Restriction Map of STE5/YDR103W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

STE5/YDR103W on chromosome IV from coordinates 658350 to 661103.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15133

AluI CviJI | TaqI SfeI* TspEI | SetI \ \ \ \ ATGATGGAAACTCCTACAGACAATATAGTTTCCCCTTTTCACAATTTTGGTAGCTCGACA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACCTTTGAGGATGTCTGTTATATCAAAGGGGAAAAGTGTTAAAACCATCGAGCTGT / / / / / SfeI* | | | TaqI | | CviJI | | AluI | SetI TspEI M M E T P T D N I V S P F H N F G S S T * W K L L Q T I * F P L F T I L V A R H D G N S Y R Q Y S F P F S Q F W * L D T ----:----|----:----|----:----|----:----|----:----|----:----| X I S V G V S L I T E G K * L K P L E V X S P F E * L C Y L K G K E C N Q Y S S H H F S R C V I Y N G R K V I K T A R C AluI CviJI |MaeI Acc65I ||SetI HgiCI* ||| BfiI |Csp6I ||| |MwoI ||RsaI ||| || CviJI ||NlaIV ||| || | BsrI ||| KpnI ||| || | | TatI ||| | SetI ||| || | | |Csp6I ||| | | TaqI ||| || | | ||RsaI ||| | | |Hpy178III* ||| || | | ||ScaI \\\ \ \ \\ \\\ \\ \ \ \\\ CAATATAGTGGTACCTTGTCGAGAACTCCCAACCAAATAATAGAGCTAGAGAAGCCCAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATATCACCATGGAACAGCTCTTGAGGGTTGGTTTATTATCTCGATCTCTTCGGGTCA / /// // / / // / / | ||HgiCI* |Hpy178III* | | |BfiI CviJI ScaI | ||Acc65I TaqI | | MwoI BsrI RsaI | |Csp6I | | MaeI | NlaIV | CviJI | RsaI | AluI | SetI SetI KpnI Q Y S G T L S R T P N Q I I E L E K P S N I V V P C R E L P T K * * S * R S P V I * W Y L V E N S Q P N N R A R E A Q Y ----:----|----:----|----:----|----:----|----:----|----:----| C Y L P V K D L V G L W I I S S S F G L V I Y H Y R T S F E W G F L L A L S A W L I T T G Q R S S G V L Y Y L * L L G T BssKI CviJI EcoRII | ScrFI | BseBI | |TspGWI MnlI | || SetI | Hpy178III* | || NlaIV TsoI \ \ \ \\ \ \ ACTCTATCCCCATTGTCAAGAGGAAAAAAATGGACGGAAAAGTTAGCCAGGTTCCAAAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGATAGGGGTAACAGTTCTCCTTTTTTTACCTGCCTTTTCAATCGGTCCAAGGTTTCT // / / //// // / |TatI MnlI Hpy178III* |||| |NlaIV TsoI Csp6I |||| EcoRII |||| BssKI |||BseBI |||ScrFI ||SetI |TspGWI CviJI T L S P L S R G K K W T E K L A R F Q R L Y P H C Q E E K N G R K S * P G S K E S I P I V K R K K M D G K V S Q V P K K ----:----|----:----|----:----|----:----|----:----|----:----| V R D G N D L P F F H V S F N A L N W L Y E I G M T L L F F I S P F T L W T G F S * G W Q * S S F F P R F L * G P E L S HphI | XmnI SetI MnlI | |TfiI | BseRI | HphI | |HinfI | | Hin4II* | |MnlI \ \\ \ \ \ \ \\ AGTAGTGCTAAAAAGAAAAGATTCTCACCTTCTCCTATTTCCTCCTCTACATTTTCGTTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCACGATTTTTCTTTTCTAAGAGTGGAAGAGGATAAAGGAGGAGATGTAAAAGCAAG / / / / / / / // | | | SetI BseRI Hin4II* | |MnlI | | HinfI | HphI | | TfiI MnlI | XmnI HphI S S A K K K R F S P S P I S S S T F S F V V L K R K D S H L L L F P P L H F R S * C * K E K I L T F S Y F L L Y I F V L ----:----|----:----|----:----|----:----|----:----|----:----| L L A L F F L N E G E G I E E E V N E N F Y H * F S F I R V K E * K R R * M K T T T S F L F S E * R R R N G G R C K R E BsrDI MaeI | MaeIII BsiYI* | BstEII | MboII | Tsp4CI* | |MaeIII | |BbvII* | |Tsp45I | || MboII | || TaqII | || |SetI | || | MboII Ksp632I* | || |TspDTI \ \\ \ \ \ \ \\ \\ TCACCCAAATCTAGGGTCACTTCTTCAAACTCTTCTGGCAATGAAGACGGTAACCTAATG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGGTTTAGATCCCAGTGAAGAAGTTTGAGAAGACCGTTACTTCTGCCATTGGATTAC / / / / / / / / / / | | | | MboII | | | | TspDTI | | | Tsp45I | | | | BbvII* | | | MaeIII | | | | BstEII | | TaqII | | | | MaeIII | MboII | | | | MboII | MaeI | | | SetI BsiYI* | | Tsp4CI* | BsrDI Ksp632I* S P K S R V T S S N S S G N E D G N L M H P N L G S L L Q T L L A M K T V T * * T Q I * G H F F K L F W Q * R R * P N E ----:----|----:----|----:----|----:----|----:----|----:----| E G L D L T V E E F E E P L S S P L R I R V W I * P * K K L S K Q C H L R Y G L * G F R P D S R * V R R A I F V T V * H SetI | TspDTI | | Tsp4CI* MnlI | | | Hin4II* TspRI | AjuI \ \ \ \ \ \ \ AATACACCTTCTACGGTTTCCACTGATTATTTGCCACAACACCCTCACAGAACATCGTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGTGGAAGATGCCAAAGGTGACTAATAAACGGTGTTGTGGGAGTGTCTTGTAGCAGA / / / / / / SetI | | | TspRI MnlI | | Hin4II* AjuI | Tsp4CI* TspDTI N T P S T V S T D Y L P Q H P H R T S S I H L L R F P L I I C H N T L T E H R L Y T F Y G F H * L F A T T P S Q N I V F ----:----|----:----|----:----|----:----|----:----|----:----| F V G E V T E V S * K G C C G * L V D D S Y V K * P K W Q N N A V V G E C F M T I C R R R N G S I I Q W L V R V S C R R SetI | AvaI SetI | Hpy178III* TspEI AjuI MaeIII | |BmeT110I \ \ \ \ \\ TTGCCAAGACCTAATTCCAATCTCTTTCACGCAAGTAATAGTAACCTATCCCGAGCAAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTTCTGGATTAAGGTTAGAGAAAGTGCGTTCATTATCATTGGATAGGGCTCGTTTA / / / / / /// SetI TspEI AjuI | MaeIII ||AvaI SetI |BmeT110I Hpy178III* L P R P N S N L F H A S N S N L S R A N C Q D L I P I S F T Q V I V T Y P E Q M A K T * F Q S L S R K * * * P I P S K * ----:----|----:----|----:----|----:----|----:----|----:----| K G L G L E L R K * A L L L L R D R A F K A L V * N W D R E R L Y Y Y G I G L L Q W S R I G I E K V C T I T V * G S C I CviJI | SduI | HgiJII* | | StyI | | SecI* | | | AsuI* | | | |BmgT120I | | | ||CviJI | | | ||HaeIII | | | ||| ApoI StyI TsoI TaqII | | | ||| TspEI Hpy188I SecI* SetI | CviJI \ \ \ \\\ \ \ \ \ \ \ GAGCCCCCAAGGGCCGAAAATTTATCAGATAATATACCACCCAAGGTCGCTCCATTTGGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGGGGTTCCCGGCTTTTAAATAGTCTATTATATGGTGGGTTCCAGCGAGGTAAACCG / / / // / / / / / / | CviJI | |AsuI* | Hpy188I | SecI* TaqII CviJI HgiJII* | BmgT120I TspEI | StyI SduI | HaeIII ApoI | TsoI | CviJI SetI SecI* StyI E P P R A E N L S D N I P P K V A P F G S P Q G P K I Y Q I I Y H P R S L H L A A P K G R K F I R * Y T T Q G R S I W L ----:----|----:----|----:----|----:----|----:----|----:----| S G G L A S F K D S L I G G L T A G N P H A G L P R F N I L Y Y V V W P R E M Q L G W P G F I * * I I Y W G L D S W K A Csp6I |RsaI ||MaeII ||| SetI SetI ||| TaiI | MseI ||| | MaeIII | | MnlI BsmI ||| | Tsp45I \ \ \ \ \\\ \ \ TATCCAATACAAAGAACCTCTATTAAAAAATCCTTTTTGAATGCTTCTTGTACGTTATGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGTTATGTTTCTTGGAGATAATTTTTTAGGAAAAACTTACGAAGAACATGCAATACA / // / // / SetI |MnlI BsmI || MaeII MseI |Csp6I RsaI TaiI SetI Y P I Q R T S I K K S F L N A S C T L C I Q Y K E P L L K N P F * M L L V R Y V S N T K N L Y * K I L F E C F L Y V M * ----:----|----:----|----:----|----:----|----:----|----:----| * G I C L V E I L F D K K F A E Q V N H S D L V F F R * * F I R K S H K K Y T I I W Y L S G R N F F G K Q I S R T R * T AluI CviJI | SetI | Cac8I | | FatI | | CviRI* | | |CviAII | | || NspI | | || NlaIII | | || |CfrI | | || || BalI | | || || CviJI | | || || HaeIII | | || || | HphI MboII | | || || | | SmlI CviJI | TspEI | | || || | | AflII \ \ \ \ \ \\ \\ \ \ \ GACGAGCCTATTTCTAACAGAAGAAAGGGAGAGAAAATTATAGAGCTTGCATGTGGCCAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTCGGATAAAGATTGTCTTCTTTCCCTCTCTTTTAATATCTCGAACGTACACCGGTG / / / / / / / / // /// | CviJI MboII | | | | | || ||CfrI Tsp45I | | | | | || |HphI MaeIII | | | | | || |FalI | | | | | || |FalI | | | | | || HaeIII | | | | | || CviJI | | | | | || BalI | | | | | |FatI | | | | | CviAII | | | | CviRI* | | | | NlaIII | | | | NspI | | | Cac8I | | CviJI | | AluI | SetI TspEI D E P I S N R R K G E K I I E L A C G H T S L F L T E E R E R K L * S L H V A T R A Y F * Q K K G R E N Y R A C M W P L ----:----|----:----|----:----|----:----|----:----|----:----| S S G I E L L L F P S F I I S S A H P W H R A * K * C F F P L S F * L A Q M H G V L R N R V S S L S L F N Y L K C T A V MseI |FalI FalI |FalI FalI MaeII || MaeIII HgiCI* | SetI || Tsp45I | NlaIV | TaiI \\ \ \ \ \ \ TTAAGTCACCAAGAATGTCTTATTATCTCTTTTGGCACCACTTCAAAGGCAGACGTTCGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCAGTGGTTCTTACAGAATAATAGAGAAAACCGTGGTGAAGTTTCCGTCTGCAAGCA // / / / / / / || Tsp45I FalI | HgiCI* | MaeII || MaeIII FalI NlaIV TaiI |AflII SetI |SmlI MseI L S H Q E C L I I S F G T T S K A D V R * V T K N V L L S L L A P L Q R Q T F V K S P R M S Y Y L F W H H F K G R R S C ----:----|----:----|----:----|----:----|----:----|----:----| K L * W S H R I I E K P V V E F A S T R S L D G L I D * * R K Q C W K L P L R E * T V L F T K N D R K A G S * L C V N T Hin6I BsmI |GlaI Csp6I CviRI* ||HhaI |RsaI BceAI CviJI | EcoT22I \\\ \\ \ \ \ \ GCGCTATTTCCTTTTTGTACCAAATGTAAAAAAGATACTAACAAAGCCGTTCAATGCATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGATAAAGGAAAAACATGGTTTACATTTTTTCTATGATTGTTTCGGCAAGTTACGTAA /// // / / / / ||Hin6I |Csp6I BceAI CviJI | CviRI* |GlaI RsaI EcoT22I HhaI BsmI A L F P F C T K C K K D T N K A V Q C I R Y F L F V P N V K K I L T K P F N A F A I S F L Y Q M * K R Y * Q S R S M H S ----:----|----:----|----:----|----:----|----:----|----:----| A S N G K Q V L H L F S V L L A T * H M H A I E K K Y W I Y F L Y * C L R E I C R * K R K T G F T F F I S V F G N L A N TfiI HinfI | BseMII TspDTI Hpy188I TfiI | |BspCNI Hpy178III* | TspEI |TspDTI HinfI | ||Hpy178III* \ \ \ \\ \ \ \\\ CCAGAAAATGATGAACTAAAGGATATTCTAATTTCTGATTTTTTGATTCATAAGATTCCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTTTACTACTTGATTTCCTATAAGATTAAAGACTAAAAAACTAAGTATTCTAAGGA / / / / / // / / Hpy178III* TspDTI | Hpy188I HinfI || | Hpy178III* | TspDTI TfiI || HinfI TspEI || TfiI |BspCNI BseMII P E N D E L K D I L I S D F L I H K I P Q K M M N * R I F * F L I F * F I R F L R K * * T K G Y S N F * F F D S * D S * ----:----|----:----|----:----|----:----|----:----|----:----| G S F S S S F S I R I E S K K I * L I G E L F H H V L P Y E L K Q N K S E Y S E W F I I F * L I N * N R I K Q N M L N R AciI TfiI | MnlI HinfI | | BspCNI | DdeI | | |FauI | |Hpy188I DdeI | | |BseMII | || BslFI |SetI | | ||HphI MnlI \ \\ \ \\ \ \ \\\ \ GATTCTGAGTTATCAATCACACCTCAGTCCCGCTTTCCTCCTTATTCACCACTCTTGCCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGACTCAATAGTTAGTGTGGAGTCAGGGCGAAAGGAGGAATAAGTGGTGAGAACGGA // / / / / // // / / / || DdeI | SetI DdeI || || | FauI MnlI |Hpy188I BslFI || || HphI HinfI || |BseMII TfiI || BspCNI |AciI MnlI D S E L S I T P Q S R F P P Y S P L L P I L S Y Q S H L S P A F L L I H H S C L F * V I N H T S V P L S S L F T T L A S ----:----|----:----|----:----|----:----|----:----|----:----| S E S N D I V G * D R K G G * E G S K G Q N Q T I L * V E T G S E E K N V V R A I R L * * D C R L G A K R R I * W E Q R AluI BsiYI* Hin4I CviJI | MnlI SetI | Bce83I* SmlI | SetI \ \ \ \ \ \ \ \ CCTTTTGGGTTATCCTATACACCTGTTGAAAGACAAACGATATATTCTCAAGCTCCAAGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAACCCAATAGGATATGTGGACAACTTTCTGTTTGCTATATAAGAGTTCGAGGTTCA / / / / / /// / | MnlI SetI | Bce83I* ||| Hin4I BsiYI* Hin4I ||CviJI ||AluI |SmlI SetI P F G L S Y T P V E R Q T I Y S Q A P S L L G Y P I H L L K D K R Y I L K L Q V F W V I L Y T C * K T N D I F S S S K S ----:----|----:----|----:----|----:----|----:----|----:----| G K P N D * V G T S L C V I Y E * A G L E K Q T I R Y V Q Q F V F S I N E L E L R K P * G I C R N F S L R Y I R L S W T TseI CviJI |BisI BsgI ||BlsI StyI ApoI Hin4I |BbvI |||CviRI* SecI* TspEI \ \\ \\\\ \ \ CTAAACCCAAATCTCATATTGGCTGCACCCCCCAAGGAAAGAAACCAAATTCCACAAAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTGGGTTTAGAGTATAACCGACGTGGGGGGTTCCTTTCTTTGGTTTAAGGTGTTTTT / / //// / / BsgI BbvI |||CviRI* SecI* TspEI |||TseI StyI ApoI ||BisI |BlsI CviJI L N P N L I L A A P P K E R N Q I P Q K * T Q I S Y W L H P P R K E T K F H K K K P K S H I G C T P Q G K K P N S T K K ----:----|----:----|----:----|----:----|----:----|----:----| R F G F R M N A A G G L S L F W I G C F D L G L D * I P Q V G W P F F G F E V F * V W I E Y Q S C G G L F S V L N W L F BssKI SecI* SduI EcoRII BseSI BetI* |PasI TspGWI BspMII* |SecI* | ApoI |HpaII ||ScrFI | TspEI |MboII HphI ||BseBI | EcoRI |Hpy178III* \ \\\ \ \ \\ AAATCAAACTATACATTTTTACATTCACCCCTGGGGCACAGAAGAATTCCGTCCGGAGCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTTTGATATGTAAAAATGTAAGTGGGGACCCCGTGTCTTCTTAAGGCAGGCCTCGT / /// / / / // HphI ||| TspGWI | | |BspMII* ||EcoRII | | |BetI* ||BssKI | | Hpy178III* ||SecI* | | HpaII ||BseSI | MboII ||SduI EcoRI |SecI* TspEI |PasI ApoI BseBI ScrFI K S N Y T F L H S P L G H R R I P S G A N Q T I H F Y I H P W G T E E F R P E Q I K L Y I F T F T P G A Q K N S V R S K ----:----|----:----|----:----|----:----|----:----|----:----| F D F * V N K C E G R P C L L I G D P A F I L S Y M K V N V G P A C F F E T R L F * V I C K * M * G Q P V S S N R G S C SetI |SfeI* || EcoP15I || | MnlI || | | MwoI || | | | AluI || | | | CviJI || | | | | SetI || | | | | | TfiI DdeI || | | | | | HinfI \ \\ \ \ \ \ \ \ AACTCTATCTTAGCAGACACCTCTGTAGCGTTGTCAGCTAATGATTCTATTTCTGCTGTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGATAGAATCGTCTGTGGAGACATCGCAACAGTCGATTACTAAGATAAAGACGACAA / / / / / / / / DdeI SetI | | | | CviJI HinfI | | | | AluI TfiI | | | SetI | | MwoI | MnlI EcoP15I SfeI* N S I L A D T S V A L S A N D S I S A V T L S * Q T P L * R C Q L M I L F L L F L Y L S R H L C S V V S * * F Y F C C F ----:----|----:----|----:----|----:----|----:----|----:----| F E I K A S V E T A N D A L S E I E A T L S * R L L C R Q L T T L * H N * K Q Q V R D * C V G R Y R Q * S I I R N R S N AclI MaeII | SetI | TaiI | | AciI | | BisI | | |BlsI | | ||TauI | | ||NspBII* TspEI BseGI FokI | | ||| MseI SetI \ \ \ \ \ \\\ \ \ TCCAATTCGGTAAGAGCAAAGGATGACGAAACCAAAACAACGTTGCCGCTGTTAAGGTCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTAAGCCATTCTCGTTTCCTACTGCTTTGGTTTTGTTGCAACGGCGACAATTCCAGT / / // / //// / TspEI BseGI || | |||| MseI || | |||| SetI || | |||NspBII* || | |||AciI || | ||BisI || | |BlsI || | TauI || MaeII || AclI |TaiI |SetI FokI S N S V R A K D D E T K T T L P L L R S P I R * E Q R M T K P K Q R C R C * G H Q F G K S K G * R N Q N N V A A V K V I ----:----|----:----|----:----|----:----|----:----|----:----| E L E T L A F S S S V L V V N G S N L D K W N P L L L P H R F W F L T A A T L T G I R Y S C L I V F G F C R Q R Q * P * TspEI |XmnI || PfoI || BssKI || EcoRII TspEI ApoI || | ScrFI | CviRI* TspEI || | BseBI | | MboII \ \\ \ \ \ \ \ TATTTTATTCAAATTCTTTTGAACAATTTCCAGGAAGAATTGCAGGATTGGAGAATAGAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAATAAGTTTAAGAAAACTTGTTAAAGGTCCTTCTTAACGTCCTAACCTCTTATCTG / / / / / // / TspEI | | | EcoRII || MboII ApoI | | | BssKI |CviRI* | | | PfoI TspEI | | BseBI | | ScrFI | TspEI XmnI Y F I Q I L L N N F Q E E L Q D W R I D I L F K F F * T I S R K N C R I G E * T F Y S N S F E Q F P G R I A G L E N R R ----:----|----:----|----:----|----:----|----:----|----:----| Y K I * I R K F L K W S S N C S Q L I S M N * E F E K S C N G P L I A P N S F L I K N L N K Q V I E L F F Q L I P S Y V SetI | AccI DdeI | |Hpy166II BslFI | || TspEI BccI Hpy188I \ \ \\ \ \ \ GGGGACTATGGATTACTAAGGTTGGTAGACAAATTGATGATTTCCAAAGATGGTCAGAGA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTGATACCTAATGATTCCAACCATCTGTTTAACTACTAAAGGTTTCTACCAGTCTCT /// // / / / ||BslFI |AccI TspEI BccI Hpy188I |DdeI Hpy166II SetI G D Y G L L R L V D K L M I S K D G Q R G T M D Y * G W * T N * * F P K M V R D G L W I T K V G R Q I D D F Q R W S E I ----:----|----:----|----:----|----:----|----:----|----:----| P S * P N S L N T S L N I I E L S P * L R P S H I V L T P L C I S S K W L H D S P V I S * * P Q Y V F Q H N G F I T L S BbvII* | HgaI | MboII \ \ TATATACAATGCTGGTGTTTCTTATTTGAAGACGCATTTGTAATAGCAGAAGTGGATAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATATATGTTACGACCACAAAGAATAAACTTCTGCGTAAACATTATCGTCTTCACCTATTG / / | HgaI BbvII* MboII Y I Q C W C F L F E D A F V I A E V D N I Y N A G V S Y L K T H L * * Q K W I T Y T M L V F L I * R R I C N S R S G * R ----:----|----:----|----:----|----:----|----:----|----:----| Y I C H Q H K K N S S A N T I A S T S L I Y V I S T N R I Q L R M Q L L L L P Y I Y L A P T E * K F V C K Y Y C F H I V ApoI TspEI TspEI SetI SmlI \ \ \ \ GATGTTGATGTTTTGGAAATTAGACTAAAGAATTTAGAAGTATTTACACCTATTGCCAAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAACTACAAAACCTTTAATCTGATTTCTTAAATCTTCATAAATGTGGATAACGGTTG / / / TspEI TspEI SetI ApoI D V D V L E I R L K N L E V F T P I A N M L M F W K L D * R I * K Y L H L L P T C * C F G N * T K E F R S I Y T Y C Q L ----:----|----:----|----:----|----:----|----:----|----:----| S T S T K S I L S F F K S T N V G I A L R H Q H K P F * V L S N L L I * V * Q W I N I N Q F N S * L I * F Y K C R N G V TaqI | HindIII | |Bce83I* | ||AluI | ||CviJI | ||| SetI | ||| | TatI CviRI* Eco57I | ||| | |Csp6I | MseI BsrDI Eco57MI | ||| | ||RsaI | SetI | Hin6I | BarI | ||| | ||ScaI | BarI | |GlaI \ \ \ \\\ \ \\\ \ \ \ \\ TTGAGAATGACTACACTCGAAGCTTCAGTACTCAAATGCACCTTAAATAAACAACATTGC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTTACTGATGTGAGCTTCGAAGTCATGAGTTTACGTGGAATTTATTTGTTGTAACG / / // / / /// // / / // | Eco57MI || | | ||TatI |SetI MseI BsrDI |GlaI | Eco57I || | | |Csp6I CviRI* HhaI | BarI || | | ScaI BarI SmlI || | | RsaI || | HindIII || CviJI || AluI |SetI Bce83I* TaqI L R M T T L E A S V L K C T L N K Q H C * E * L H S K L Q Y S N A P * I N N I A E N D Y T R S F S T Q M H L K * T T L R ----:----|----:----|----:----|----:----|----:----|----:----| K L I V V S S A E T S L H V K F L C C Q S S F S * V R L K L V * I C R L Y V V N Q S H S C E F S * Y E F A G * I F L M A MboI BglII TatI XhoII Tsp4CI* Hpy188I Hpy188I Bsp1407I | DpnI | ApoI |Csp6I HhaI | |BstKTI | TspEI Hpy188I ||RsaI \ \ \\ \ \ \ \\\ GCCGATTTATCAGATCTTTACATTGTTCAGAATATAAATTCTGACGAAAGCACAACTGTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCTAAATAGTCTAGAAATGTAACAAGTCTTATATTTAAGACTGCTTTCGTGTTGACAT / / // / / // / // Hin6I | || XhoII Hpy188I |Hpy188I | |Csp6I | || BglII TspEI | RsaI | || MboI ApoI Tsp4CI* | |DpnI | BstKTI Hpy188I A D L S D L Y I V Q N I N S D E S T T V P I Y Q I F T L F R I * I L T K A Q L Y R F I R S L H C S E Y K F * R K H N C T ----:----|----:----|----:----|----:----|----:----|----:----| A S K D S R * M T * F I F E S S L V V T R R N I L D K C Q E S Y L N Q R F C L Q G I * * I K V N N L I Y I R V F A C S Y TfiI HinfI EcoRV SetI | Hpy178III* MnlI \ \ \ \ \ CAGAAATGGATATCAGGTATATTGAATCAGGATTTTGTATTCAATGAGGACAATATCACT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTTACCTATAGTCCATATAACTTAGTCCTAAAACATAAGTTACTCCTGTTATAGTGA / / / / / / Bsp1407I | SetI | | MnlI TatI EcoRV | Hpy178III* HinfI TfiI Q K W I S G I L N Q D F V F N E D N I T R N G Y Q V Y * I R I L Y S M R T I S L E M D I R Y I E S G F C I Q * G Q Y H F ----:----|----:----|----:----|----:----|----:----|----:----| C F H I D P I N F * S K T N L S S L I V V S I S I L Y I S D P N Q I * H P C Y * L F P Y * T Y Q I L I K Y E I L V I D S Esp3I TaqI MboII PsiI BsmAI \ \ \ \ TCGACCCTGCCTATTCTTCCCATTATAAAGAACTTTTCAAAAGATGTTGGTAATGGTAGG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTGGGACGGATAAGAAGGGTAATATTTCTTGAAAAGTTTTCTACAACCATTACCATCC / / / | MboII PsiI TaqI S T L P I L P I I K N F S K D V G N G R R P C L F F P L * R T F Q K M L V M V G D P A Y S S H Y K E L F K R C W * W * A ----:----|----:----|----:----|----:----|----:----|----:----| E V R G I R G M I F F K E F S T P L P L K S G A * E E W * L S S K L L H Q Y H Y R G Q R N K G N Y L V K * F I N T I T P Csp6I |RsaI || SetI SetI BsiI* || | MaeI |MseI MmeI \ \\ \ \ \\ \ CACGAGACGAGTACCTTTCTAGGTTTAATCAATCCTAACAAAGTTGTTGAAGTTGGAAAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCTCTGCTCATGGAAAGATCCAAATTAGTTAGGATTGTTTCAACAACTTCAACCTTTA / / // // / / | BsiI* |Csp6I |MaeI | MmeI BsmAI RsaI SetI MseI Esp3I SetI H E T S T F L G L I N P N K V V E V G N T R R V P F * V * S I L T K L L K L E M R D E Y L S R F N Q S * Q S C * S W K C ----:----|----:----|----:----|----:----|----:----|----:----| C S V L V K R P K I L G L L T T S T P F A R S S Y R E L N L * D * C L Q Q L Q F V L R T G K * T * D I R V F N N F N S I ApaLI | CviRI* | Hpy166II MseI | | SduI SetI | | BseSI | ApoI | | HgiAI* Tsp4CI* TfiI | TspEI | | | MslI | MnlI HphI HinfI | | Hpy178III* \ \ \ \ \ \ \ \ \ \ \ GTGCACGATAATGATACTGTAATCATAAGGAGGGGATTCACCTTAAATTCAGGAGAATGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTGCTATTACTATGACATTAGTATTCCTCCCCTAAGTGGAATTTAAGTCCTCTTACA / / / / / / / // / / / | | | MslI | MnlI HphI |SetI | | Hpy178III* | | ApaLI Tsp4CI* HinfI | TspEI | Hpy166II TfiI | ApoI | CviRI* MseI HgiAI* BseSI SduI V H D N D T V I I R R G F T L N S G E C C T I M I L * S * G G D S P * I Q E N V A R * * Y C N H K E G I H L K F R R M F ----:----|----:----|----:----|----:----|----:----|----:----| T C S L S V T I M L L P N V K F E P S H H A R Y H Y Q L * L S P I * R L N L L I H V I I I S Y D Y P P S E G * I * S F T TatI |Csp6I ||RsaI ||ScaI ||| Tsp4CI* ||| |SalI ||| ||TaqI ||| ||AccI ||| |||HindII ||| |||Hpy166II AluI ||| |||| Tsp4CI* CviJI ||| |||| | AccI | SetI ||| |||| | |BssNAI | |TspEI MaeI ||| |||| | |Hpy166II | ||TsoI \ \\\ \\\\ \ \\ \ \\\ TCTAGGCAGAGTACTGTCGACAGTATACAATCTGTTCTAACCACGATAAGCTCAATTCTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCCGTCTCATGACAGCTGTCATATGTTAGACAAGATTGGTGCTATTCGAGTTAAGAA / /// //// // / / / / MaeI ||| |||| |AccI | | TsoI TspEI ||| |||| Hpy166II | CviJI ||| |||| BssNAI | AluI ||| |||Tsp4CI* SetI ||| ||SalI ||| |AccI ||| |TaqI ||| Hpy166II ||| HindII ||Tsp4CI* ||TatI |Csp6I ScaI RsaI S R Q S T V D S I Q S V L T T I S S I L L G R V L S T V Y N L F * P R * A Q F F * A E Y C R Q Y T I C S N H D K L N S F ----:----|----:----|----:----|----:----|----:----|----:----| E L C L V T S L I C D T R V V I L E I R N * A S Y Q R C Y V I Q E L W S L S L E R P L T S D V T Y L R N * G R Y A * N K MboI | DpnI | |TaqI SetI | |ClaI Hin4II* MseI | TspEI | |BstKTI |TspEI \ \ \ \ \\ \\ TCCCTTAAACGAGAAAAACCTGATAATTTGGCAATAATCTTACAGATCGATTTTACGAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGAATTTGCTCTTTTTGGACTATTAAACCGTTATTAGAATGTCTAGCTAAAATGCTTT / / / // // / MseI SetI TspEI || |ClaI Hin4II* || |TaqI || MboI |DpnI BstKTI S L K R E K P D N L A I I L Q I D F T K P L N E K N L I I W Q * S Y R S I L R N P * T R K T * * F G N N L T D R F Y E I ----:----|----:----|----:----|----:----|----:----|----:----| E R L R S F G S L K A I I K C I S K V F K G * V L F V Q Y N P L L R V S R N * S G K F S F F R I I Q C Y D * L D I K R F Tsp4CI* Tsp4CI* |BbvII* | HindIII || MseI | | AluI || MboII | | CviJI MseI || |TspEI | | | SetI | ApoI || || MboII PsiI | | | |MseI | TspEI \\ \\ \ \ \ \ \ \\ \ \ TTGAAGGAAGAAGACAGTTTAATTGTTGTTTATAACAGTCTAAAAGCTTTAACCATTAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCCTTCTTCTGTCAAATTAACAACAAATATTGTCAGATTTTCGAAATTGGTAATTT / / / / / / / / / / / / TspEI | | | TspEI | Tsp4CI* | | | MseI MseI | | BbvII* PsiI | | HindIII | | MboII | CviJI | | MseI | AluI | MboII SetI Tsp4CI* L K E E D S L I V V Y N S L K A L T I K * R K K T V * L L F I T V * K L * P L N E G R R Q F N C C L * Q S K S F N H * I ----:----|----:----|----:----|----:----|----:----|----:----| N F S S S L K I T T * L L R F A K V M L I S P L L C N L Q Q K Y C D L L K L W * Q L F F V T * N N N I V T * F S * G N F MboI Hin6I | DpnI |GlaI | |TaqI ||HhaI | |BstKTI Hpy178III* ||TsoI | || TspEI | MboI ||FnuDII* | || | Hin4I | | DpnI ||| CviRI* | || | Hin4I | | |BstKTI \\\ \ \ \\ \ \ \ \ \\ TTTGCGCGTTTGCAGTTTTGTTTCGTTGATCGAAATAATTATGTTCTGGACTATGGATCG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGCGCAAACGTCAAAACAAAGCAACTAGCTTTATTAATACAAGACCTGATACCTAGC / /// / // // / / / // / | ||| CviRI* || || | TspEI | || MboI | ||FnuDII* || || Hin4I | |DpnI | ||Hin6I || || Hin4I | BstKTI | |GlaI || |TaqI Hpy178III* | TsoI || MboI | HhaI |DpnI TspEI BstKTI ApoI F A R L Q F C F V D R N N Y V L D Y G S L R V C S F V S L I E I I M F W T M D R C A F A V L F R * S K * L C S G L W I G ----:----|----:----|----:----|----:----|----:----|----:----| N A R K C N Q K T S R F L * T R S * P D I Q A N A T K N R Q D F Y N H E P S H I K R T Q L K T E N I S I I I N Q V I S R Hin4I Hin4I | TfiI MaeI | Hin4I | TfiI BinI* | HinfI | HinfI BccI Hin4I TaqI \ \ \ \ \ \ \ \ GTATTACACAAGATAGATTCACTAGATTCCATCTCAAATCTCAAATCAAAGAGTTCCTCG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CATAATGTGTTCTATCTAAGTGATCTAAGGTAGAGTTTAGAGTTTAGTTTCTCAAGGAGC / / / / / / / / / | | Hin4I | | HinfI BccI Hin4I TaqI | Hin4I | | TfiI | Hin4I | MaeI BinI* HinfI TfiI V L H K I D S L D S I S N L K S K S S S Y Y T R * I H * I P S Q I S N Q R V P R I T Q D R F T R F H L K S Q I K E F L D ----:----|----:----|----:----|----:----|----:----|----:----| T N C L I S E S S E M E F R L D F L E E P I V C S L N V L N W R L D * I L S N R Y * V L Y I * * I G D * I E F * L T G R TspDTI Hpy178III* | XmnI | |SspI | || FatI | || BspHI HphI | || |CviAII | TspEI | || |Hpy178III* | | MnlI SetI | || || NlaIII \ \ \ \ \ \\ \\ \ ACACAATTTTCACCTATTTGGTTGAAAAATACTCTATATCCCGAAAATATTCATGAACAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTAAAAGTGGATAAACCAACTTTTTATGAGATATAGGGCTTTTATAAGTACTTGTA / / / / / / // / // | | | SetI | | || | |BspHI | | TspEI | | || | |FatI | MnlI | | || | Hpy178III* HphI | | || | CviAII | | || NlaIII | | |SspI | | XmnI | Hpy178III* TspDTI T Q F S P I W L K N T L Y P E N I H E H H N F H L F G * K I L Y I P K I F M N I T I F T Y L V E K Y S I S R K Y S * T F ----:----|----:----|----:----|----:----|----:----|----:----| V C N E G I Q N F F V R Y G S F I * S C S V I K V * K T S F Y E I D R F Y E H V C L K * R N P Q F I S * I G F I N M F M SfaNI TspDTI Hpy178III* \ \ TTGGGTATTGTTGCTGTATCAAATAGTAATATGGAAGCAAAAAAATCCATACTATTTCAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCATAACAACGACATAGTTTATCATTATACCTTCGTTTTTTTAGGTATGATAAAGTT / / TspDTI Hpy178III* L G I V A V S N S N M E A K K S I L F Q W V L L L Y Q I V I W K Q K N P Y Y F K G Y C C C I K * * Y G S K K I H T I S R ----:----|----:----|----:----|----:----|----:----|----:----| K P I T A T D F L L I S A F F D M S N * N P Y Q Q Q I L Y Y Y P L L F I W V I E Q T N N S Y * I T I H F C F F G Y * K L AsuI* |CviJI |HaeIII |BmgT120I MseI || MboII | TspDTI || | MboII | | SetI Hin4II* || | | TspEI | | |MboII \ \\ \ \ \ \ \ \\ GATTACAGATGCTTTACAAGTTTTGGAAGAAGAAGGCCCAATGAATTGAAGATTAAGGTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATGTCTACGAAATGTTCAAAACCTTCTTCTTCCGGGTTACTTAACTTCTAATTCCAC / / /// / / /// / SfaNI Hin4II* ||| MboII TspEI ||| MboII ||AsuI* ||PsrI |BmgT120I |MseI |MboII |SetI HaeIII TspDTI CviJI D Y R C F T S F G R R R P N E L K I K V I T D A L Q V L E E E G P M N * R L R W L Q M L Y K F W K K K A Q * I E D * G G ----:----|----:----|----:----|----:----|----:----|----:----| S * L H K V L K P L L L G L S N F I L T L N C I S * L N Q F F F A W H I S S * P I V S A K C T K S S S P G I F Q L N L H AclI MaeII | SetI CviJI | TaiI HaeIII | |HindII |TspDTI | |Hpy166II ||Cac8I | || SfeI* ||| AluI | || | Tsp4CI* ||| CviJI | || | | TspRI ||| | PfoI | || | | | TspEI ||| | SetI | || | | | | PsrI ||| | BssKI | || | | | | | BplI ||| | EcoRII | || | | | | | BplI ||| | |AlwNI | || | | | | | | MnlI ||| | |PflMI | || | | | | | | SpeI ||| | |BsiYI* PsrI | || | | | | | | |MaeI ||| | ||ScrFI |CviJI | || | | | | | | || TaqI ||| | ||BseBI \\ \ \\ \ \ \ \ \ \ \\ \ \\\ \ \\\ GGCTATTTGAACGTTGACTACAGTGATAAAATTGATGAACTAGTCGAGGCCAGCTCCTGG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATAAACTTGCAACTGATGTCACTATTTTAACTACTTGATCAGCTCCGGTCGAGGACC / / / / / // / // / // / // / / / / CviJI | | | | |SfeI* | || | || | || | | | EcoRII | | | | | | || | || | || | | | BssKI | | | | | | || | || | || | | | PfoI | | | | | | || | || | || | | BseBI | | | | | | || | || | || | | ScrFI | | | | | | || | || | || | BsiYI* | | | | | | || | || | || | PflMI | | | | | | || | || | || | AlwNI | | | | | | || | || | || | CviJI | | | | | | || | || | || | AluI | | | | | | || | || | || Cac8I | | | | | | || | || | || SetI | | | | | | || | || | |HaeIII | | | | | | || | || | |CviJI | | | | | | || | || | TspDTI | | | | | | || | || TaqI | | | | | | || | |SpeI | | | | | | || | MaeI | | | | | | || MnlI | | | | | | |TspEI | | | | | | BplI | | | | | | BplI | | | | | PsrI | | | | Tsp4CI* | | | TspRI | | Hpy166II | | HindII | MaeII | AclI TaiI SetI G Y L N V D Y S D K I D E L V E A S S W A I * T L T T V I K L M N * S R P A P G L F E R * L Q * * N * * T S R G Q L L D ----:----|----:----|----:----|----:----|----:----|----:----| P * K F T S * L S L I S S S T S A L E Q P S N S R Q S C H Y F Q H V L R P W S R A I Q V N V V T I F N I F * D L G A G P TaqII FatI BplI | SfeI* |CviAII BplI | | Tsp4CI* DdeI || NlaIII \ \ \ \ \ \\ \ ACTTTTGTTTTAGAAACTCTTTGCTACAGTTTCGGTCTAAGTTTTGATGAACATGATGAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAACAAAATCTTTGAGAAACGATGTCAAAGCCAGATTCAAAACTACTTGTACTACTG / / // / / // / BplI TaqII |SfeI* DdeI | |FatI TspDTI BplI Tsp4CI* | CviAII NlaIII T F V L E T L C Y S F G L S F D E H D D L L F * K L F A T V S V * V L M N M M T F C F R N S L L Q F R S K F * * T * * R ----:----|----:----|----:----|----:----|----:----|----:----| V K T K S V R Q * L K P R L K S S C S S S K Q K L F E K S C N R D L N Q H V H H S K N * F S K A V T E T * T K I F M I V TspDTI | Hpy178III* | | MboI MboII | | | DpnI | TfiI | | | SfaNI TspDTI | HinfI | | | |Hin4I Ksp632I* | | TaqI TaqII | | | |Hin4I |MnlI | | | McrI* |MmeI | | | |BstKTI \\ \ \ \ \ \\ \ \ \ \\ GATGACGAAGAGGATAATGATGATTCGACCGATAATGAACTTGATAATAGTTCAGGATCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCTTCTCCTATTACTACTAAGCTGGCTATTACTTGAACTATTATCAAGTCCTAGT / / / / / // / / /// / | Ksp632I* MboII | McrI* |MmeI | | ||| MboI MnlI | TaqI TaqII | | ||DpnI HinfI | | |BstKTI TfiI | | |TspRI | | Hpy178III* | Hin4I | Hin4I TspDTI D D E E D N D D S T D N E L D N S S G S M T K R I M M I R P I M N L I I V Q D H * R R G * * * F D R * * T * * * F R I T ----:----|----:----|----:----|----:----|----:----|----:----| S S S S S L S S E V S L S S S L L E P D R H R L P Y H H N S R Y H V Q Y Y N L I I V F L I I I I R G I I F K I I T * S * Tsp4CI* |BinI* || TspRI || |Hpy188I || || BseGI || || |TfiI FokI Hin4I TfiI || || |HinfI TspDTI Hin4I HinfI \\ \\ \\ \ \ \ CTGTCGGATGCTGAATCTACAACTACTATTCATATTGATTCTCCATTTGATAATGAAAAT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGCCTACGACTTAGATGTTGATGATAAGTATAACTAAGAGGTAAACTATTACTTTTA / // / // / / / | || BseGI || | Hin4I HinfI | |Hpy188I || | Hin4I TfiI | BinI* || FokI Tsp4CI* |TspDTI SfaNI HinfI TfiI L S D A E S T T T I H I D S P F D N E N C R M L N L Q L L F I L I L H L I M K M V G C * I Y N Y Y S Y * F S I * * * K C ----:----|----:----|----:----|----:----|----:----|----:----| S D S A S D V V V I * I S E G N S L S F V T P H Q I * L * * E Y Q N E M Q Y H F Q R I S F R C S S N M N I R W K I I F I HphI | BseMII DdeI | |BspCNI | Hin4II* AciI | || SetI | | TspRI | TspDTI | || |MnlI | | | Hpy166II HphI \ \ \ \\ \\ \ \ \ \ \ GCTACCGCAAATATGGTGAATGACAGAAACCTTCTCACTGAGGGTGAACATAGCAATATA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGGCGTTTATACCACTTACTGTCTTTGGAAGAGTGACTCCCACTTGTATCGTTATAT // /// // / / / / |AciI ||| |TspRI | DdeI | HphI TspDTI ||| MnlI | Hpy166II ||BspCNI Hin4II* ||SetI |BseMII HphI A T A N M V N D R N L L T E G E H S N I L P Q I W * M T E T F S L R V N I A I * Y R K Y G E * Q K P S H * G * T * Q Y R ----:----|----:----|----:----|----:----|----:----|----:----| A V A F I T F S L F R R V S P S C L L I H * R L Y P S H C F G E * Q P H V Y C Y S G C I H H I V S V K E S L T F M A I Y TatI |Csp6I ||RsaI ||| CviJI ||| | Cac8I ||| | | AluI DdeI ||| | | CviJI | Eco57I ||| | | | SetI | Eco57MI ||| | | | | Hpy188I | | MboII ||| | | | | |TfiI SspI | | |Tsp4CI* ||| | | | | |HinfI | TspDTI \ \ \\ \\\ \ \ \ \ \\ \ \ GAAAACTTAGAAACTGTCGCTTCTTCAGTACAGCCAGCTCTGATTCCTAATATTAGATTT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGAATCTTTGACAGCGAAGAAGTCATGTCGGTCGAGACTAAGGATTATAATCTAAA / / // /// / / / / / / / / | | |Tsp4CI* ||| | | | | HinfI | TspDTI BseMII | | MboII ||| | | | | TfiI SspI | DdeI ||| | | | Hpy188I Eco57MI ||| | | CviJI Eco57I ||| | | AluI ||| | Cac8I ||| | SetI ||| CviJI ||TatI |Csp6I RsaI E N L E T V A S S V Q P A L I P N I R F K T * K L S L L Q Y S Q L * F L I L D F K L R N C R F F S T A S S D S * Y * I F ----:----|----:----|----:----|----:----|----:----|----:----| S F K S V T A E E T C G A R I G L I L N L F S L F Q R K K L V A L E S E * Y * I F V * F S D S R * Y L W S Q N R I N S K BseMII |BspCNI || MnlI || | MnlI Csp6I TspDTI || | | DdeI |RsaI | TspDTI || | | |Hpy188I |SetI | | BsrI || | | ||Hin4II* || BseRI | | |TspDTI \\ \ \ \\\ \\ \ \ \ \\ TCACTTCATTCTGAGGAGGAAGGTACTAATGAAAATGAAAATGAAAATGATATGCCAGTA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGAAGTAAGACTCCTCCTTCCATGATTACTTTTACTTTTACTTTTACTATACGGTCAT / / / // / / /// / / // | | | || DdeI | ||BseRI | | |TspDTI | | | |Hin4II* | |Csp6I | | BsrI | | | Hpy188I | RsaI | TspDTI | | MnlI SetI TspDTI | MnlI BspCNI S L H S E E E G T N E N E N E N D M P V H F I L R R K V L M K M K M K M I C Q Y T S F * G G R Y * * K * K * K * Y A S I ----:----|----:----|----:----|----:----|----:----|----:----| E S * E S S S P V L S F S F S F S I G T K V E N Q P P L Y * H F H F H F H Y A L * K M R L L F T S I F I F I F I I H W Y HgaI |TsoI || AvaI || XhoI BccI || SmlI |TfiI || Hpy178III* |HinfI || |TaqI || TaqI || |BmeT110I DdeI || ClaI TspDTI || || HinfI \ \\ \ \ \\ \\ \ TTATTACTTAGTGATATGGATAAAGGAATCGATGGCATAACCAGACGCAGTTCATTCTCG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATGAATCACTATACCTATTTCCTTAGCTACCGTATTGGTCTGCGTCAAGTAAGAGC / / / / / / /// DdeI | | ClaI TspDTI TsoI ||BmeT110I | | TaqI ||TaqI | HinfI |Hpy178III* | TfiI HgaI BccI L L L S D M D K G I D G I T R R S S F S Y Y L V I W I K E S M A * P D A V H S R I T * * Y G * R N R W H N Q T Q F I L E ----:----|----:----|----:----|----:----|----:----|----:----| N N S L S I S L P I S P M V L R L E N E I I V * H Y P Y L F R H C L W V C N M R * * K T I H I F S D I A Y G S A T * E R AciI NdeI PleI BslFI |BsiYI* |MlyI BsrBI Tsp4CI* || MnlI \\ \ \ \\ \ AGTCTTATAGAGAGCGGTAATAACAACTGTCCCCTCCATATGGATTATATATAG 2710 2720 2730 2740 2750 ----:----|----:----|----:----|----:----|----:----|---- TCAGAATATCTCTCGCCATTATTGTTGACAGGGGAGGTATACCTAATATATATC / / / / / / / / / / | HinfI PleI | | BslFI Tsp4CI* | | MnlI SmlI MlyI | AciI | NdeI XhoI BsrBI BsiYI* AvaI S L I E S G N N N C P L H M D Y I * V L * R A V I T T V P S I W I I Y X S Y R E R * * Q L S P P Y G L Y I X ----:----|----:----|----:----|----:----|----:----|---- L R I S L P L L L Q G R W I S * I Y S D * L S R Y Y C S D G G Y P N Y I T K Y L A T I V V T G E M H I I Y L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 4 BspACI,SsiI AclI 2 Psp1406I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AjuI 1 AluI 10 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 8 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 1 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 2 BmgT120I 2 BplI 2 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 4 BseRI 2 BseSI 2 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 5 Cac8I 3 BstC8I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 10 CviQI,RsaNI CviAII 3 CviJI 23 CviKI-1 CviRI* 7 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 5 MalI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 2 FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 3 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 15 HpaII 1 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 10 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 5 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 15 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 2 MnlI 18 MseI 11 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PasI 1 PflMI 1 BasI,AccB7I,Van91I PfoI 2 PleI 1 PpsI PsiI 2 AanI PsrI 1 RsaI 10 AfaI SalI 1 ScaI 3 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 39 SfaNI 2 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 4 SmoI SpeI 1 BcuI,AhlI SspI 2 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 12 TaqII 4 TatI 5 TauI 1 TfiI 14 PfeI TseI 1 ApeKI TsoI 5 Tsp45I 3 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 17 TspEI 25 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 4 TscAI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflIII AgeI AhaIII* AlfI AloI ApaI AscI AsuII AvaII AvrII BaeI BamHI BbvCI BcgI BciVI BclI BdaI BglI BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseYI Bsp120I BspLU11I* BspMI BspOI BstAPI BstXI BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EgeI EheI EspI* FseI FspAI GsaI GsuI HaeII HpaI Hpy99I KasI MauBI MfeI MluI MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI OliI PacI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI Tth111I VspI XbaI XcmI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769