Y E F L V N M I T K K S K K P L K I Q A T N L * * T * L R R K A R S H * K S R L R I Y ----:----|----:----|----:----|----:----|----:----|----:----| I L L C S * S S F C S A M S F G P * S N L * Y V H N R L F A L L W Q F D L S R I N T F M I V F F L L F G N F I W A V F K TspDTI | SetI | | AluI | | CviJI SfaNI | | | SetI | BsrI | | | |MboI | TspRI | | | || DpnI | | BfiI | | | || |BstKTI | | TspEI | | | || || FatI | | | MnlI | | | || || |CviAII \ \ \ \ \ \ \ \\ \\ \\ ATTTTAGAAAAAGCATCAGCACTGGGATATGAATTAGTTAGCGAGGTTGAGCTGGATCGC 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAATCTTTTTCGTAGTCGTGACCCTATACTTAATCAATCGCTCCAACTCGACCTAGCG / / / / / // / / // // TspRI | | BfiI TspEI |SetI | | || |NlaIII | SfaNI MnlI TspDTI | | || MboI BsrI | | |DpnI | | BstKTI | CviJI | AluI SetI I L E K A S A L G Y E L V S E V E L D R F * K K H Q H W D M N * L A R L S W I A F R K S I S T G I * I S * R G * A G S H ----:----|----:----|----:----|----:----|----:----|----:----| I K S F A D A S P Y S N T L S T S S S R * K L F L M L V P I H I L * R P Q A P D N * F F C * C Q S I F * N A L N L Q I A FatI TseI |BbvI CviJI |CviAII |BisI TfiI || NspI ||BlsI BinI* HinfI || CviRI* ||| AciI |NlaIII HphI TspDTI || NlaIII ||| Cac8I \\ \ \ \\ \ \\\ \ ATGAAACAAATGATTGATTCACCAGATATTGACTACATGCAAGAAAAGGCTGCCCGCAAT 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTGTTTACTAACTAAGTGGTCTATAACTGATGTACGTTCTTTTCCGACGGGCGTTA // / / / / /// //// / / |BinI* | | HinfI | ||BbvI |||| | AciI |FatI | | TfiI | |CviRI* |||| Cac8I CviAII | TspDTI | |FatI |||TseI HphI | CviAII ||BisI NlaIII |BlsI NspI CviJI M K Q M I D S P D I D Y M Q E K A A R N * N K * L I H Q I L T T C K K R L P A M E T N D * F T R Y * L H A R K G C P Q * ----:----|----:----|----:----|----:----|----:----|----:----| M F C I I S E G S I S * M C S F A A R L C S V F S Q N V L Y Q S C A L F P Q G C H F L H N I * W I N V V H L F L S G A I FauI BsrDI | BsrDI TspDTI | BseRI | | MnlI |MnlI Hin4II* | | CviRI* EcoP15I \ \ \ \\ \ \ \ \ \ GAAATGGTGTTGTTGAGGAACGAGGAGAAGGAAGCATTGCAAAAGAAAATAGAATATCCC 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACCACAACAACTCCTTGCTCCTCTTCCTTCGTAACGTTTTCTTTTATCTTATAGGG / / / / / / / / / / | | MnlI | MnlI Hin4II* | | CviRI* EcoP15I | FauI TspDTI | BseRI BsrDI BsrDI E M V L L R N E E K E A L Q K K I E Y P K W C C * G T R R R K H C K R K * N I P N G V V E E R G E G S I A K E N R I S L ----:----|----:----|----:----|----:----|----:----|----:----| S I T N N L F S S F S A N C F F I S Y G H F P T T S S R P S P L M A F S F L I D F H H Q Q P V L L L F C Q L L F Y F I G MseI | BcgI | | MnlI TseI TspDTI | | | BbvI CviJI | HindII | | | |MseI |BisI | Hpy166II | | | || TaqI ||BlsI BcgI | | TaqI \ \ \ \\ \ \\\ \ \ \ \ TCTTTAACATTTTTAATCGAAAAGGCTGCTGGAATGAACAAAATACTTGTTGACCAAATC 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATTGTAAAAATTAGCTTTTCCGACGACCTTACTTGTTTTATGAACAACTGGTTTAG // / // / //// / / / || MnlI || TaqI |||TseI BcgI | Hpy166II |MseI |BbvI ||BisI | HindII BcgI MseI |BlsI TspDTI CviJI S L T F L I E K A A G M N K I L V D Q I L * H F * S K R L L E * T K Y L L T K S F N I F N R K G C W N E Q N T C * P N R ----:----|----:----|----:----|----:----|----:----|----:----| E K V N K I S F A A P I F L I S T S W I R K L M K L R F P Q Q F S C F V Q Q G F R * C K * D F L S S S H V F Y K N V L D BccI | MslI | |Hpy188I | ||BstXI | ||| MnlI | ||| | BseGI | ||| | |AluI | ||| | |CviJI | ||| | ||MaeI | ||| | |||SetI TspDTI | ||| | |||| FokI | CviRI* | ||| | |||| |TfiI FokI | | BseGI | ||| | |||| |HinfI \ \ \ \ \ \\\ \ \\\\ \\ GAGTATGATGAAACTATAAGAAAATGCAATCATCCCACTCGGATGGAGCTAGAGGAATCC 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATACTACTTTGATATTCTTTTACGTTAGTAGGGTGAGCCTACCTCGATCTCCTTAGG / / / / // / /// / / / TaqI | | BseGI || | ||| | MaeI HinfI | CviRI* || | ||| CviJI FokI TspDTI || | ||| AluI TfiI FokI || | ||SetI || | |BseGI || | MnlI || Hpy188I || MslI |BstXI BccI E Y D E T I R K C N H P T R M E L E E S S M M K L * E N A I I P L G W S * R N P V * * N Y K K M Q S S H S D G A R G I L ----:----|----:----|----:----|----:----|----:----|----:----| S Y S S V I L F H L * G V R I S S S S D R T H H F * L F I C D D W E S P A L P I L I I F S Y S F A I M G S P H L * L F G TatI |Csp6I ||RsaI ||ScaI ||| FalI TaqI ||| FalI DdeI SetI \ \\\ \ \ \ TGTCATCACTTGAACTTGGTTTTGCTCGACCAAAACGAGTACTCAACTCTAAGAGAACCT 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGTAGTGAACTTGAACCAAAACGAGCTGGTTTTGCTCATGAGTTGAGATTCTCTTGGA / / /// / / TaqI | ||TatI | SetI | |Csp6I DdeI | ScaI | RsaI FalI FalI C H H L N L V L L D Q N E Y S T L R E P V I T * T W F C S T K T S T Q L * E N L S S L E L G F A R P K R V L N S K R T F ----:----|----:----|----:----|----:----|----:----|----:----| Q * * K F K T K S S W F S Y E V R L S G R D D S S S P K A R G F R T S L E L L V T M V Q V Q N Q E V L V L V * S * S F R MseI |TspEI |BbvII* || MseI || PacI BsrDI || | MboII | Bce83I* FalI || | | SmlI | |CviRI* TaqI FalI || | | |SetI | ||TspEI \ \ \\ \ \ \\ \ \\\ TTGGAAAATCGAAATGTTGAAGACTTAATTAACACCTTGAGCAAACTAAACTACATTGCA 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTTTAGCTTTACAACTTCTGAATTAATTGTGGAACTCGTTTGATTTGATGTAACGT / / / // / / / / / | TaqI | || SetI SmlI | | CviRI* FalI | |MseI | Bce83I* FalI | BbvII* BsrDI | MboII | TspEI PacI MseI L E N R N V E D L I N T L S K L N Y I A W K I E M L K T * L T P * A N * T T L Q G K S K C * R L N * H L E Q T K L H C N ----:----|----:----|----:----|----:----|----:----|----:----| K S F R F T S S K I L V K L L S F * M A K P F D F H Q L S L * C R S C V L S C Q Q F I S I N F V * N V G Q A F * V V N C MseI XcmI TfiI |TspEI HinfI \\ \ ATTCCTAATACTATCTACCAAGATTTAATTGGAAAGTATGAGAATCCAAACTTTGATTAT 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGATTATGATAGATGGTTCTAAATTAACCTTTCATACTCTTAGGTTTGAAACTAATA / / / / / TspEI | | TspEI HinfI | MseI TfiI XcmI I P N T I Y Q D L I G K Y E N P N F D Y F L I L S T K I * L E S M R I Q T L I I S * Y Y L P R F N W K V * E S K L * L S ----:----|----:----|----:----|----:----|----:----|----:----| I G L V I * W S K I P F Y S F G F K S * L E * Y * R G L N L Q F T H S D L S Q N N R I S D V L I * N S L I L I W V K I I MaeII | SetI | TaiI | | Hpy99I | | | XbaI TfiI | | | |MaeI BccI HinfI | | | |Hpy178III* |TspEI \ \ \ \ \\ \\ CTAAAGGATTCTTTGAACAAAATGGATTACGTCGCAATCTCTAGACAAGATTATGAATTG 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTCCTAAGAAACTTGTTTTACCTAATGCAGCGTTAGAGATCTGTTCTAATACTTAAC / // / // / / HinfI || MaeII |XbaI | TspEI TfiI |Hpy99I Hpy178III* BccI TaiI MaeI SetI L K D S L N K M D Y V A I S R Q D Y E L * R I L * T K W I T S Q S L D K I M N * K G F F E Q N G L R R N L * T R L * I D ----:----|----:----|----:----|----:----|----:----|----:----| R F S E K F L I S * T A I E L C S * S N D L P N K S C F P N R R L R * V L N H I * L I R Q V F H I V D C D R S L I I F Q BsrI Eco57I Eco57MI | MboII | | ApoI TspDTI CviJI | | TspEI Hpy188I TaqI \ \ \ \ \ \ \ ATGGTTGCTAAATACGAAAAGCCACAACTGGATTATTTGAAAATTTCTTCAGAGAAAATC 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAACGATTTATGCTTTTCGGTGTTGACCTAATAAACTTTTAAAGAAGTCTCTTTTAG / / / / / / TspDTI CviJI | MboII | Hpy188I Eco57MI TspEI Eco57I ApoI BsrI M V A K Y E K P Q L D Y L K I S S E K I W L L N T K S H N W I I * K F L Q R K S G C * I R K A T T G L F E N F F R E N R ----:----|----:----|----:----|----:----|----:----|----:----| I T A L Y S F G C S S * K F I E E S F I S P Q * I R F A V V P N N S F K K L S F H N S F V F L W L Q I I Q F N R * L F D DdeI |Hpy188I || TatI || MnlI || |Csp6I || ||TsoI MslI || ||RsaI | BseMII || ||| TspEI MaeIII | |BspCNI || ||| | MseI | TspEI BseYI \ \\ \\ \\\ \ \ \ \ \ GACCACATTGTAGTGCCTCTGTCTGAGTACAATTTAATGGTTACAAATTATAGAAATCCC 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTGTAACATCACGGAGACAGACTCATGTTAAATTACCAATGTTTAATATCTTTAGGG / / // / // /// / / / / / / TaqI | |BspCNI | || ||| | MseI | TspEI | SetI | BseMII | || ||| TspEI MaeIII GsaI MslI | || ||TatI | || |Csp6I | || RsaI | |DdeI | |TsoI | MnlI Hpy188I D H I V V P L S E Y N L M V T N Y R N P T T L * C L C L S T I * W L Q I I E I P P H C S A S V * V Q F N G Y K L * K S Q ----:----|----:----|----:----|----:----|----:----|----:----| S W M T T G R D S Y L K I T V F * L F G R G C Q L A E T Q T C N L P * L N Y F D V V N Y H R Q R L V I * H N C I I S I G AluI GsaI CviJI |SmlI ||SetI ||| AluI ||| CviJI ||| | SetI ||| | BceAI Bce83I* ||| | | MseI |CviJI MseI \\\ \ \ \ \\ \ AGCTTGAGCTACTTAAAAGAGAAAGCCGTTTTGAATAATCATATTTTAATAAAAGAAGAT 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAACTCGATGAATTTTCTCTTTCGGCAAAACTTATTAGTATAAAATTATTTTCTTCTA / /// / / / / / | ||| | MseI | CviJI MseI | ||| BceAI Bce83I* | ||CviJI | ||AluI | |SmlI | SetI BseYI CviJI AluI S L S Y L K E K A V L N N H I L I K E D A * A T * K R K P F * I I I F * * K K M L E L L K R E S R F E * S Y F N K R R * ----:----|----:----|----:----|----:----|----:----|----:----| L K L * K F S F A T K F L * I K I F S S W S S S S L L S L R K S Y D Y K L L L L A Q A V * F L F G N Q I I M N * Y F F I Hpy188I | BseGI | | Hpy188I | | |BinI* | | || Tsp4CI* | | || | MboI | | || | | DpnI | | || | | |TspRI | | || | | |BstKTI | | || | | || SetI | | || | | || | Hpy188I | | || | | || | | MnlI MboII FokI | | || | | || | | MmeI \ \ \ \ \\ \ \ \\ \ \ \ GACTATAAAAACATTTTAGCAGTATCAGAACATCCGACAGTGATCCACCTCTCCGAAAAG 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATATTTTTGTAAAATCGTCATAGTCTTGTAGGCTGTCACTAGGTGGAGAGGCTTTTC / / / / // // // // / // MboII FokI | BseGI || || || |SetI | |MnlI Hpy188I || || || MboI | MmeI || || |DpnI Hpy188I || || BstKTI || |Tsp4CI* || BinI* |TspRI Hpy188I D Y K N I L A V S E H P T V I H L S E K T I K T F * Q Y Q N I R Q * S T S P K R L * K H F S S I R T S D S D P P L R K G ----:----|----:----|----:----|----:----|----:----|----:----| S * L F M K A T D S C G V T I W R E S F H S Y F C K L L I L V D S L S G G R R F V I F V N * C Y * F M R C H D V E G F L FokI |FatI ||CviAII ||Tth111I ||| MaeIII MseI AccI ||| Tsp45I SfaNI |Hpy166II BseGI ||| |NlaIII TaqI \ \\ \ \\\ \\ \ GCATCTTTATTAAATAAAGTCTTGGTAGACAAGGATGATTTTGCGACCATGTCACGCTCG 5890 5900 5910 5920 5930 5940 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGAAATAATTTATTTCAGAACCATCTGTTCCTACTAAAACGCTGGTACAGTGCGAGC / / // / / /// / / | SfaNI |AccI BseGI | ||| | TaqI MseI Hpy166II | ||| Tsp45I | ||| MaeIII | ||FatI | |CviAII | |FokI | Tth111I NlaIII A S L L N K V L V D K D D F A T M S R S H L Y * I K S W * T R M I L R P C H A R I F I K * S L G R Q G * F C D H V T L D ----:----|----:----|----:----|----:----|----:----|----:----| A D K N F L T K T S L S S K A V M D R E P M K I L Y L R P L C P H N Q S W T V S C R * * I F D Q Y V L I I K R G H * A R Hin6I |GlaI ||HhaI |||HaeII Hin4I TaqI |||| Hin4I SpeI Hin4I ClaI DdeI |||| Hin4I |MaeI \ \ \ \\\\ \ \\ ATTGAGAAACCAACTATCGATTTCTTATCCACTAAGGCGCTATCAATGGGGAAAATACTA 5950 5960 5970 5980 5990 6000 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTCTTTGGTTGATAGCTAAAGAATAGGTGATTCCGCGATAGTTACCCCTTTTATGAT / / ///// / Hin4I ClaI ||||Hin6I MaeI Hin4I TaqI |||GlaI ||Hin4I ||Hin4I ||HhaI |HaeII DdeI I E K P T I D F L S T K A L S M G K I L L R N Q L S I S Y P L R R Y Q W G K Y * * E T N Y R F L I H * G A I N G E N T S ----:----|----:----|----:----|----:----|----:----|----:----| I S F G V I S K K D V L A S D I P F I S S Q S V L * R N R I W * P A I L P S F V N L F W S D I E * G S L R * * H P F Y * Hpy188I | TfiI | HinfI | | AlwNI | | | Hpy188I TfiI | | | |ApoI MseI HinfI TspDTI | | | |TspEI \ \ \ \ \ \ \\ GTTAATGAATCTACGCATAAAAGAAACGAGAAACTATTATCTGAACCAGATTCTGAATTT 6010 6020 6030 6040 6050 6060 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTACTTAGATGCGTATTTTCTTTGCTCTTTGATAATAGACTTGGTCTAAGACTTAAA / / / / / / // / | MseI HinfI TspDTI Hpy188I | || TspEI SpeI TfiI | || ApoI | |Hpy188I | HinfI | TfiI AlwNI V N E S T H K R N E K L L S E P D S E F L M N L R I K E T R N Y Y L N Q I L N F * * I Y A * K K R E T I I * T R F * I F ----:----|----:----|----:----|----:----|----:----|----:----| T L S D V C L L F S F S N D S G S E S N L * H I * A Y F F R S V I I Q V L N Q I N I F R R M F S V L F * * R F W I R F K CviJI TspDTI SspI |StyI | CviJI | FauI |SecI* | | TspEI Hpy188I | |Hpy188I \\ \ \ \ \ \ \\ TTGACAATGAAAGCCAAGGAGCAAGGGCTAATTATCATTTCAGAAAAGGAATATTCTGAA 6070 6080 6090 6100 6110 6120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTTACTTTCGGTTCCTCGTTCCCGATTAATAGTAAAGTCTTTTCCTTATAAGACTT / / / / / / / / / | | TspDTI CviJI TspEI Hpy188I | | FauI | SecI* | Hpy188I | StyI SspI CviJI L T M K A K E Q G L I I I S E K E Y S E * Q * K P R S K G * L S F Q K R N I L N D N E S Q G A R A N Y H F R K G I F * T ----:----|----:----|----:----|----:----|----:----|----:----| K V I F A L S C P S I I M E S F S Y E S K S L S L W P A L A L * * K L F P I N Q Q C H F G L L L P * N D N * F L F I R F AciI | MboI | | DpnI | | |BstKTI | | || BinI* | | || |MboI CviJI | | || || DpnI HaeIII | | || || |BstKTI |AciI | | || || || MaeI |BisI | | || || || | CviJI ||BlsI | | || || || | | MaeI |||TauI \ \ \\ \\ \\ \ \ \ \\\\ CTGCGGGATCAAATAGATCGTCCTAGCCTAGATGTTTTGAAAGAAAAGGCCGCCATTTTT 6130 6140 6150 6160 6170 6180 ----:----|----:----|----:----|----:----|----:----|----:----| GACGCCCTAGTTTATCTAGCAGGATCGGATCTACAAAACTTTCTTTTCCGGCGGTAAAAA / // / /// / // / //// | || MboI ||| MboI || MaeI |||AciI | |DpnI ||DpnI |CviJI ||BisI | BstKTI |BstKTI MaeI |BlsI AciI BinI* HaeIII CviJI TauI L R D Q I D R P S L D V L K E K A A I F C G I K * I V L A * M F * K K R P P F L A G S N R S S * P R C F E R K G R H F * ----:----|----:----|----:----|----:----|----:----|----:----| S R S * I S R G L R S T K F S F A A M K V A P D F L D D * G L H K S L F P R W K Q P I L Y I T R A * I N Q F F L G G N K TstI PflMI BsiYI* | BslFI | | BsrI SfaNI | | |Hpy166II \ \ \ \\ GATAGCATCATAGTAGAAAACATAGAATACCAACAACTGGTAAACACTACAAGTCCCTGC 6190 6200 6210 6220 6230 6240 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCGTAGTATCATCTTTTGTATCTTATGGTTGTTGACCATTTGTGATGTTCAGGGACG / / / / / SfaNI | | | Hpy166II | | | BslFI | | BsrI | BsiYI* | PflMI TstI D S I I V E N I E Y Q Q L V N T T S P C I A S * * K T * N T N N W * T L Q V P A * H H S R K H R I P T T G K H Y K S L P ----:----|----:----|----:----|----:----|----:----|----:----| S L M M T S F M S Y W C S T F V V L G Q Q Y C * L L F C L I G V V P L C * L D R I A D Y Y F V Y F V L L Q Y V S C T G A TstI MboII | MnlI |TspDTI TspEI TspEI \ \ \\ \ \ CCTCCCATTACTTATGAAGATTTGAAAGTATATGCCCACCAATTCGGTATGGAATTATGC 6250 6260 6270 6280 6290 6300 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGGGTAATGAATACTTCTAAACTTTCATATACGGGTGGTTAAGCCATACCTTAATACG / / / / / TstI MnlI TspDTI TspEI TspEI MboII P P I T Y E D L K V Y A H Q F G M E L C L P L L M K I * K Y M P T N S V W N Y A S H Y L * R F E S I C P P I R Y G I M P ----:----|----:----|----:----|----:----|----:----|----:----| G G M V * S S K F T Y A W W N P I S N H G E W * K H L N S L I H G G I R Y P I I R G N S I F I Q F Y I G V L E T H F * A BseMII |BspCNI || Hpy178III* || | AluI || | CviJI || | |DdeI || | |EspI* || | ||SetI || | ||| MwoI || | ||| |Cac8I || | ||| || CviRI* || | ||| || | MwoI || | ||| || | |Hin4I || | ||| || | |Hin4I || | ||| || | || Hin6I || | ||| || | || |GlaI || | ||| || | || ||HhaI || | ||| || | || ||GsuI MnlI || | ||| || | || ||Eco57MI BsgI \ \\ \ \\\ \\ \ \\ \\\ \ CTCCAAAAACCCAACAAACTTTCTGGAGCTGAGCGTGCAGAGCGCATTGATGAACAATCA 6310 6320 6330 6340 6350 6360 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTTTTTGGGTTGTTTGAAAGACCTCGACTCGCACGTCTCGCGTAACTACTTGTTAGT / // // / // /// /// / MnlI || || | || ||| ||Hin6I BsgI || || | || ||| |GlaI || || | || ||| Eco57MI || || | || ||| GsuI || || | || ||| HhaI || || | || ||CviRI* || || | || |MwoI || || | || Cac8I || || | || Hin4I || || | || Hin4I || || | |EspI* || || | |DdeI || || | MwoI || || CviJI || || AluI || |SetI || Hpy178III* |BspCNI BseMII L Q K P N K L S G A E R A E R I D E Q S S K N P T N F L E L S V Q S A L M N N Q P K T Q Q T F W S * A C R A H * * T I N ----:----|----:----|----:----|----:----|----:----|----:----| R W F G L L S E P A S R A S R M S S C D G G F V W C V K Q L Q A H L A C Q H V I E L F G V F K R S S L T C L A N I F L * TaqI | FatI | |SfaNI | |CviAII | || NspI | || NlaIII Hin4I | || EcoP15I Hin4I | || | Hpy166II | MaeIII | || | | CviRI* TspDTI | | TaqI | || | | | MaeI \ \ \ \ \ \\ \ \ \ \ ATAAATACGACCAGCAGTAACTCGACCACAACATCGAGCATGTTTACAGATGCACTAGAT 6370 6380 6390 6400 6410 6420 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTATGCTGGTCGTCATTGAGCTGGTGTTGTAGCTCGTACAAATGTCTACGTGATCTA / / / / / / //// / / | Hin4I | TaqI | | |||| | MaeI | Hin4I MaeIII | | |||| CviRI* TspDTI | | |||Hpy166II | | |||EcoP15I | | ||SfaNI | | |FatI | | CviAII | NlaIII | NspI TaqI I N T T S S N S T T T S S M F T D A L D * I R P A V T R P Q H R A C L Q M H * M K Y D Q Q * L D H N I E H V Y R C T R * ----:----|----:----|----:----|----:----|----:----|----:----| I F V V L L L E V V V D L M N V S A S S L L Y S W C Y S S W L M S C T * L H V L Y I R G A T V R G C C R A H K C I C * I AluI MboII SapI CviJI | TaqI MboII Ksp632I* | MseI | | TspEI |TspDTI | TaqI | SetI | | | CviRI* Hin4I ||FokI \ \ \ \ \ \ \ \ \ \\\ GATAATATCGAAGAGCTTAATCGTGTCGAATTGCAGAATAATGAAGATTATACTGACATA 6430 6440 6450 6460 6470 6480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATAGCTTCTCGAATTAGCACAGCTTAACGTCTTATTACTTCTAATATGACTGTAT / / / / / / / // / / | | | | | MboII | |CviRI* Hin4I TspDTI | | | | MseI | TspEI MboII | | | CviJI TaqI | | | AluI | | SetI | TaqI Ksp632I* SapI D N I E E L N R V E L Q N N E D Y T D I I I S K S L I V S N C R I M K I I L T * * Y R R A * S C R I A E * * R L Y * H N ----:----|----:----|----:----|----:----|----:----|----:----| S L I S S S L R T S N C F L S S * V S M H Y Y R L A * D H R I A S Y H L N Y Q C I I D F L K I T D F Q L I I F I I S V Y Hpy178III* | BseGI | | SfaNI | | | Hin4I | | | Tsp4CI* | | | | TspRI EcoP15I |TaqI | | | | TspDTI | AciI FauI Hpy178III* \\ \ \ \ \ \ \ \ \ \ ATCTCGAAATCATCCACAGTGAAAGATGCTACCATTTTCATTCCCGCCTATGAAAACATC 6490 6500 6510 6520 6530 6540 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGCTTTAGTAGGTGTCACTTTCTACGATGGTAAAAGTAAGGGCGGATACTTTTGTAG / // / // / / / / / / | || | || | SfaNI TspDTI | AciI FauI | || | || Tsp4CI* EcoP15I | || | |TspRI | || | Hin4I | || BseGI | |TaqI | Hpy178III* FokI I S K S S T V K D A T I F I P A Y E N I S R N H P Q * K M L P F S F P P M K T S L E I I H S E R C Y H F H S R L * K H Q ----:----|----:----|----:----|----:----|----:----|----:----| I E F D D V T F S A V M K M G A * S F M L R S I M W L S L H * W K * E R R H F C D R F * G C H F I S G N E N G G I F V D ApoI TspEI CviJI EcoRI | TspGWI TaqI | TspDTI TspEI | | TspEI AsuII \ \ \ \ \ \ \ AAGAATTCTGCTGAAAAATTAGGCTACAAATTAGTTCCGTTCGAAAAATCAAATATCAAT 6550 6560 6570 6580 6590 6600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTAAGACGACTTTTTAATCCGATGTTTAATCAAGGCAAGCTTTTTAGTTTATAGTTA // / / // / / || EcoRI | |TspGWI TspEI AsuII || TspEI | CviJI TaqI || ApoI TspEI |TspDTI Hpy178III* K N S A E K L G Y K L V P F E K S N I N R I L L K N * A T N * F R S K N Q I S I E F C * K I R L Q I S S V R K I K Y Q S ----:----|----:----|----:----|----:----|----:----|----:----| L F E A S F N P * L N T G N S F D F I L * S N Q Q F I L S C I L E T R F I L Y * L I R S F F * A V F * N R E F F * I D I AluI Hin4II* CviJI | TaqI Hpy188I | SetI | AsuII MaeI BsrI \ \ \ \ \ \ \ CTGAAAAACATTGAAGCTCCATTATTTTCGAAGGACAACGATGACACTAGCGTTGCCAGT 6610 6620 6630 6640 6650 6660 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTTTTGTAACTTCGAGGTAATAAAAGCTTCCTGTTGCTACTGTGATCGCAACGGTCA / / / / / / / / Hpy188I | CviJI | AsuII MaeI BsrI Hin4I | AluI | TaqI Hin4I SetI Hin4II* L K N I E A P L F S K D N D D T S V A S * K T L K L H Y F R R T T M T L A L P V E K H * S S I I F E G Q R * H * R C Q * ----:----|----:----|----:----|----:----|----:----|----:----| R F F M S A G N N E F S L S S V L T A L D S F C Q L E M I K S P C R H C * R Q W Q F V N F S W * K R L V V I V S A N G T Hin4I Hin4I | MboI | BglII | XhoII | | DpnI | | |BstKTI | | ||Hpy178III* | | |||BsaBI | | ||||MboI | | ||||BclI XbaI MboI | | ||||| DpnI |MaeI Hin4I BclI | | ||||| |BstKTI |Hpy178III* Hin4I Hpy188I \ \ \\\\\ \\ \\ \ \ AGCATAGATCTTGATCACTTATCTAGAAAAGCAGAAAAATATGGTATGACCCTCATTTCT 6670 6680 6690 6700 6710 6720 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTATCTAGAACTAGTGAATAGATCTTTTCGTCTTTTTATACCATACTGGGAGTAAAGA // ///// / // / // || ||||| BclI |XbaI Hin4I |MnlI || ||||| MboI | Hin4I Hpy188I || ||||DpnI Hpy178III* BdaI || |||BstKTI MaeI BdaI || ||Hpy178III* || |BsaBI || XhoII || BglII || MboI |DpnI BstKTI S I D L D H L S R K A E K Y G M T L I S A * I L I T Y L E K Q K N M V * P S F L H R S * S L I * K S R K I W Y D P H F * ----:----|----:----|----:----|----:----|----:----|----:----| L M S R S * K D L F A S F Y P I V R M E Y C L D Q D S I * F L L F I H Y S G * K A Y I K I V * R S F C F F I T H G E N R BdaI BdaI MnlI |DpnI ||BstKTI |||Hpy178III* AciI |||| ApoI BdaI FnuDII* FatI |||| TspEI MboII BdaI | MseI Hpy188I |CviAII \\\\ \ \ \ \ \ \ \\ GATCAGGAATTTGAAGAATATCATATACTAAAAGATAACGCGGTTAATCTGAATGGTGGC 6730 6740 6750 6760 6770 6780 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTCCTTAAACTTCTTATAGTATATGATTTTCTATTGCGCCAATTAGACTTACCACCG // / / / / / / / / / / || | | TspEI MboII BdaI | | | Hpy188I NlaIII || | | ApoI BdaI | | MseI || | Hpy178III* | AciI || BclI FnuDII* || MboI |DpnI BstKTI D Q E F E E Y H I L K D N A V N L N G G I R N L K N I I Y * K I T R L I * M V A S G I * R I S Y T K R * R G * S E W W H ----:----|----:----|----:----|----:----|----:----|----:----| S * S N S S Y * I S F S L A T L R F P P Q D P I Q L I D Y V L L Y R P * D S H H I L F K F F I M Y * F I V R N I Q I T A DdeI | TseI AlfI TspDTI | |BisI AlfI NlaIII MboII | Hpy188I | ||BlsI BbvI \ \ \ \ \ \\\ \ ATGGAAGAAATGAATAATCCCTTGTCAGAAAATCAAAACTTAGCAGCAAAAACCACAAAC 6790 6800 6810 6820 6830 6840 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCTTTACTTATTAGGGAACAGTCTTTTAGTTTTGAATCGTCGTTTTTGGTGTTTG // / / / / /// / / |FatI MboII | Hpy188I | ||TseI AlfI BbvI CviAII TspDTI | |BisI AlfI | BlsI DdeI M E E M N N P L S E N Q N L A A K T T N W K K * I I P C Q K I K T * Q Q K P Q T G R N E * S L V R K S K L S S K N H K H ----:----|----:----|----:----|----:----|----:----|----:----| M S S I F L G K D S F * F K A A F V V F C P L F S Y D R T L F D F S L L L F W L H F F H I I G Q * F I L V * C C F G C V Hin6I HgiCI* Hin4II* Hin4II* |AjuI | AlfI |GlaI ||SetI | AlfI ||HhaI ||NlaIV | |Tsp4CI* AjuI \\\ \\\ \ \\ \ ACAGCGCAAGAAGGTGCCTTCCAAAACACCGTTCCCCACAATGATATGGACAACGAAGAA 6850 6860 6870 6880 6890 6900 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGCGTTCTTCCACGGAAGGTTTTGTGGCAAGGGGTGTTACTATACCTGTTGCTTCTT //// / / / / // / / |||| | | | HgiCI* || Tsp4CI* AjuI |||| | | NlaIV |AlfI |||| | SetI |AlfI |||| AjuI Hin4II* |||Hin6I ||GlaI |HhaI Hin4II* T A Q E G A F Q N T V P H N D M D N E E Q R K K V P S K T P F P T M I W T T K K S A R R C L P K H R S P Q * Y G Q R R S ----:----|----:----|----:----|----:----|----:----|----:----| V A C S P A K W F V T G W L S I S L S S C L A L L H R G F C R E G C H Y P C R L C R L F T G E L V G N G V I I H V V F F MboII | AsuI* | |BmgT120I | ||CviJI | ||HaeIII SmlI | |||BinI* | Hpy178III* | |||HpaII | | AciI | |||| MboI | | | NspBII* | |||| | DpnI FokI | | | | Cac8I | |||| | |BseGI Bce83I* | | | | | MboI TaqI | |||| | |BstKTI | Tsp4CI* | |MmeI | | | FauI \ \ \\\\ \ \\ \ \ \ \\ \ \ \ \ GTCGAATATGGGCCGGATGATCCAACATTCACAGTAAGGCAACTCAAGAAACCCGCTGGC 6910 6920 6930 6940 6950 6960 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTTATACCCGGCCTACTAGGTTGTAAGTGTCATTCCGTTGAGTTCTTTGGGCGACCG / / //// // / / / / / / / | MboII |||| || | | Tsp4CI* | | | Cac8I TaqI |||| || | | FokI | | NspBII* |||| || | Bce83I* | | AciI |||| || MboI | Hpy178III* |||| |DpnI | SmlI |||| BstKTI MmeI |||| BseGI |||HpaII ||BinI* |AsuI* BmgT120I HaeIII CviJI V E Y G P D D P T F T V R Q L K K P A G S N M G R M I Q H S Q * G N S R N P L A R I W A G * S N I H S K A T Q E T R W R ----:----|----:----|----:----|----:----|----:----|----:----| T S Y P G S S G V N V T L C S L F G A P L R I H A P H D L M * L L A V * S V R Q D F I P R I I W C E C Y P L E L F G S A DpnI |PvuI |McrI* Tsp4CI* |BstKTI SpeI | TspRI || TspEI |MaeI | | Hpy178III* \\ \ \\ \ \ \ GATCGTAATTTGATTTTGACTAGTAGGGAGAAAACACTGTTATCAAGAGATGATAATATA 6970 6980 6990 7000 7010 7020 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCATTAAACTAAAACTGATCATCCCTCTTTTGTGACAATAGTTCTCTACTATTATAT // / / // / / / || MboI TspEI |SpeI | Tsp4CI* Hpy178III* |FauI MaeI TspRI |DpnI BstKTI McrI* PvuI D R N L I L T S R E K T L L S R D D N I I V I * F * L V G R K H C Y Q E M I I * S * F D F D * * G E N T V I K R * * Y N ----:----|----:----|----:----|----:----|----:----|----:----| S R L K I K V L L S F V S N D L S S L I R D Y N S K S * Y P S F V T I L L H Y Y I T I Q N Q S T P L F C Q * * S I I I Y PleI HphI |MlyI | Hpy188I || AciI | | AluI HinfI || | Hin4I MaeIII | | CviJI Hin4I | MnlI || | Hin4I Tsp45I | | | SetI Hin4I CviJI \ \ \\ \ \ \ \ \ \ \ \ \ ATGAGTCAAAATGAGGCGGTTTATGGTGACGATATATCTGATAGCTTTGTAGATGAAAGC 7030 7040 7050 7060 7070 7080 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAGTTTTACTCCGCCAAATACCACTGCTATATAGACTATCGAAACATCTACTTTCG // / / / / / / / / / / |HinfI | | AciI | | | | | Hin4I CviJI MnlI | Hin4I | | | | | Hin4I | Hin4I | | | | CviJI PleI | | | | AluI MlyI | | | SetI | | Hpy188I | HphI Tsp45I MaeIII M S Q N E A V Y G D D I S D S F V D E S * V K M R R F M V T I Y L I A L * M K A E S K * G G L W * R Y I * * L C R * K P ----:----|----:----|----:----|----:----|----:----|----:----| I L * F S A T * P S S I D S L K T S S L L S D F H P P K H H R Y I Q Y S Q L H F H T L I L R N I T V I Y R I A K Y I F A AccI Bce83I* AluI |Hpy166II CviJI TspDTI || MseI SmlI | SetI TspDTI \ \\ \ \ \ \ \ CAAGAAATCAAAAATGATGTAGACATTATTAAAACTCAAGCTATGAAATATGGTATGTTG 7090 7100 7110 7120 7130 7140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTAGTTTTTACTACATCTGTAATAATTTTGAGTTCGATACTTTATACCATACAAC / / // / /// / TspDTI | |AccI MseI ||CviJI TspDTI | Hpy166II ||AluI Bce83I* |SmlI SetI Q E I K N D V D I I K T Q A M K Y G M L K K S K M M * T L L K L K L * N M V C C R N Q K * C R H Y * N S S Y E I W Y V V ----:----|----:----|----:----|----:----|----:----|----:----| W S I L F S T S M I L V * A I F Y P I N G L F * F H H L C * * F E L * S I H Y T L F D F I I Y V N N F S L S H F I T H Q CviRI* |Bce83I* || NdeI || |MwoI SmlI Hpy178III* || |BstAPI |SduI | TaqII || || SfaNI |HgiAI* | | TspEI || || CviRI* ||Hpy178III* \ \ \ \\ \\ \ \\\ TGTATTCCTGAAAGTAATTTTGTGGGTGCATCATATGCAAGTGCTCAAGATATGAGCGAT 7150 7160 7170 7180 7190 7200 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAAGGACTTTCATTAAAACACCCACGTAGTATACGTTCACGAGTTCTATACTCGCTA / / / // / / / / / | TaqII TspEI || | | | HgiAI* Hpy178III* Hpy178III* || | | | SfaNI SmlI || | | | SduI || | | CviRI* || | NdeI || BstAPI || MwoI |CviRI* Bce83I* C I P E S N F V G A S Y A S A Q D M S D V F L K V I L W V H H M Q V L K I * A I Y S * K * F C G C I I C K C S R Y E R Y ----:----|----:----|----:----|----:----|----:----|----:----| H I G S L L K T P A D Y A L A * S I L S T Y E Q F Y N Q P H M M H L H E L Y S R T N R F T I K H T C * I C T S L I H A I FatI |CviAII || BbvII* AciI MaeIII || |NlaIII HgaI | FnuDII* HphI Tsp45I SetI || || MboII \ \ \ \ \ \ \\ \\ \ ATAGTTGTGCTTTCCGCGTCCTATTACCATAATCTAATGTCACCTGAAGACATGAAATGG 7210 7220 7230 7240 7250 7260 ----:----|----:----|----:----|----:----|----:----|----:----| TATCAACACGAAAGGCGCAGGATAATGGTATTAGATTACAGTGGACTTCTGTACTTTACC / / / / / / // / HgaI FnuDII* HphI | Tsp45I | || BbvII* AciI | MaeIII | || MboII SetI | |FatI | CviAII NlaIII I V V L S A S Y Y H N L M S P E D M K W * L C F P R P I T I I * C H L K T * N G S C A F R V L L P * S N V T * R H E M E ----:----|----:----|----:----|----:----|----:----|----:----| I T T S E A D * * W L R I D G S S M F H Y L Q A K R T R N G Y D L T V Q L C S I Y N H K G R G I V M I * H * R F V H F P AciI CviJI MboII |NlaIV Tsp4CI* |TspDTI ||SduI |Eco57I || GsuI ||HgiJII* |Eco57MI || Eco57MI |||Hpy178III* || TspDTI TspEI || |MseI |||| CviRI* \\ \ \ \\ \\ \\\\ \ AACTGTGTTAGTAATGAAGAATTACAAGCGGAAGTTAAAAAGCGTGGGCTCCAGATTGCA 7270 7280 7290 7300 7310 7320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACACAATCATTACTTCTTAATGTTCGCCTTCAATTTTTCGCACCCGAGGTCTAACGT / / / / / / / / // / / | TspDTI | | | | MseI | || | CviRI* Eco57MI | | | Eco57MI | || Hpy178III* Tsp4CI* | | | GsuI | |NlaIV Eco57I | | AciI | CviJI | TspDTI HgiJII* | MboII SduI TspEI N C V S N E E L Q A E V K K R G L Q I A T V L V M K N Y K R K L K S V G S R L H L C * * * R I T S G S * K A W A P D C T ----:----|----:----|----:----|----:----|----:----|----:----| F Q T L L S S N C A S T L F R P S W I A S S H * Y H L I V L P L * F A H A G S Q V T N T I F F * L R F N F L T P E L N C FokI |MboII || SetI || | CviJI || | |SecI* || | |DsaI* || | || BseGI || | || | Hin4I || | || | | FatI || | || | | |SfaNI || | || | | |CviAII || | || | | || NlaIII || | || | | || |MslI || | || | | || |BceAI \\ \ \\ \ \ \\ \\ CTAACAACAAAGGAAGATAAGAAAGGTCAAGCCACGGCATCCAAACATGAGTATGTGTCG 7330 7340 7350 7360 7370 7380 ----:----|----:----|----:----|----:----|----:----|----:----| GATTGTTGTTTCCTTCTATTCTTTCCAGTTCGGTGCCGTAGGTTTGTACTCATACACAGC // / / // / /// / || | | |DsaI* | ||| BceAI || | | |SecI* | ||SfaNI || | | BseGI | ||MslI || | | Hin4I | |FatI || | CviJI | CviAII || FokI NlaIII |MboII SetI L T T K E D K K G Q A T A S K H E Y V S * Q Q R K I R K V K P R H P N M S M C R N N K G R * E R S S H G I Q T * V C V A ----:----|----:----|----:----|----:----|----:----|----:----| S V V F S S L F P * A V A D L C S Y T D V L L L P L Y S L D L W P M W V H T H T * C C L F I L F T L G R C G F M L I H R AluI CviJI | SetI Tsp4CI* | | Hin4I | Hpy166II Hpy178III* \ \ \ \ \ \ CATAAGCTAAACAATAAAACATCTACTGTGTCCACAAAGTCTGGAGCAAAAAAGGGACTT 7390 7400 7410 7420 7430 7440 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTCGATTTGTTATTTTGTAGATGACACAGGTGTTTCAGACCTCGTTTTTTCCCTGAA / // / / / / | |Hin4I | Hpy166II Hpy178III* Eco57MI | CviJI Tsp4CI* GsuI | AluI SetI H K L N N K T S T V S T K S G A K K G L I S * T I K H L L C P Q S L E Q K R D L * A K Q * N I Y C V H K V W S K K G T C ----:----|----:----|----:----|----:----|----:----|----:----| C L S F L L V D V T D V F D P A F F P S A Y A L C Y F M * Q T W L T Q L L F P V M L * V I F C R S H G C L R S C F L S K CviRI* |GsuI |Eco57MI || TseI FokI || MwoI | TfiI || |BisI | HinfI || |BslFI | | Hpy188I || ||BlsI MwoI | | | EcoP15I || |||TseI BbvI | | | | MboII BcgI || ||||BisI BstAPI | | | | |TspDTI |SapI || |||||BlsI | BbvI | | | | ||BseGI |Ksp632I* \\ \\\\\\ \ \ \ \ \ \ \\\ \\ GCAGAAGCAGCAGCAACAACTGCTTATGAAGATTCCGAAAGTCATCCACAAATAGAAGAG 7450 7460 7470 7480 7490 7500 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTCGTCGTCGTTGTTGACGAATACTTCTAAGGCTTTCAGTAGGTGTTTATCTTCTC / / ////// / / / /// // / / | | |||||| BstAPI | BbvI ||| || BcgI Ksp632I* | | |||||| MwoI BbvI ||| |EcoP15I SapI | | |||||TseI ||| |BseGI | | ||||BslFI ||| TspDTI | | ||||BisI ||| MboII | | |||BlsI ||Hpy188I | | ||TseI |HinfI | | |BisI |TfiI | | BlsI FokI | MwoI CviRI* A E A A A T T A Y E D S E S H P Q I E E Q K Q Q Q Q L L M K I P K V I H K * K S R S S S N N C L * R F R K S S T N R R A ----:----|----:----|----:----|----:----|----:----|----:----| A S A A A V V A * S S E S L * G C I S S Q L L L L L L Q K H L N R F D D V F L L C F C C C C S S I F I G F T M W L Y F L MaeII | SetI | TaiI | |HindII | |Hpy166II | || HinfI | || | AlwNI | || | | Hpy188I | || | | |ApoI | || | | |TspEI MboII | || | | |EcoRI |BsmAI | || | | || PleI || Csp6I | || | | || |MlyI || |RsaI BcgI | || | | || || TspEI \\ \\ \ \ \\ \ \ \\ \\ \ CAGTCTCATCGTACTAATCATCATAAGCACCATAAACGTCAACAGAGTCTGAATTCTAAT 7510 7520 7530 7540 7550 7560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAGAGTAGCATGATTAGTAGTATTCGTGGTATTTGCAGTTGTCTCAGACTTAAGATTA / // / / / / / // // MboII |Csp6I BcgI | | | | || |EcoRI BsmAI | | | | || |TspEI RsaI | | | | || |ApoI | | | | || PleI | | | | || MlyI | | | | |Hpy188I | | | | HinfI | | | AlwNI | | Hpy166II | | HindII | MaeII TaiI SetI Q S H R T N H H K H H K R Q Q S L N S N S L I V L I I I S T I N V N R V * I L I V S S Y * S S * A P * T S T E S E F * F ----:----|----:----|----:----|----:----|----:----|----:----| C D * R V L * * L C W L R * C L R F E L A T E D Y * D D Y A G Y V D V S D S N * L R M T S I M M L V M F T L L T Q I R I Cac8I | XbaI SetI | |MaeI | TspDTI | |Hpy178III* | | MnlI MnlI TaqI | || SfaNI \ \ \ \ \ \ \\ \ TCAACCTCAAAAACCACACATTCATCGAGGAATACGCCAGCATCTAGACGAGATATAGTA 7570 7580 7590 7600 7610 7620 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGGAGTTTTTGGTGTGTAAGTAGCTCCTTATGCGGTCGTAGATCTGCTCTATATCAT / / / / / / / // / | SetI | MnlI MnlI TaqI Cac8I |XbaI SfaNI TspEI TspDTI Hpy178III* MaeI S T S K T T H S S R N T P A S R R D I V Q P Q K P H I H R G I R Q H L D E I * * N L K N H T F I E E Y A S I * T R Y S S ----:----|----:----|----:----|----:----|----:----|----:----| E V E F V V C E D L F V G A D L R S I T N L R L F W V N M S S Y A L M * V L Y L * G * F G C M * R P I R W C R S S I Y Y SfaNI |MaeIII |Tsp45I || MaeII || |PmaCI || |BsaAI || || SetI || || TaiI || || |CviRI* || || || MboI || || || XhoII || || || | DpnI || || || | |MwoI || || || | |AlwNI || || || | |BstKTI || || || | |BstAPI || || || | || BsrI SfaNI || || || | || |BinI* BsgI | BceAI \\ \\ \\ \ \\ \\ \ \ \ GCATCATTTATGTCACGTGCAGGATCTGCCAGTAGGACGGCATCTTTACAAACTTTAGCA 7630 7640 7650 7660 7670 7680 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGTAAATACAGTGCACGTCCTAGACGGTCATCCTGCCGTAGAAATGTTTGAAATCGT / // / /// // / / / / | || | ||| || | BsgI | BceAI | || | ||| || BinI* SfaNI | || | ||| |BsrI | || | ||| XhoII | || | ||| MboI | || | ||DpnI | || | |BstKTI | || | BstAPI | || | AlwNI | || | MwoI | || CviRI* | |MaeII | Tsp45I | MaeIII | BsaAI | PmaCI SfaNI TaiI SetI A S F M S R A G S A S R T A S L Q T L A H H L C H V Q D L P V G R H L Y K L * H I I Y V T C R I C Q * D G I F T N F S I ----:----|----:----|----:----|----:----|----:----|----:----| A D N I D R A P D A L L V A D K C V K A L M M * T V H L I Q W Y S P M K V F K L C * K H * T C S R G T P R C R * L S * C AciI | FnuDII* | | MseI | | |HpaI | | |HindII Tsp4CI* | | |Hpy166II |XcmI SfaNI | | ||FauI || BsiYI* SspI \ \ \ \\\ \\ \ \ TCATTGAACGAACCAAGCATAATACCCGCGTTAACCCAAACCGTCATTGGGGAATATTTG 7690 7700 7710 7720 7730 7740 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAACTTGCTTGGTTCGTATTATGGGCGCAATTGGGTTTGGCAGTAACCCCTTATAAAC / / // / // / / SfaNI | || FauI || BsiYI* SspI | |MseI |XcmI | Hpy166II Tsp4CI* | HindII | HpaI FnuDII* AciI S L N E P S I I P A L T Q T V I G E Y L H * T N Q A * Y P R * P K P S L G N I C I E R T K H N T R V N P N R H W G I F V ----:----|----:----|----:----|----:----|----:----|----:----| D N F S G L M I G A N V W V T M P S Y K M M S R V L C L V R T L G F R * Q P I N * Q V F W A Y Y G R * G L G D N P F I Q TfiI HinfI | TaqI | AsuII | BslFI | |BsaBI | ||TfiI | ||HinfI | ||| MaeII | ||| |BtrI | ||| || FatI | ||| || SetI | ||| || TaiI | ||| || BspHI BsiYI* | ||| || |CviAII | AsuI* | ||| || |Hpy178III* | AvaII | ||| || || MboII | DraII | ||| || || |NlaIII | PpuMI | ||| || || || FokI | |NlaIV | ||| || || || TfiI | |BmgT120I | ||| || || || HinfI MseI | || SetI | ||| || || || | TspDTI \ \ \\ \ \ \\\ \\ \\ \\ \ \ TTTAAGTATTATCCACGCTTGGGACCTTTTGGATTCGAATCACGTCATGAAAGATTCTTC 7750 7760 7770 7780 7790 7800 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTCATAATAGGTGCGAACCCTGGAAAACCTAAGCTTAGTGCAGTACTTTCTAAGAAG / / /// /// /// /// /// / // / MseI BsiYI* ||PpuMI ||| ||| ||| ||| | || TspDTI ||DraII ||| ||| ||| ||| | |FokI ||AvaII ||| ||| ||| ||| | HinfI ||AsuI* ||| ||| ||| ||| | TfiI |BmgT120I ||| ||| ||| ||| TspDTI NlaIV ||| ||| ||| ||BspHI SetI ||| ||| ||| ||FatI ||| ||| ||| |Hpy178III* ||| ||| ||| |CviAII ||| ||| ||| MboII ||| ||| ||NlaIII ||| ||| |MaeII ||| ||| BtrI ||| ||TaiI ||| ||SetI ||| |HinfI ||| |TfiI ||| BslFI ||AsuII ||TaqI |BsaBI HinfI TfiI F K Y Y P R L G P F G F E S R H E R F F L S I I H A W D L L D S N H V M K D S S * V L S T L G T F W I R I T S * K I L L ----:----|----:----|----:----|----:----|----:----|----:----| N L Y * G R K P G K P N S D R * S L N K T * T N D V S P V K Q I R I V D H F I R K L I I W A Q S R K S E F * T M F S E E TatI |Csp6I ||RsaI ||| AsuI* ||| AvaII BseGI ||| |BmgT120I | MaeI ||| ||FokI | | BccI TspDTI MseI ||| ||BsrI | | | TfiI | BseGI SetI ||| |||AciI | | | HinfI \ \ \ \\\ \\\\ \ \ \ \ TGGGTTCATCCATATACCTTAACTTTGTACTGGTCCGCTTCTAATCCCATCCTAGAGAAT 7810 7820 7830 7840 7850 7860 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCAAGTAGGTATATGGAATTGAAACATGACCAGGCGAAGATTAGGGTAGGATCTCTTA / / / /// / // // / / / / BseGI SetI MseI ||| | || |FokI BseGI | | HinfI ||| | || AciI | | TfiI ||| | |AvaII | BccI ||| | |AsuI* MaeI ||| | BmgT120I ||| BsrI ||TatI |Csp6I RsaI W V H P Y T L T L Y W S A S N P I L E N G F I H I P * L C T G P L L I P S * R I G S S I Y L N F V L V R F * S H P R E S ----:----|----:----|----:----|----:----|----:----|----:----| Q T * G Y V K V K Y Q D A E L G M R S F R P E D M Y R L K T S T R K * D W G L S P N M W I G * S Q V P G S R I G D * L I MaeIII SetI MaeI Tsp45I \ \ \ CCTGCCAATACCAAAACAAAAGGTGTTGCCATTCTAGGAGTAGAAAGTGTCACAGACCCA 7870 7880 7890 7900 7910 7920 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGGTTATGGTTTTGTTTTCCACAACGGTAAGATCCTCATCTTTCACAGTGTCTGGGT / / / SetI MaeI Tsp45I MaeIII P A N T K T K G V A I L G V E S V T D P L P I P K Q K V L P F * E * K V S Q T Q C Q Y Q N K R C C H S R S R K C H R P K ----:----|----:----|----:----|----:----|----:----|----:----| G A L V L V F P T A M R P T S L T V S G D Q W Y W F L L H Q W E L L L F H * L G R G I G F C F T N G N * S Y F T D C V W MmeI MaeIII MaeI \ \ \ AACCCATATCCAACAGGATTGTATCACAAAAGTATTGTTGTTACCACAGAAACTAGGACT 7930 7940 7950 7960 7970 7980 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGTATAGGTTGTCCTAACATAGTGTTTTCATAACAACAATGGTGTCTTTGATCCTGA / / / MmeI MaeIII MaeI N P Y P T G L Y H K S I V V T T E T R T T H I Q Q D C I T K V L L L P Q K L G L P I S N R I V S Q K Y C C Y H R N * D Y ----:----|----:----|----:----|----:----|----:----|----:----| F G Y G V P N Y * L L I T T V V S V L V L G M D L L I T D C F Y Q Q * W L F * S V W I W C S Q I V F T N N N G C F S P S MaeII SspI | SetI MseI Hpy166II | TspDTI TspEI | TaiI \ \ \ \ \ \ \ ATTAAGTTTACTTGTCCTACAAGGCAAAGACACAATATTTGGTATAATTCATTACGTTAT 7990 8000 8010 8020 8030 8040 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTCAAATGAACAGGATGTTCCGTTTCTGTGTTATAAACCATATTAAGTAATGCAATA / / / / / / | Hpy166II TspDTI | | MaeII MseI SspI | TaiI | SetI TspEI I K F T C P T R Q R H N I W Y N S L R Y L S L L V L Q G K D T I F G I I H Y V I * V Y L S Y K A K T Q Y L V * F I T L F ----:----|----:----|----:----|----:----|----:----|----:----| I L N V Q G V L C L C L I Q Y L E N R * * * T * K D * L A F V C Y K T Y N M V N N L K S T R C P L S V I N P I I * * T I FatI |CviAII || NspI || CviRI* BinI* || NlaIII | MboI || | BtgZI | | DpnI || | | MnlI | | |BstKTI \\ \ \ \ \ \ \\ TTACTTCAAAGGAACATGCAAGGGATAAGTTTAGAGGACATCGCTGATGATCCAACAGAT 8050 8060 8070 8080 8090 8100 ----:----|----:----|----:----|----:----|----:----|----:----| AATGAAGTTTCCTTGTACGTTCCCTATTCAAATCTCCTGTAGCGACTACTAGGTTGTCTA / // / / / // / | |CviRI* | BtgZI | || MboI | |FatI MnlI | |DpnI | CviAII | BstKTI NlaIII BinI* NspI L L Q R N M Q G I S L E D I A D D P T D Y F K G T C K G * V * R T S L M I Q Q I T S K E H A R D K F R G H R * * S N R * ----:----|----:----|----:----|----:----|----:----|----:----| K S * L F M C P I L K S S M A S S G V S N V E F S C A L S L N L P C R Q H D L L * K L P V H L P Y T * L V D S I I W C I AluI BsrDI CviJI | BssKI Ecl136II | |BsiYI* | SetI | ||HpaII | SduI | ||ScrFI | SacI | ||CauII* | HgiAI* Hpy178III* | ||| GsuI | HgiJII* | MmeI | ||| Eco57MI | |BsrI \ \ \ \\\ \ \ \\ AATATGTATTCAGGAAAGATTTTCCCATTGCCCGGCGAAAATACAAAGAGCTCCAGTAAA 8110 8120 8130 8140 8150 8160 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACATAAGTCCTTTCTAAAAGGGTAACGGGCCGCTTTTATGTTTCTCGAGGTCATTT // / / /// / // |MmeI | | ||BssKI | |BsrI | | | |Eco57MI | Ecl136II | | | |HpaII | CviJI | | | |GsuI | AluI | | | CauII* HgiJII* | | | ScrFI HgiAI* | | BsiYI* SacI | BsrDI SduI Hpy178III* SetI N M Y S G K I F P L P G E N T K S S S K I C I Q E R F S H C P A K I Q R A P V K Y V F R K D F P I A R R K Y K E L Q * K ----:----|----:----|----:----|----:----|----:----|----:----| L I Y E P F I K G N G P S F V F L E L L Y Y T N L F S K G M A R R F Y L S S W Y I H I * S L N E W Q G A F I C L A G T F DdeI | Hin6I | |GlaI | ||HhaI | |||Hin4II* | ||||TspGWI | |||||TaqI | ||||||Hpy178III* | ||||||| SfaNI | ||||||| |AsuI* SetI | ||||||| |AvaII | DdeI | ||||||| ||BmgT120I | |BsmAI Csp6I | ||||||| |||SetI | |Eco31I |RsaI \ \\\\\\\ \\\\ \ \\ \\ AGACTTAGCGCATCGAGAAGGTCCGTATCTACAAGGTCTCTAAGACATAGAGTACCACAA 8170 8180 8190 8200 8210 8220 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGAATCGCGTAGCTCTTCCAGGCATAGATGTTCCAGAGATTCTGTATCTCATGGTGTT //// // / // / / / // |||| || | |SfaNI SetI | Eco31I |Csp6I |||| || | |AvaII | BsmAI RsaI |||| || | |AsuI* DdeI |||| || | BmgT120I |||| || SetI |||| |Hpy178III* |||| TaqI |||Hin4II* |||TspGWI |||Hin6I ||GlaI |HhaI DdeI R L S A S R R S V S T R S L R H R V P Q D L A H R E G P Y L Q G L * D I E Y H K T * R I E K V R I Y K V S K T * S T T K ----:----|----:----|----:----|----:----|----:----|----:----| L S L A D L L D T D V L D R L C L T G C F V * R M S F T R I * L T E L V Y L V V S K A C R S P G Y R C P R * S M S Y W L CviJI | MboI | | DpnI | | |BstKTI TspEI \ \ \\ \ AGCCGATCATTTGGCAATTTACGATAG 8230 8240 ----:----|----:----|----:-- TCGGCTAGTAAACCGTTAAATGCTATC / // / / | || MboI TspEI | |DpnI | BstKTI CviJI S R S F G N L R * A D H L A I Y D X P I I W Q F T I X ----:----|----:----|----:-- L R D N P L K R Y F G I M Q C N V I A S * K A I * S L # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 14 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AjuI 3 AlfI 2 AluI 20 AluBI AlwNI 3 CaiI ApoI 27 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 6 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BaeI 13 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 13 BpiI,BpuAI,BstV2I,BbsI BccI 30 Bce83I* 8 BpuEI BceAI 6 BcgI 2 BciVI 11 BfuI BclI 2 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BfiI 3 BmrI,BmuI BglII 2 BinI* 9 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmgT120I 7 BplI 2 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaBI 7 Bse8I,BseJI BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 13 BstF5I,BtsCI BseMII 7 BseRI 4 BseYI 1 BsgI 2 BsiYI* 17 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 7 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 6 BseMI,Bse3DI BsrI 16 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 3 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 30 BstXI 2 BtgZI 1 BtrI 2 BmgBI,AjiI BtsI 1 Cac8I 8 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 3 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CviAII 25 CviJI 79 CviKI-1 CviRI* 49 HpyCH4V DdeI 22 BstDEI,HpyF3I DpnI 30 MalI DraII 2 EcoO109I DraIII 5 AdeI DsaI* 1 BtgI,BstDSI Ecl136II 2 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 6 AcuI Eco57MI 12 EcoP15I 5 EcoRI 15 EcoRII 3 AjnI,Psp6I,PspGI Esp3I 1 BsmBI EspI* 2 Bpu1102I,Bsp1720I,CelII,BlpI FalI 6 FatI 25 FauI 5 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 13 GlaI 4 GsaI 1 GsuI 6 BpmI HaeII 1 BstH2I HaeIII 21 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 4 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 17 Hin4II* 26 HpyAV Hin6I 4 HinP1I,HspAI HindII 4 HincII HindIII 2 HinfI 31 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 17 AsuHPI Hpy166II 13 Hpy8I Hpy178III* 49 Hpy188III Hpy188I 55 Hpy99I 2 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 69 FspBI,BfaI,XspI MaeII 12 HpyCH4IV MaeIII 16 MboI 30 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 40 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 4 SchI MmeI 16 MnlI 32 MseI 41 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 25 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 14 BstNSI,XceI PacI 1 PflMI 13 BasI,AccB7I,Van91I PleI 4 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PsrI 1 PstI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 12 AfaI SacI 2 Psp124BI,SstI SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 15 BseDI,BssECI,BsaJI SetI 82 SfaNI 15 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 8 SmoI SpeI 6 BcuI,AhlI SspI 8 StuI 1 Eco147I,PceI,SseBI,AatI StyI 14 Eco130I,EcoT14I,ErhI,BssT1I TaiI 12 TaqI 33 TaqII 2 TatI 6 TauI 3 TfiI 27 PfeI TseI 5 ApeKI TsoI 7 Tsp45I 6 NmuCI Tsp4CI* 21 HpyCH4III,TaaI,Bst4CI TspDTI 40 TspEI 83 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 17 TscAI TstI 2 Tth111I 10 PflFI,PsyI,AspI VspI 3 PshBI,AseI XbaI 4 XcmI 2 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI BbvCI BglI BmeT110I BmtI BsePI BseSI BsiI* Bsp120I Bsp1407I BspLU11I* BspOI BsrBI BssNAI Bst1107I BstZ17I Cfr10I Cfr9I CfrI CspCI DinI DrdI Eam1105I EciI Eco47III EcoNI EcoRV EcoT22I EgeI EheI FseI FspAI KasI KpnI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PasI PfoI PmeI PpiI PshAI PspOMI PspXI PvuII RsrII SacII SalI SanDI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769