Restriction Map of TMN2/YDR107C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TMN2/YDR107C on chromosome IV from coordinates 671034 to 669016.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26529

EMBOSS_001 SetI CviRI* | TspDTI | MseI \ \ \ \ ATGAAACGAGGTGTTTGGTTGCTGATTTATTGCTATGCAACTTTAACTAAAGGATTTTCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTGCTCCACAAACCAACGACTAAATAACGATACGTTGAAATTGATTTCCTAAAAGG / / / / SetI TspDTI CviRI* MseI M K R G V W L L I Y C Y A T L T K G F S * N E V F G C * F I A M Q L * L K D F P E T R C L V A D L L L C N F N * R I F L ----:----|----:----|----:----|----:----|----:----|----:----| X F R P T Q N S I * Q * A V K V L P N E X S V L H K T A S K N S H L K L * L I K H F S T N P Q Q N I A I C S * S F S K G BspCNI |BseMII || AciI || | BtgZI BssKI || | |BsiYI* EcoRII || | || FauI | ScrFI || | || TspDTI | BseBI || | || | Hpy166II | | StuI || | || | | MlyI | | CviJI || | || | | PleI | | HaeIII DdeI || | || | | AciI \ \ \ \ \\ \ \\ \ \ \ TTGCCAGGCCTATCTCCCACAACATATCACTCAGGCGATGAAATCCCGCTATTGGTGAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTCCGGATAGAGGGTGTTGTATAGTGAGTCCGCTACTTTAGGGCGATAACCACTTG / / / // / / // / / | EcoRII DdeI || | | || | MlyI | HaeIII || | | || Hpy166II | BssKI || | | |FauI | CviJI || | | BtgZI | StuI || | TspDTI BseBI || BsiYI* ScrFI || AciI |BseMII BspCNI L P G L S P T T Y H S G D E I P L L V N C Q A Y L P Q H I T Q A M K S R Y W * T A R P I S H N I S L R R * N P A I G E P ----:----|----:----|----:----|----:----|----:----|----:----| K G P R D G V V Y * E P S S I G S N T F R A L G I E W L M D S L R H F G A I P S Q W A * R G C C I V * A I F D R * Q H V MnlI |Hpy178III* ||MslI HphI TspEI ||| Hin4II* MaeIII HinfI | BccI ||| | SfaNI | SetI \ \ \ \\\ \ \ \ \ CGCTTGACTCCATCAATTTACTTTCAGCATCAAGATGAGGAAGGTAACGATGTTTCAGGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCGAACTGAGGTAGTTAAATGAAAGTCGTAGTTCTACTCCTTCCATTGCTACAAAGTCCG // / / // / // // / || | HinfI |BccI | || |SetI MaeIII || HphI TspEI | || SfaNI |AciI | |Hpy178III* PleI | |Hin4II* | MslI MnlI R L T P S I Y F Q H Q D E E G N D V S G A * L H Q F T F S I K M R K V T M F Q A L D S I N L L S A S R * G R * R C F R R ----:----|----:----|----:----|----:----|----:----|----:----| R K V G D I * K * C * S S S P L S T E P G S S E M L K S E A D L H P L Y R H K L A Q S W * N V K L M L I L F T V I N * A MnlI AccI XmnI | TspDTI SetI |Hpy166II \ \ \ \ \\ GATAAAGAACATTTTCTTTACTCCTATGATTACTATAATAAGAGGTTTCATTTTTGTAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTCTTGTAAAAGAAATGAGGATACTAATGATATTATTCTCCAAAGTAAAAACATCT / // / // XmnI |TspDTI SetI |AccI MnlI Hpy166II D K E H F L Y S Y D Y Y N K R F H F C R I K N I F F T P M I T I I R G F I F V D * R T F S L L L * L L * * E V S F L * T ----:----|----:----|----:----|----:----|----:----|----:----| S L S C K R * E * S * * L L L N * K Q L R Y L V N E K S R H N S Y Y S T E N K Y I F F M K K V G I I V I I L P K M K T S SduI MaeII HgiAI* | SetI | TaiI | | BseMII | | |BspCNI | | || CviJI PleI | | || | DdeI |MlyI MaeIII ApoI | | || | | HinfI || SetI Tsp45I TspEI \ \ \\ \ \ \ \\ \ \ \ CCAGAGCACGTTGAGAAACAGCCTGAGTCGTTAGGTTCAGTCATATTTGGTGACAGAATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTCGTGCAACTCTTTGTCGGACTCAGCAATCCAAGTCAGTATAAACCACTGTCTTAA / / / // / / / / / / / | | | |BspCNI | | | | PleI | TspEI | | | BseMII | | | | MlyI | HphI | | MaeII | | | SetI | ApoI | TaiI | | HinfI Tsp45I | SetI | DdeI MaeIII HgiAI* CviJI SduI P E H V E K Q P E S L G S V I F G D R I Q S T L R N S L S R * V Q S Y L V T E F R A R * E T A * V V R F S H I W * Q N L ----:----|----:----|----:----|----:----|----:----|----:----| G S C T S F C G S D N P E T M N P S L I V L A R Q S V A Q T T L N L * I Q H C F W L V N L F L R L R * T * D Y K T V S N FatI AflIII BspLU11I* |MnlI |CviAII ||TstI BseRI ||BsaXI | CviRI* HphI MfeI ||| NspI | | BsaXI | TspEI TspEI ||| NlaIII | | | TstI \ \ \ \\\ \ \ \ \ \ TACAATTCCCCATTCCAATTGAACATGTTAGAGGAGAAAGAGTGTGTTGCACTTTGTAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTAAGGGGTAAGGTTAACTTGTACAATCTCCTCTTTCTCACACAACGTGAAACATTT / / // // / / / TspEI | || |BspLU11I* | | BsaXI | || |AflIII | | TstI | || |FatI | CviRI* | || CviAII BseRI | |NlaIII | |NspI | |MnlI | BsaXI TspEI MfeI TstI Y N S P F Q L N M L E E K E C V A L C K T I P H S N * T C * R R K S V L H F V K Q F P I P I E H V R G E R V C C T L * K ----:----|----:----|----:----|----:----|----:----|----:----| * L E G N W N F M N S S F S H T A S Q L K C N G M G I S C T L P S L T H Q V K Y V I G W E L Q V H * L L F L T N C K T F TfiI HinfI | PfoI | SfaNI | BssKI | |HpaII | ||ScrFI ApoI | ||CauII* TspEI MseI \ \\\ \ \ AGCACGATTCCGGGAAAAGATGCCAAATTTATCAACACCCTTATTAAAAGTGGATTTTTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGCTAAGGCCCTTTTCTACGGTTTAAATAGTTGTGGGAATAATTTTCACCTAAAAAG / /// / / | ||BssKI TspEI MseI | ||PfoI ApoI | |SfaNI | CauII* | HpaII | ScrFI HinfI TfiI S T I P G K D A K F I N T L I K S G F F A R F R E K M P N L S T P L L K V D F S H D S G K R C Q I Y Q H P Y * K W I F P ----:----|----:----|----:----|----:----|----:----|----:----| L V I G P F S A L N I L V R I L L P N K F C S E P F L H W I * * C G * * F H I K A R N R S F I G F K D V G K N F T S K E BseGI | FalI | FalI | | Cac8I CviJI | | | TseI |BccI | | | FokI MwoI FalI |BsrI | | | |BisI | BbvI FalI |BsiI* | | | ||BlsI | CviJI EcoP15I \\ \ \ \ \\\ \ \ \ CAAAACTGGCTCGTGGATGGATTGCCAGCAGCAAGAAAGGCTTATGATAGCAGAACAAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGACCGAGCACCTACCTAACGGTCGTCGTTCTTTCCGAATACTATCGTCTTGTTTT // / / / / //// / / / / / || | | BseGI | |||| MwoI | BbvI FalI EcoP15I || | | FalI | |||FokI CviJI FalI || | | FalI | ||TseI || | BsiI* | |BisI || BccI | BlsI |CviJI Cac8I BsrI Q N W L V D G L P A A R K A Y D S R T K K T G S W M D C Q Q Q E R L M I A E Q K K L A R G W I A S S K K G L * * Q N K N ----:----|----:----|----:----|----:----|----:----|----:----| W F Q S T S P N G A A L F A * S L L V F G F S A R P H I A L L L F P K H Y C F L L V P E H I S Q W C C S L S I I A S C F Tsp4CI* | HindII BceAI SetI MseI | Hpy166II \ \ \ \ \ ACAAACTATTACGGCACAGGATTTGAGTTAGGTTTTACAGATGTTAAGCAAACCGTTGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTGATAATGCCGTGTCCTAAACTCAATCCAAAATGTCTACAATTCGTTTGGCAACTG / / / / / BceAI MseI | | Tsp4CI* SetI | Hpy166II | HindII Tsp4CI* T N Y Y G T G F E L G F T D V K Q T V D Q T I T A Q D L S * V L Q M L S K P L T K L L R H R I * V R F Y R C * A N R * R ----:----|----:----|----:----|----:----|----:----|----:----| V F * * P V P N S N P K V S T L C V T S F L S N R C L I Q T L N * L H * A F R Q C V I V A C S K L * T K C I N L L G N V AluI BsrI CviJI |BccI | SetI || Csp6I | |MnlI || |RsaI | || MboII || || SapI | || | Hpy188I || || Eco57I | || | | StuI || || Eco57MI | || | | CviJI MnlI Tsp4CI* || || Ksp632I* | || | | HaeIII | SfaNI | BfiI || || |BstXI | || | | | MnlI | | BseGI \ \ \\ \\ \\ \ \\ \ \ \ \ \ \ \ GGTAAAGCAGTTCCCAGTACGATGGAAGAGCTTACTTCAGAGGCCTCAAATGAGGATGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTTCGTCAAGGGTCATGCTACCTTCTCGAATGAAGTCTCCGGAGTTTACTCCTACAA / / //// / / / / / / // / / BfiI | |||| | | | | | | |MnlI MnlI BseGI | |||| | | | | | | HaeIII | |||| | | | | | | CviJI | |||| | | | | | | StuI | |||| | | | | | Hpy188I | |||| | | | | MboII | |||| | | | MnlI | |||| | | CviJI | |||| | | AluI | |||| | SetI | |||| Ksp632I* | |||| SapI | |||Csp6I | ||Eco57MI | ||Eco57I | ||RsaI | |BstXI | BccI BsrI G K A V P S T M E E L T S E A S N E D V V K Q F P V R W K S L L Q R P Q M R M L * S S S Q Y D G R A Y F R G L K * G C Y ----:----|----:----|----:----|----:----|----:----|----:----| P L A T G L V I S S S V E S A E F S S T R Y L L E W Y S P L A * K L P R L H P H T F C N G T R H F L K S * L G * I L I N MseI TaqI | CviJI Tsp4CI* FokI BseGI FokI | | TspEI MseI | TspEI \ \ \ \ \ \ \ \ \ ATATTGGATGCTCGACTGCCCAAGAATGTTAAGCCTAATTTAGTTAAAACGGTAGAATTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TATAACCTACGAGCTGACGGGTTCTTACAATTCGGATTAAATCAATTTTGCCATCTTAAT / // / / / / / / / / SfaNI || TaqI FokI | CviJI TspEI | Tsp4CI* TspEI |FokI MseI MseI SetI BseGI I L D A R L P K N V K P N L V K T V E L Y W M L D C P R M L S L I * L K R * N Y I G C S T A Q E C * A * F S * N G R I T ----:----|----:----|----:----|----:----|----:----|----:----| I N S A R S G L F T L G L K T L V T S N * I P H E V A W S H * A * N L * F P L I Y Q I S S Q G L I N L R I * N F R Y F * Hpy178III* | MboI | | DpnI | | OliI | | MslI | | |PvuI ApoI | | |McrI* SetI MslI TspEI | | |BstKTI TspEI \ \ \ \ \ \\ \ CCTTACTTTGTAAATCATTTTGACATTGAAGTGGAATTTCACGATCGTGGAAACGATAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGAATGAAACATTTAGTAAAACTGTAACTTCACCTTAAAGTGCTAGCACCTTTGCTATTA / / /// / MslI | ||| MboI | ||MslI | ||OliI | ||DpnI | |BstKTI | |McrI* | |PvuI | Hpy178III* TspEI ApoI P Y F V N H F D I E V E F H D R G N D N L T L * I I L T L K W N F T I V E T I I L L C K S F * H * S G I S R S W K R * L ----:----|----:----|----:----|----:----|----:----|----:----| G * K T F * K S M S T S N * S R P F S L V K S Q L D N Q C Q L P I E R D H F R Y R V K Y I M K V N F H F K V I T S V I I TaqI | HphI | | MboI | | | DpnI | | | |BstKTI | | | ||MaeIII | | | ||Tsp45I | | | ||| BssKI | | | ||| EcoRII | | | ||| | ScrFI | | | ||| | BseBI | | | ||| | |SetI | | | ||| | || Hin6I | | | ||| | || |GlaI | | | ||| | || ||HhaI Hpy166II | | | ||| | || ||FnuDII* \ \ \ \ \\\ \ \\ \\\ TACCGAGTTGTTGGTGTCATTGTAAACCCTGTATCTATCGAAAGATCGTCACCTGGCGCG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGCTCAACAACCACAGTAACATTTGGGACATAGATAGCTTTCTAGCAGTGGACCGCGC / / / // / / / / /// TspEI Hpy166II | || | | | | ||FnuDII* | || | | | | ||Hin6I | || | | | | |GlaI | || | | | | EcoRII | || | | | | BssKI | || | | | | HhaI | || | | | BseBI | || | | | ScrFI | || | | Tsp45I | || | | MaeIII | || | SetI | || MboI | |DpnI | BstKTI TaqI HphI Y R V V G V I V N P V S I E R S S P G A T E L L V S L * T L Y L S K D R H L A R P S C W C H C K P C I Y R K I V T W R V ----:----|----:----|----:----|----:----|----:----|----:----| * R T T P T M T F G T D I S L D D G P A N G L Q Q H * Q L G Q I * R F I T V Q R V S N N T D N Y V R Y R D F S R * R A R SetI | Hpy188I | | MnlI | | |MaeI SetI | | ||MnlI MnlI |Hpy166II \ \ \\\ \ \\ TGTTCTACAACGGGAAAACCTCTGATACTAGACGAGGATAAGGATAACGAGGTTTACTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGATGTTGCCCTTTTGGAGACTATGATCTGCTCCTATTCCTATTGCTCCAAATGAAG / / / / / / / / SetI | | | MaeI MnlI SetI Hpy166II | | MnlI | MnlI Hpy188I C S T T G K P L I L D E D K D N E V Y F V L Q R E N L * Y * T R I R I T R F T S F Y N G K T S D T R R G * G * R G L L H ----:----|----:----|----:----|----:----|----:----|----:----| H E V V P F G R I S S S S L S L S T * K T N * L P F V E S V L R P Y P Y R P K S T R C R S F R Q Y * V L I L I V L N V E Hpy188I | MnlI | Tsp4CI* MseI | | TspRI | ApoI | | | CviJI | TspEI | | | |BccI BsaBI \ \ \ \ \ \\ \ ACTTATTCTGTTAAATTTGTTGCCTCTGATACAGTGTGGGCTACGAGATGGGATAAGTAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATAAGACAATTTAAACAACGGAGACTATGTCACACCCGATGCTCTACCCTATTCATA / / / / / / / / | TspEI | | Tsp4CI* | BccI BsaBI | ApoI | | MnlI CviJI MseI | TspRI Hpy188I T Y S V K F V A S D T V W A T R W D K Y L I L L N L L P L I Q C G L R D G I S I L F C * I C C L * Y S V G Y E M G * V S ----:----|----:----|----:----|----:----|----:----|----:----| V * E T L N T A E S V T H A V L H S L Y * K N Q * I Q Q R Q Y L T P * S I P Y T S I R N F K N G R I C H P S R S P I L I MseI VspI | TspGWI | | ApoI BaeI FauI | | TspEI MslI | AciI TspDTI | | | BaeI \ \ \ \ \ \ \ \ CTACATATTTATGACCCGCAGATACAATGGTTTTCATTAATAAATTTTTCCGTTATTGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTATAAATACTGGGCGTCTATGTTACCAAAAGTAATTATTTAAAAAGGCAATAACAA / / / / / / / / MslI | | FauI | | BaeI TspEI BaeI | TspDTI | VspI ApoI AciI | MseI TspGWI L H I Y D P Q I Q W F S L I N F S V I V Y I F M T R R Y N G F H * * I F P L L L T Y L * P A D T M V F I N K F F R Y C Y ----:----|----:----|----:----|----:----|----:----|----:----| R C I * S G C I C H N E N I F K E T I T D V Y K H G A S V I T K M L L N K R * Q * M N I V R L Y L P K * * Y I K G N N N BsmI MboI CviRI* | DpnI | EcoT22I CviJI | |BstKTI \ \ \ \ \\ ATTTTGTTGTCATCTGTTGTAATGCATTCTCTATTACGGGCTTTGAAAAGCGATCTCGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAACAACAGTAGACAACATTACGTAAGAGATAATGCCCGAAACTTTTCGCTAGAGCGA / / / // / | CviRI* CviJI || MboI EcoT22I |DpnI BsmI BstKTI I L L S S V V M H S L L R A L K S D L A F C C H L L * C I L Y Y G L * K A I S L F V V I C C N A F S I T G F E K R S R S ----:----|----:----|----:----|----:----|----:----|----:----| I K N D D T T I C E R N R A K F L S R A * K T T M Q Q L A N E I V P K S F R D R N Q Q * R N Y H M R * * P S Q F A I E S ApoI TspEI EcoRI | FatI | |CviAII | || NlaIII | || | TfiI | || | XcmI | || | HinfI | || | |TspDTI | || | || CviJI | || | || | MboII | || | || | |TspDTI | || | || | || TspEI | || | || | || | AsuI* | || | || | || | |BmgT120I | || | || | || | ||CviJI | || | || | || | ||HaeIII | || | || | || | |||FatI | || | || | || | |||NcoI | || | || | || | |||StyI | || | || | || | |||SecI* PsiI | || | || | || | |||DsaI* \ \ \\ \ \\ \ \\ \ \\\\ CGTTATAACGAACTAAACTTGGATAATGAATTCCATGAAGATTCTGGCTGGAAATTGGGC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GCAATATTGCTTGATTTGAACCTATTACTTAAGGTACTTCTAAGACCGACCTTTAACCCG / // // / / // / // PsiI || || | | |TspDTI | |NlaIII || || | | |MboII | |AsuI* || || | | CviJI | BmgT120I || || | HinfI | HaeIII || || | TfiI | CviJI || || TspDTI TspEI || || XcmI || |FatI || CviAII |NlaIII EcoRI TspEI ApoI R Y N E L N L D N E F H E D S G W K L G V I T N * T W I M N S M K I L A G N W A L * R T K L G * * I P * R F W L E I G P ----:----|----:----|----:----|----:----|----:----|----:----| R * L S S F K S L S N W S S E P Q F N P E N Y R V L S P Y H I G H L N Q S S I P T I V F * V Q I I F E M F I R A P F Q A MslI |BinI* ||BstXI ||| MboI CviAII ||| BamHI | MaeIII ||| XhoII | Tsp45I BbvI ||| | DpnI | NlaIII SfaNI ||| | NlaIV | | MaeII | DdeI TseI ||| | |BetI* | | | SetI | | BccI |BisI ||| | |BstKTI | | | TaiI HphI | | |TaqI ||BlsI ||| | ||HpaII \ \ \ \ \ \ \ \\ \\\ \\\ \ \\\ CATGGTGACGTATTTAGAACCCCATCTAAGTCGATGCTGCTATCCATTCTTGTGGGATCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTACCACTGCATAAATCTTGGGGTAGATTCAGCTACGACGATAGGTAAGAACACCCTAGG // / // / / / / / /// / / / // / || | || HphI | | | | ||TseI | | | || XhoII || | |MaeII | | | | |BisI | | | || BamHI || | Tsp45I | | | | BlsI | | | || MboI || | MaeIII | | | TaqI | | | |NlaIV || TaiI | | BccI | | | |DpnI || SetI | DdeI | | | BstKTI |DsaI* SfaNI | | BinI* |SecI* BbvI | MslI |StyI BstXI |NcoI |FatI CviAII H G D V F R T P S K S M L L S I L V G S M V T Y L E P H L S R C C Y P F L W D P W * R I * N P I * V D A A I H S C G I R ----:----|----:----|----:----|----:----|----:----|----:----| W P S T N L V G D L D I S S D M R T P D G H H R I * F G M * T S A A I W E Q P I M T V Y K S G W R L R H Q * G N K H S G AciI BinI* FatI BisI | CviRI* |CviAII |BlsI | | BccI || NlaIII ||TauI SetI \ \ \ \\ \ \\\ \ GGTATGCAGTTATTTTTGATGGTCATGTGTAGCATTTTTTTTGCCGCAGTAGGTCTTGTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACGTCAATAAAAACTACCAGTACACATCGTAAAAAAAACGGCGTCATCCAGAACAC // / / / / // //// / || | CviRI* BccI | |FatI |||| SetI || BinI* | CviAII |||AciI |BetI* NlaIII ||BisI HpaII |BlsI TauI G M Q L F L M V M C S I F F A A V G L V V C S Y F * W S C V A F F L P Q * V L C Y A V I F D G H V * H F F C R S R S C V ----:----|----:----|----:----|----:----|----:----|----:----| P I C N N K I T M H L M K K A A T P R T R Y A T I K S P * T Y C K K Q R L L D Q T H L * K Q H D H T A N K K G C Y T K H MnlI | BinI* | Hpy178III* | | MboI | | BamHI | | XhoII | | | DpnI | | | NlaIV | | | |BstKTI CviRI* | | | || PsrI | EcoT22I | | | || |BinI* Tsp4CI* | | PsrI \ \ \ \\ \\ \ \ \ \ TCGCCTGTTTCCAGAGGATCCCTGCCAACTGTAATGTTTGTTCTTTATGCATTATTTGGA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGCGGACAAAGGTCTCCTAGGGACGGTTGACATTACAAACAAGAAATACGTAATAAACCT / // // / / / / // MnlI || || | | Tsp4CI* | |PsrI || || | BinI* | CviRI* || || XhoII EcoT22I || || BamHI || || MboI || |NlaIV || |DpnI || |PsrI || BstKTI |Hpy178III* BinI* S P V S R G S L P T V M F V L Y A L F G R L F P E D P C Q L * C L F F M H Y L D A C F Q R I P A N C N V C S L C I I W I ----:----|----:----|----:----|----:----|----:----|----:----| D G T E L P D R G V T I N T R * A N N P T A Q K W L I G A L Q L T Q E K H M I Q R R N G S S G Q W S Y H K N K I C * K S BinI* | MboI | BamHI | XhoII AsuI* | | DpnI MnlI AvaII | | NlaIV | AccI Hpy166II | | |BstKTI | |Hpy166II |BmgT120I | | || TaqII | || ApoI ||NlaIV | | || | BinI* | || TspEI ||| Hin4II* \ \ \\ \ \ \ \\ \ \\\ \ TTTGTAGGATCCTACGCCTCAATGGGTGTCTACAAATTTTTTCGTGGACCCTATTGGAAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAACATCCTAGGATGCGGAGTTACCCACAGATGTTTAAAAAAGCACCTGGGATAACCTTC / // / / / // / / /// | || | BinI* | |AccI TspEI | ||Hin4II* | || XhoII | | ApoI | |AvaII | || BamHI | Hpy166II | |AsuI* | || TaqII MnlI | BmgT120I | || MboI | NlaIV | |NlaIV Hpy166II | |DpnI | BstKTI BinI* F V G S Y A S M G V Y K F F R G P Y W K L * D P T P Q W V S T N F F V D P I G R C R I L R L N G C L Q I F S W T L L E G ----:----|----:----|----:----|----:----|----:----|----:----| N T P D * A E I P T * L N K R P G * Q F I Q L I R R R L P H R C I K E H V R N S K Y S G V G * H T D V F K K T S G I P L PfoI BssKI EcoRII | ScrFI GsuI MseI SspI | BseBI TspEI Eco57MI \ \ \ \ \ \ GCGAATATGATATTAACGCCAATATTACTTCCTGGAGCAATTTTTTTACTGATTGTAATA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTTATACTATAATTGCGGTTATAATGAAGGACCTCGTTAAAAAAATGACTAACATTAT / / / / / / MseI SspI | EcoRII TspEI Eco57MI | BssKI GsuI | PfoI BseBI ScrFI A N M I L T P I L L P G A I F L L I V I R I * Y * R Q Y Y F L E Q F F Y * L * * E Y D I N A N I T S W S N F F T D C N N ----:----|----:----|----:----|----:----|----:----|----:----| A F I I N V G I N S G P A I K K S I T I P S Y S I L A L I V E Q L L K K V S Q L R I H Y * R W Y * K R S C N K * Q N Y Y Eco57I Eco57MI | TspDTI SetI | | MboII | BseGI | | | CviRI* | | BseYI | | | | FokI | | | GsaI CviJI \ \ \ \ \ \ \ \ \ \ ATGAACTTCTTTTTGTTATTTGCACATTCTTCAGGTGTCATCCCAGCGAGAAGCCTATTC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTGAAGAAAAACAATAAACGTGTAAGAAGTCCACAGTAGGGTCGCTCTTCGGATAAG / / / / / / / / / / / | | | CviRI* | | BseGI | BseYI CviJI MboII | | MboII | SetI GsaI | TspDTI FokI Eco57MI Eco57I M N F F L L F A H S S G V I P A R S L F * T S F C Y L H I L Q V S S Q R E A Y S E L L F V I C T F F R C H P S E K P I L ----:----|----:----|----:----|----:----|----:----|----:----| I F K K K N N A C E E P T M G A L L R N L S S R K T I Q V N K L H * G L S F G I H V E K Q * K C M R * T D D W R S A * E MfeI MboII TspGWI FauI AciI TspEI \ \ \ \ \ TTTATCATTCTTCTATGGTTTTTAGTTTCTGTTCCGTTGTCGTTTGCGGGTTCAATTGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGTAAGAAGATACCAAAAATCAAAGACAAGGCAACAGCAAACGCCCAAGTTAACAA / / / / TspGWI FauI AciI TspEI MfeI F I I L L W F L V S V P L S F A G S I V L S F F Y G F * F L F R C R L R V Q L L Y H S S M V F S F C S V V V C G F N C C ----:----|----:----|----:----|----:----|----:----|----:----| K I M R R H N K T E T G N D N A P E I T R * * E E I T K L K Q E T T T Q P N L Q K D N K * P K * N R N R Q R K R T * N N FokI |TspEI Hin4I ||BtsI BsaBI FokI Hin4I TfiI ||TspRI |BseGI | SfaNI | MmeI HinfI \\\ \\ \ \ \ \ \ GCTCATAAGCAGTGTAATTGGGATGAGCATCCAACTAAAACAAACCAAATCGCCAGACAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTATTCGTCACATTAACCCTACTCGTAGGTTGATTTTGTTTGGTTTAGCGGTCTGTC / / // // / / / / TspRI | |TspEI |BsaBI | SfaNI Hin4I MmeI | FokI BseGI FokI Hin4I BtsI A H K Q C N W D E H P T K T N Q I A R Q L I S S V I G M S I Q L K Q T K S P D R S * A V * L G * A S N * N K P N R Q T D ----:----|----:----|----:----|----:----|----:----|----:----| A * L C H L Q S S C G V L V F W I A L C Q E Y A T Y N P H A D L * F L G F R W V S M L L T I P I L M W S F C V L D G S L XcmI | BssKI | SecI* | EcoRII | | ScrFI | | BseBI | | | Csp6I | | | |RsaI | | | || SmlI Bce83I* | | | || | Hin4I |MseI ApoI | | | || | Hin4I |SetI TspEI \ \ \ \\ \ \ \\ \ ATTCCATATCAACCCTGGTACTTGAGAACAGCACAAGCAACCTTAATCGCTGGAATTTTC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGTATAGTTGGGACCATGAACTCTTGTCGTGTTCGTTGGAATTAGCGACCTTAAAAG / / ///// / // / / HinfI XcmI ||||| SmlI || MseI TspEI TfiI ||||Csp6I |Bce83I* ApoI |||RsaI SetI ||EcoRII ||Hin4I ||Hin4I ||BssKI |SecI* BseBI ScrFI I P Y Q P W Y L R T A Q A T L I A G I F F H I N P G T * E Q H K Q P * S L E F S S I S T L V L E N S T S N L N R W N F Q ----:----|----:----|----:----|----:----|----:----|----:----| I G Y * G Q Y K L V A C A V K I A P I K S E M D V R T S S F L V L L R L R Q F K N W I L G P V Q S C C L C G * D S S N E TspDTI | GsuI | AluI MboI | CviJI Hpy188I | Eco57MI | DpnI | | TatI | |BstKTI | | SetI | || BinI* | | |Csp6I PflMI ApoI | || |AciI | | ||RsaI BsrI BsiYI* TspEI \ \\ \\ \ \ \\\ \ \ \ AGTTTCGGATCAATAGCGGTTGAGCTGTACTTCATTTACTCCAGTTTATGGTTCAACAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAGCCTAGTTATCGCCAACTCGACATGAAGTAAATGAGGTCAAATACCAAGTTGTTT / // / / // / / /// / / | || MboI | || | | ||TatI BsrI BsiYI* | |DpnI | || | | |Csp6I PflMI | BstKTI | || | | RsaI Hpy188I | || | CviJI | || | AluI | || Eco57MI | || SetI | || GsuI | |TspDTI | AciI BinI* S F G S I A V E L Y F I Y S S L W F N K V S D Q * R L S C T S F T P V Y G S T K F R I N S G * A V L H L L Q F M V Q Q N ----:----|----:----|----:----|----:----|----:----|----:----| L K P D I A T S S Y K M * E L K H N L L * N R I L L P Q A T S * K S W N I T * C T E S * Y R N L Q V E N V G T * P E V F Hin4I | HindII | Hpy166II Hin4I TspDTI | | SetI SetI \ \ \ \ \ \ ATTTTTTATATGTTTGGATTTTTACTCTTTTCATTCTTATTGTTGACCTTGACAACCTCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAAATATACAAACCTAAAAATGAGAAAAGTAAGAATAACAACTGGAACTGTTGGAGT / / / // / TspEI TspDTI Hin4I |SetI SetI Hin4I Hpy166II ApoI HindII I F Y M F G F L L F S F L L L T L T T S F F I C L D F Y S F H S Y C * P * Q P H F L Y V W I F T L F I L I V D L D N L I ----:----|----:----|----:----|----:----|----:----|----:----| I K * I N P N K S K E N K N N V K V V E F K K Y T Q I K V R K M R I T S R S L R N K I H K S K * E K * E * Q Q G Q C G * Hpy178III* | MboI | BclI TsoI | | DpnI XbaI MaeIII | | BccI |MaeI CviJI | MnlI | | |BstKTI |Hpy178III* |BsrI \ \ \ \ \\ \\ \\ TTAGTTACCATCTTGATCACATATTACTCGTTATGTCTAGAAAACTGGCTATGGCAATGG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAATGGTAGAACTAGTGTATAATGAGCAATACAGATCTTTTGACCGATACCGTTACC / / ///// / // // / | | ||||BclI TsoI |XbaI |CviJI BsrDI | | ||||MboI | BsrI | | |||BccI Hpy178III* | | ||DpnI MaeI | | |BstKTI | | Hpy178III* | MaeIII MnlI L V T I L I T Y Y S L C L E N W L W Q W * L P S * S H I T R Y V * K T G Y G N G S Y H L D H I L L V M S R K L A M A M E ----:----|----:----|----:----|----:----|----:----|----:----| N T V M K I V Y * E N H R S F Q S H C H M L * W R S * M N S T I D L F S A I A I * N G D Q D C I V R * T * F V P * P L P FokI BseGI | TspDTI | | FokI | | | MaeII | | | | SetI | | | | TaiI | | | | |BseGI Hin4I | | | | || Hin4I BsrDI Hin4I | | | | || Hin4I CspCI \ \ \ \ \ \ \\ \ \ AGAAGTTTTATTATTGGTGGTTTAGGATGTTCAATCTATACGTTCATCCACTCCATACTA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCAAAATAATAACCACCAAATCCTACAAGTTAGATATGCAAGTAGGTGAGGTATGAT / / / / / / / / Hin4I | | | | | Hin4I CspCI Hin4I | | | | | Hin4I | | | | MaeII | | | | BseGI | | | | FokI | | | TaiI | | | SetI | | FokI | TspDTI BseGI R S F I I G G L G C S I Y T F I H S I L E V L L L V V * D V Q S I R S S T P Y Y K F Y Y W W F R M F N L Y V H P L H T I ----:----|----:----|----:----|----:----|----:----|----:----| L L K I I P P K P H E I * V N M W E M S S F N * * Q H N L I N L R Y T * G S W V S T K N N T T * S T * D I R E D V G Y * HindIII | AluI | CviJI Tsp4CI* SduI DdeI | | SetI | CspCI HgiAI* Hpy188I \ \ \ \ \ \ \ \ TTTACTAAGTTCAAGCTTGGTGGAGTTATTACTGTCGTGCTCTATCTCGGATATTCACTT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGATTCAAGTTCGAACCACCTCAATAATGACAGCACGAGATAGAGCCTATAAGTGAA / / / / // / / DdeI | | HindIII || HgiAI* Hpy188I | CviJI || SduI | AluI |CspCI SetI Tsp4CI* F T K F K L G G V I T V V L Y L G Y S L L L S S S L V E L L L S C S I S D I H L Y * V Q A W W S Y Y C R A L S R I F T Y ----:----|----:----|----:----|----:----|----:----|----:----| N V L N L S P P T I V T T S * R P Y E S I * * T * A Q H L * * Q R A R D R I N V K S L E L K T S N N S D H E I E S I * K MaeIII BsrI GsuI CviRI* Tsp45I TspRI Eco57MI \ \ \ \ ATTATATCTGCATTATGTTGTGTCGTCACTGGAGCGATTGGTTTTTTTAGTAGTATGTTT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAATATAGACGTAATACAACACAGCAGTGACCTCGCTAACCAAAAAAATCATCATACAAA / / / / / CviRI* | | BsrI Eco57MI | Tsp45I GsuI | MaeIII TspRI I I S A L C C V V T G A I G F F S S M F L Y L H Y V V S S L E R L V F L V V C F Y I C I M L C R H W S D W F F * * Y V F ----:----|----:----|----:----|----:----|----:----|----:----| I I D A N H Q T T V P A I P K K L L I N * * I Q M I N H R * Q L S Q N K * Y Y T N Y R C * T T D D S S R N T K K T T H K MboII | MseI \ \ TTTATTAGGAAGATATACTCTGCCATTAAAGTTGAGTGA 1990 2000 2010 ----:----|----:----|----:----|----:---- AAATAATCCTTCTATATGAGACGGTAATTTCAACTCACT / / MboII MseI F I R K I Y S A I K V E * L L G R Y T L P L K L S X Y * E D I L C H * S * V X ----:----|----:----|----:----|----:---- K I L F I Y E A M L T S H K * * S S I S Q W * L Q T K N P L Y V R G N F N L S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AflIII 1 AluI 3 AluBI ApoI 9 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 3 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 7 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 7 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 2 BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 2 BseRI 1 BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstKTI 8 BstXI 2 BtgZI 1 BtsI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 8 MalI DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 5 EcoP15I 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 2 FatI 4 FauI 3 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 1 GsaI 1 GsuI 3 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 5 HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 5 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 6 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 2 SchI MmeI 1 MnlI 13 MseI 10 Tru1I,Tru9I MslI 5 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 2 PleI 2 PpsI PsiI 1 AanI PsrI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 3 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 20 SfaNI 5 LweI SmlI 1 SmoI SspI 1 StuI 2 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 3 TaqII 1 TatI 1 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 19 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI TstI 1 VspI 1 PshBI,AseI XbaI 1 XcmI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BalI BarI BbvCI BbvII* BcgI BciVI BdaI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsePI BseSI BsgI BslFI BsmAI BsmFI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cfr10I Cfr9I CfrI ClaI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EgeI EheI Esp3I EspI* FaqI FseI FspAI HaeII HgaI HgiCI* HgiJII* HpaI Hpy99I KasI KpnI MauBI MluI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* PacI PasI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI Tth111I XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769