Restriction Map of FIN1/YDR130C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

FIN1/YDR130C on chromosome IV from coordinates 716622 to 715747.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.20734

EMBOSS_001 Hpy166II | MaeII | |BsaAI MwoI | |MaeIII | TstI | |Tsp45I | BsaXI | || SetI BsaXI | | AciI | || TaiI | TstI TaqI \ \ \ \ \\ \ \ \ \ ATGAGCAATAAAAGCAACCGCAGGAGTTTACGTGACATAGGGAATACGATTGGTCGAAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGTTATTTTCGTTGGCGTCCTCAAATGCACTGTATCCCTTATGCTAACCAGCTTTA / / / / // // / / / | | BsaXI AciI || || | BsaXI TaqI | TstI || || | TstI MwoI || || Tsp45I || || MaeIII || |MaeII || BsaAI |TaiI |SetI Hpy166II M S N K S N R R S L R D I G N T I G R N * A I K A T A G V Y V T * G I R L V E I E Q * K Q P Q E F T * H R E Y D W S K * ----:----|----:----|----:----|----:----|----:----|----:----| X L L L L L R L L K R S M P F V I P R F X S C Y F C G C S N V H C L S Y S Q D F H A I F A V A P T * T V Y P I R N T S I MaeIII Tsp45I Tth111I BslFI MnlI BsiYI* \ \ \ \ \ AATATACCAAGTGACAAGGACAATGTCTTTGTGAGATTGAGTATGTCCCCTTTGAGGACG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATATGGTTCACTGTTCCTGTTACAGAAACACTCTAACTCATACAGGGGAAACTCCTGC / / / / / Tsp45I Tth111I BslFI | BsiYI* MaeIII MnlI N I P S D K D N V F V R L S M S P L R T I Y Q V T R T M S L * D * V C P L * G R Y T K * Q G Q C L C E I E Y V P F E D D ----:----|----:----|----:----|----:----|----:----|----:----| L I G L S L S L T K T L N L I D G K L V Y Y V L H C P C H R Q S I S Y T G K S S I Y W T V L V I D K H S Q T H G R Q P R MnlI | SetI SetI CviJI | | HphI EcoRV | BccI \ \ \ \ \ \ \ ACAAGCCAAAAAGAGTTTTTGAAACCACCTATGAGGATATCACCTAACAAGACAGATGGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCGGTTTTTCTCAAAAACTTTGGTGGATACTCCTATAGTGGATTGTTCTGTCTACCT / // / / / / CviJI |SetI HphI | SetI BccI MnlI EcoRV T S Q K E F L K P P M R I S P N K T D G Q A K K S F * N H L * G Y H L T R Q M E K P K R V F E T T Y E D I T * Q D R W N ----:----|----:----|----:----|----:----|----:----|----:----| V L W F S N K F G G I L I D G L L V S P S L G F L T K S V V * S S I V * C S L H C A L F L K Q F W R H P Y * R V L C I S AccI |BssNAI |Hpy166II HpaII || TspDTI | Hin4II* || | MaeIII | | Hpy188I || | | Hin4II* | | | CviJI \\ \ \ \ \ \ \ \ ATGAAGCATAGTATACAAGTAACACCAAGAAGGATTATGTCGCCGGAATGTCTGAAGGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCGTATCATATGTTCATTGTGGTTCTTCCTAATACAGCGGCCTTACAGACTTCCCG // // / / / / |TspDTI |MaeIII | | | CviJI |AccI Hin4II* | | Hpy188I Hpy166II | Hin4II* BssNAI HpaII M K H S I Q V T P R R I M S P E C L K G * S I V Y K * H Q E G L C R R N V * R A E A * Y T S N T K K D Y V A G M S E G L ----:----|----:----|----:----|----:----|----:----|----:----| I F C L I C T V G L L I I D G S H R F P F S A Y Y V L L V L F S * T A P I D S P H L M T Y L Y C W S P N H R R F T Q L A MnlI |ApoI BssKI |TspEI DdeI CviJI StuI || BspCNI |BsmAI EcoRII CviJI || |TaqI || Eco57I | ScrFI HaeIII || |AsuII || Eco57MI | BseBI | DdeI || |BseMII BinI* \\ \ \ \ \ \ \\ \\ \ TATGTCTCTAAGGAAACTCAAAGCCTGGATAGGCCTCAGTTCAAAAATTCGAATAAAAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATACAGAGATTCCTTTGAGTTTCGGACCTATCCGGAGTCAAGTTTTTAAGCTTATTTTTA / / / / / / / / // / / | BsmAI | | | | DdeI | || | AsuII Eco57MI | | | HaeIII | || | TaqI Eco57I | | | CviJI | || TspEI DdeI | | | StuI | || ApoI | | EcoRII | |BseMII | | BssKI | BspCNI | BseBI MnlI | ScrFI CviJI Y V S K E T Q S L D R P Q F K N S N K N M S L R K L K A W I G L S S K I R I K M C L * G N S K P G * A S V Q K F E * K C ----:----|----:----|----:----|----:----|----:----|----:----| * T E L S V * L R S L G * N L F E F L F S H R * P F E F G P Y A E T * F N S Y F I D R L F S L A Q I P R L E F I R I F I DdeI MboII MboI | MboI XhoII | Hpy188I | DpnI | | DpnI BspCNI SspI | |BstKTI | | |BstKTI |BseMII | HphI AjuI \ \\ \ \ \\ \\ \ \ \ GTGAAGATCCAAAACTCAGATCATATAACTAATATAATATTCCCTACATCACCAACCAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTCTAGGTTTTGAGTCTAGTATATTGATTATATTATAAGGGATGTAGTGGTTGGTTT / // / / //// / // / / / | || | | |||| | |BseMII | | AjuI | || | | |||| | BspCNI | HphI | || | | |||| MboI SspI | || | | |||DpnI | || | | ||BstKTI | || | | |DdeI | || | | Hpy188I | || | MboII | || XhoII | || MboI | |DpnI | BstKTI BinI* V K I Q N S D H I T N I I F P T S P T K * R S K T Q I I * L I * Y S L H H Q P N E D P K L R S Y N * Y N I P Y I T N Q T ----:----|----:----|----:----|----:----|----:----|----:----| T F I W F E S * I V L I I N G V D G V L H S S G F S L D Y L * Y L I G * M V L W H L D L V * I M Y S I Y Y E R C * W G F AsuI* Bsp120I |AsuI* |BmgT120I ||BssKI ||CviJI ||NlaIV ||HaeIII ||BmgT120I ||| ApaI ||| SduI MseI ||| HpaII HphI ||| ScrFI |HpaI ||| BseSI BccI |HindII ||| CauII* AjuI |TspDTI |Hpy166II ||| HgiJII* \ \\ \\ \\\ \ CTGACATTCAGTAATGAAAATAAAATCGGGGGTGATGGTTCGTTAACGAGAATACGGGCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGTAAGTCATTACTTTTATTTTAGCCCCCACTACCAAGCAATTGCTCTTATGCCCGG / / / / // / /// AjuI | BccI | |MseI | ||Bsp120I TspDTI | Hpy166II | ||AsuI* | HindII | |BmgT120I | HpaI | |AsuI* HphI | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI L T F S N E N K I G G D G S L T R I R A * H S V M K I K S G V M V R * R E Y G P D I Q * * K * N R G * W F V N E N T G P ----:----|----:----|----:----|----:----|----:----|----:----| S V N L L S F L I P P S P E N V L I R A V S M * Y H F Y F R P H H N T L S F V P Q C E T I F I F D P T I T R * R S Y P G HphI TseI HinfI |BisI | FatI ||BlsI | |PshAI ||| BsaXI | |CviAII ||| |MwoI | || MaeIII ||| || TseI | || Tsp45I ||| || MwoI MseI | || |NlaIII ||| || |BisI | MlyI | || || BciVI ||| || ||BlsI BbvI | PleI | || || |SetI ||| || |||BbvI SfaNI \ \ \ \\ \\ \\ \\\ \\ \\\\ \ CGGTTTAAGAATGGACTCATGTCACCTGAAAGGATACAGCAGCAACAGCAGCAACATATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GCCAAATTCTTACCTGAGTACAGTGGACTTTCCTATGTCGTCGTTGTCGTCGTTGTATAA /// /// / // // / / /// / /// / ||| ||| | || || | Tsp45I ||| | ||| BbvI ||| ||| | || || | MaeIII ||| | ||TseI ||| ||| | || || | BciVI ||| | |BisI ||| ||| | || || SetI ||| | BlsI ||| ||| | || |FatI ||| MwoI ||| ||| | || CviAII ||MwoI ||| ||| | |PshAI ||TseI ||| ||| | NlaIII |BsaXI ||| ||| | HinfI |BisI ||| ||| HphI BlsI ||| ||PleI ||| |MlyI ||| MseI ||BssKI |HpaII CauII* ScrFI R F K N G L M S P E R I Q Q Q Q Q Q H I G L R M D S C H L K G Y S S N S S N I F V * E W T H V T * K D T A A T A A T Y S ----:----|----:----|----:----|----:----|----:----|----:----| R N L F P S M D G S L I C C C C C C C I G T * S H V * T V Q F S V A A V A A V Y P K L I S E H * R F P Y L L L L L L M N TspRI | SetI | | Bce83I* | | |BseMII | | ||BspCNI | | ||| MnlI | | ||| | DdeI | | ||| | | AluI | | ||| | | CviJI | | ||| | | Ecl136II EcoP15I | | ||| | | |SmlI | Hpy188I | | ||| | | ||SetI | | BccI | | ||| | | ||SduI | | | BsaXI | | ||| | | ||SacI | | | |BseGI | | ||| | | ||HgiAI* | | | ||EcoP15I | | ||| | | ||HgiJII* | | | ||| FokI | | ||| | | ||| AcyI \ \ \ \\\ \ \ \ \\\ \ \ \\\ \ CTCCCATCGGATGCCAAAAGCAACACTGACCTCTGTTCTAATACTGAGCTCAAGGACGCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGGTAGCCTACGGTTTTCGTTGTGACTGGAGACAAGATTATGACTCGAGTTCCTGCGG / // / / / / / / /// / /// / / | || | | | | | | ||| MnlI ||| SmlI AcyI | || | | | | | | ||BspCNI ||Ecl136II | || | | | | | | |BseMII ||CviJI | || | | | | | | Bce83I* ||AluI | || | | | | | SetI |DdeI | || | | | | FokI HgiJII* | || | | | TspRI HgiAI* | || | | EcoP15I SacI | || | BseGI SduI | || | BccI SetI | || BsaXI | |EcoP15I | Hpy188I SfaNI BbvI L P S D A K S N T D L C S N T E L K D A S H R M P K A T L T S V L I L S S R T P P I G C Q K Q H * P L F * Y * A Q G R P ----:----|----:----|----:----|----:----|----:----|----:----| R G D S A L L L V S R Q E L V S S L S A E G M P H W F C C Q G R N * Y Q A * P R E W R I G F A V S V E T R I S L E L V G SetI | AvaI | XhoI | SmlI | PspXI | |TaqI | |BmeT110I | || AluI | || CviJI | || Hin4II* | || | SetI ApoI | || | |TspEI TspEI SmlI HgaI | || | ||MnlI |Bce83I* MboII | Hpy178III* \ \ \\ \ \\\ \\ \ \ \ CCATTTGAGAATGACCTTCCTCGAGCTAAATTGAAAGGGAAGAATTTATTAGTTGAACTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAAACTCTTACTGGAAGGAGCTCGATTTAACTTTCCCTTCTTAAATAATCAACTTGAG / / /// / / / / / | SetI ||| | TspEI | | MboII HgaI ||| MnlI | TspEI ||CviJI | ApoI ||AluI Bce83I* |Hin4II* |PspXI |SmlI |XhoI |AvaI BmeT110I TaqI SetI P F E N D L P R A K L K G K N L L V E L H L R M T F L E L N * K G R I Y * L N S I * E * P S S S * I E R E E F I S * T Q ----:----|----:----|----:----|----:----|----:----|----:----| G N S F S R G R A L N F P F F K N T S S G M Q S H G E E L * I S L S S N I L Q V W K L I V K R S S F Q F P L I * * N F E MaeII |BtrI ||MboII |||SetI |||TaiI Ksp632I* |||BbvII* TfiI |MnlI |||| MboII HinfI TaqI \\ \\\\ \ \ \ AAGAAAGAAGAGGAAGACGTGGGAAATGGCATAGAATCCCTTACTAAATCGAACACTAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTCTTCTCCTTCTGCACCCTTTACCGTATCTTAGGGAATGATTTAGCTTGTGATTT / / / // / / / | Ksp632I* | || BbvII* HinfI TaqI Hpy178III* | || MboII TfiI SmlI | |MaeII MnlI | MboII | BtrI TaiI SetI K K E E E D V G N G I E S L T K S N T K R K K R K T W E M A * N P L L N R T L N E R R G R R G K W H R I P Y * I E H * T ----:----|----:----|----:----|----:----|----:----|----:----| L F S S S S T P F P M S D R V L D F V L * S L L P L R P F H C L I G * * I S C * L F F L F V H S I A Y F G K S F R V S F ApoI TspEI EcoRI | FatI AluI | |CviAII CviJI | || NlaIII |MaeI | || | BarI ||SetI | || | Cac8I ||| BarI | || | | Hin4II* SetI ||| | Hpy178III* \ \\ \ \ \ \ \\\ \ \ CTGAATTCCATGCTGGCGAACGAAGGTAAGATACACAAAGCTAGTTTCCAGAAAAGTGTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTAAGGTACGACCGCTTGCTTCCATTCTATGTGTTTCGATCAAAGGTCTTTTCACAT /// // // / / // / / ||| || |Hin4II* SetI | || MaeI Hpy178III* ||| || Cac8I | |BarI ||| |FatI | CviJI ||| CviAII | AluI ||BarI SetI |NlaIII EcoRI TspEI ApoI L N S M L A N E G K I H K A S F Q K S V * I P C W R T K V R Y T K L V S R K V * E F H A G E R R * D T Q S * F P E K C K ----:----|----:----|----:----|----:----|----:----|----:----| S F E M S A F S P L I C L A L K W F L T V S N W A P S R L Y S V C L * N G S F H Q I G H Q R V F T L Y V F S T E L F T Y SecI* DsaI* |Tsp4CI* ApoI || MboII TspEI || | MseI | MseI MaeIII || | | Eco57I | |AhaIII* SetI Tsp45I || | | Eco57MI \ \\ \ \ \\ \ \ \ AAATTTAAACTACCTGATAATATAGTGACTGAAGAAACCGTGGAACTTAAAGAAATAAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAATTTGATGGACTATTATATCACTGACTTCTTTGGCACCTTGAATTTCTTTATTTC /// / / / / // ||| SetI Tsp45I | MboII |MseI ||MseI MaeIII | DsaI* Eco57MI |AhaIII* | SecI* Eco57I TspEI Tsp4CI* ApoI K F K L P D N I V T E E T V E L K E I K N L N Y L I I * * L K K P W N L K K * R I * T T * * Y S D * R N R G T * R N K G ----:----|----:----|----:----|----:----|----:----|----:----| F N L S G S L I T V S S V T S S L S I F L I * V V Q Y Y L S Q L F R P V * L F L F K F * R I I Y H S F F G H F K F F Y L Hin4I | BbvII* | | MboII | | | TfiI | | | HinfI | | | | Hpy178III* | | | | | PpiI | | | | | | Hin4I | | | | | | | TaqI \ \ \ \ \ \ \ \ GACTTGCTACTACAAATGTTGAGAAGACAGCGAGAGATTGAATCAAGATTATCCAATATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACGATGATGTTTACAACTCTTCTGTCGCTCTCTAACTTAGTTCTAATAGGTTATAG / / / / / / Hin4I BbvII* | | | Hin4I MboII | | PpiI | Hpy178III* HinfI TfiI D L L L Q M L R R Q R E I E S R L S N I T C Y Y K C * E D S E R L N Q D Y P I S L A T T N V E K T A R D * I K I I Q Y R ----:----|----:----|----:----|----:----|----:----|----:----| S K S S C I N L L C R S I S D L N D L I P S A V V F T S F V A L S Q I L I I W Y V Q * * L H Q S S L S L N F * S * G I D PpiI | TspGWI \ \ GAACTTCAACTCACGGAAATACCGAAACATAAGTAA 850 860 870 ----:----|----:----|----:----|----:- CTTGAAGTTGAGTGCCTTTATGGCTTTGTATTCATT / / / TaqI PpiI TspGWI E L Q L T E I P K H K * N F N S R K Y R N I S X T S T H G N T E T * V X ----:----|----:----|----:----|----:- S S * S V S I G F C L Y R V E V * P F V S V Y T F K L E R F Y R F M L L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AjuI 1 AluI 3 AluBI ApaI 1 ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BciVI 1 BfuI BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 3 BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 2 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CviAII 2 CviJI 8 CviKI-1 DdeI 4 BstDEI,HpyF3I DpnI 2 MalI DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 2 EcoP15I 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 2 FokI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 1 Hin4II* 4 HpyAV HindII 1 HincII HinfI 3 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 5 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MlyI 1 SchI MnlI 6 MseI 4 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PleI 1 PpsI PpiI 1 PshAI 1 BstPAI,BoxI PspXI 1 SacI 1 Psp124BI,SstI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 12 SfaNI 1 LweI SmlI 3 SmoI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 2 TaqI 5 TfiI 2 PfeI TseI 2 ApeKI Tsp45I 4 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AlfI AloI AlwNI ApaLI AscI Asp718I AvaII AvrII BaeI BalI BamHI BbvCI BceAI BcgI BclI BdaI BetI* BfiI BglI BglII BmtI BplI Bpu10I BsaBI BsePI BseRI BseYI BsgI BsiI* BsmI Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BstAPI BstEII BstXI BtgZI BtsI Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI CviRI* DinI DraII DraIII DrdI Eam1105I EciI Eco31I Eco47III EcoNI EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiCI* HhaI Hin6I HindIII HinP1I Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PsiI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacII SalI SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StyI SwaI TaqII TatI TauI TsoI TspMI VspI XbaI XcmI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769