Restriction Map of MAK21/YDR060W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MAK21/YDR060W on chromosome IV from coordinates 570649 to 573726.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19631

AciI | NspBII* | | MboII | | BbvII* | | | BceAI DdeI \ \ \ \ \ ATGAGTGAGAACAACGGCAATCCGCTGGATTTGTCTTCACTAAGAAATAAGATTTCGTCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCACTCTTGTTGCCGTTAGGCGACCTAAACAGAAGTGATTCTTTATTCTAAAGCAGT // / / / || | BceAI DdeI || BbvII* |MboII NspBII* AciI M S E N N G N P L D L S S L R N K I S S * V R T T A I R W I C L H * E I R F R Q E * E Q R Q S A G F V F T K K * D F V K ----:----|----:----|----:----|----:----|----:----|----:----| X L S F L P L G S S K D E S L F L I E D X S H S C R C D A P N T K V L F Y S K T H T L V V A I R Q I Q R * * S I L N R * Hin4II* | MaeII | |BtrI TspEI | || SetI |BsmAI MboII | || TaiI \\ \ \ \\ \ AAATTGCGAGACAATAACAGCAAAAAGGCGAAGAAAACCCACAAAGGCAAGGACGTGAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACGCTCTGTTATTGTCGTTTTTCCGCTTCTTTTGGGTGTTTCCGTTCCTGCACTTC // / / / // / |BsmAI MboII | | || BsrI TspEI | | |MaeII | | BtrI | TaiI | SetI Hin4II* K L R D N N S K K A K K T H K G K D V K N C E T I T A K R R R K P T K A R T * R I A R Q * Q Q K G E E N P Q R Q G R E G ----:----|----:----|----:----|----:----|----:----|----:----| F N R S L L L L F A F F V W L P L S T F L I A L C Y C C F P S S F G C L C P R S F Q S V I V A F L R L F G V F A L V H L PshAI |MaeII || SetI || TaiI || |Hpy178III* MwoI CviJI || ||Hpy99I HgiCI* HaeIII TspEI MnlI || ||| TaqII BstAPI |BsrI | Hin4II* | SetI || ||| | MaeI | NlaIV \\ \ \ \ \ \\ \\\ \ \ \ \ GCCAGTAGTAATTCAAAGAAGGTAAATGAGGACATACGTCGTGAAGCACTAGCATTGGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCATCATTAAGTTTCTTCCATTTACTCCTGTATGCAGCACTTCGTGATCGTAACCCA / / / // // / / / / / / HaeIII | TspEI |MnlI || | | TaqII | | NlaIV CviJI Hin4II* SetI || | | | BstAPI || | | | MwoI || | | MaeI || | Hpy178III* || MaeII |Hpy99I PshAI TaiI SetI A S S N S K K V N E D I R R E A L A L G P V V I Q R R * M R T Y V V K H * H W V Q * * F K E G K * G H T S * S T S I G C ----:----|----:----|----:----|----:----|----:----|----:----| A L L L E F F T F S S M R R S A S A N P P W Y Y N L S P L H P C V D H L V L M P G T T I * L L Y I L V Y T T F C * C Q T MboI BglII XhoII | DpnI | |BstKTI | || TspEI | || MboII | || | MboII DdeI | || | | TfiI BtgZI Cac8I | || | | HinfI MseI | HgaI \ \ \\ \ \ \ \ \ \ GCCAGCGAAGAAGATCTAAAATTGATTCAAGGATTAAGCGATGATGATGACGCTAAGAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCGCTTCTTCTAGATTTTAACTAAGTTCCTAATTCGCTACTACTACTGCGATTCTCG // // / / / / / / // |Cac8I || | | | | HinfI MseI |BtgZI HgiCI* || | | | | TfiI DdeI || | | | TspEI || | | MboII || | MboII || XhoII || BglII || MboI |DpnI BstKTI A S E E D L K L I Q G L S D D D D A K S P A K K I * N * F K D * A M M M T L R A Q R R R S K I D S R I K R * * * R * E R ----:----|----:----|----:----|----:----|----:----|----:----| A L S S S R F N I * P N L S S S S A L L H W R L L D L I S E L I L R H H H R * S G A F F I * F Q N L S * A I I I V S L A FokI | TfiI | HinfI | | Hpy178III* | | |MboII BceAI | | || MboI | SfaNI MnlI | | || | DpnI | | ApoI SfaNI | | || | |TspDTI | | TspEI |Hpy99I BseGI | | || | |BstKTI \ \ \ \\ \ \ \ \\ \ \\ GAACAGGAATTTGATGCCGTCGCTGACGAGGATGCTGACGACAAGGGATTCAAGAACGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCCTTAAACTACGGCAGCGACTGCTCCTACGACTGCTGTTCCCTAAGTTCTTGCTA / / / / / / / / // / // | | TspEI | MnlI SfaNI BseGI | || | |DpnI | | ApoI Hpy99I | || | BstKTI | SfaNI | || | TspDTI BceAI | || Hpy178III* HgaI | |MboII | HinfI | TfiI FokI E Q E F D A V A D E D A D D K G F K N D N R N L M P S L T R M L T T R D S R T I T G I * C R R * R G C * R Q G I Q E R S ----:----|----:----|----:----|----:----|----:----|----:----| S C S N S A T A S S S A S S L P N L F S R V P I Q H R R Q R P H Q R C P I * S R F L F K I G D S V L I S V V L S E L V I ApoI TspEI | FatI | BspHI | |CviAII AccI | |Hpy178III* MboII |Hpy166II | || NlaIII |TspDTI TaqI || MboII \ \\ \ \\ \ \\ \ CTTCAAAATTTCATGAAGAATGTAGGATTTGACCAACACAAACTCGAAGATGTAGACGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTTTTAAAGTACTTCTTACATCCTAAACTGGTTGTGTTTGAGCTTCTACATCTGCTA / // // / / // / MboI || |BspHI TspDTI TaqI || MboII || |FatI MboII |AccI || Hpy178III* Hpy166II || CviAII |NlaIII TspEI ApoI L Q N F M K N V G F D Q H K L E D V D D F K I S * R M * D L T N T N S K M * T M S K F H E E C R I * P T Q T R R C R R * ----:----|----:----|----:----|----:----|----:----|----:----| R * F K M F F T P N S W C L S S S T S S D E F N * S S H L I Q G V C V R L H L R K L I E H L I Y S K V L V F E F I Y V I MboII AciI |MaeI | BsrBI || MboII | |SmlI || |AluI TfiI | ||Hin4II* TfiI || |CviJI HinfI | |||Hpy178III* HinfI || || SetI |Bce83I* | |||| FauI \ \\ \\ \ \\ \ \\\\ \ GACGATATAGAAGAAGAATCCACTAGCTCCAAAGAATCTAAAATACCCGCTCAAGAGAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTATATCTTCTTCTTAGGTGATCGAGGTTTCTTAGATTTTATGGGCGAGTTCTCTTC / / /// / / // / / | | ||CviJI | HinfI || | FauI | | ||AluI | TfiI || Hpy178III* | | |MaeI Bce83I* || SmlI | | MboII |Hin4II* | | SetI BsrBI | MboII AciI HinfI TfiI D D I E E E S T S S K E S K I P A Q E K T I * K K N P L A P K N L K Y P L K R R R Y R R R I H * L Q R I * N T R S R E G ----:----|----:----|----:----|----:----|----:----|----:----| S S I S S S D V L E L S D L I G A * S F H R Y L L L I W * S W L I * F V R E L S V I Y F F F G S A G F F R F Y G S L L L BsrDI FatI | CviRI* TaqI |CviAII | | BplI ClaI || NspI | | BplI |PleI || CviRI* | | TaqI HinfI |BplI || NlaIII | | | SfaNI SetI | MnlI |BplI \\ \ \ \ \ \ \ \ \ \\ GAACATGCACAATCAAACATTGCATCATCGACAATAGAGAAAACCTCCCAAGAGTCAATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTACGTGTTAGTTTGTAACGTAGTAGCTGTTATCTCTTTTGGAGGGTTCTCAGTTAG / // / // / / / / / | |CviRI* BsrDI |BplI TaqI SfaNI SetI | HinfI | |FatI |BplI | BplI | CviAII CviRI* | BplI NlaIII MnlI NspI E H A Q S N I A S S T I E K T S Q E S I N M H N Q T L H H R Q * R K P P K S Q S T C T I K H C I I D N R E N L P R V N R ----:----|----:----|----:----|----:----|----:----|----:----| S C A C D F M A D D V I S F V E W S D I P V H V I L C Q M M S L L S F R G L T L F M C L * V N C * R C Y L F G G L L * D Ksp632I* Hpy166II |MnlI | BtsI |Tsp4CI* DdeI Hin4I MlyI | TspRI ||MboII CviJI MboII | Hpy188I \ \ \ \\\ \ \ \ \ GATAATGGCAGTGAACAAGAAGAAAACACAGTAGAAGAGGCTAATCTTAGTTCAGACCAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTACCGTCACTTGTTCTTCTTTTGTGTCATCTTCTCCGATTAGAATCAAGTCTGGTT / / / // / / / / / / PleI TspRI Hpy166II || | | | | | Hpy188I MlyI BtsI || | | | | DdeI ClaI || | | | Hin4I TaqI || | | MboII || | CviJI || Ksp632I* |MboII Tsp4CI* MnlI D N G S E Q E E N T V E E A N L S S D Q I M A V N K K K T Q * K R L I L V Q T K * W Q * T R R K H S R R G * S * F R P R ----:----|----:----|----:----|----:----|----:----|----:----| S L P L S C S S F V T S S A L R L E S W R Y H C H V L L F C L L L P * D * N L G I I A T F L F F V C Y F L S I K T * V L CviJI | TfiI | HinfI | | Hpy188I | | |TfiI | | |HinfI | | || AlwNI | | || |SfeI* BseRI | | || || CviRI* | SetI | | || || | PstI BccI | |MseI | | || || | | Hin4I MnlI | MnlI | ||TspEI \ \ \\ \\ \ \ \ \ \ \ \ \\\ GAGCCAGAATCAGAATCTGCAGAGAAAGAAAAGAAAGAGGAGAAAGATGGAGGTTTAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGTCTTAGTCTTAGACGTCTCTTTCTTTTCTTTCTCCTCTTTCTACCTCCAAATTAA / // / // / / / // / / / CviJI || | || | SfeI* MnlI |MnlI BseRI | TspEI || | || CviRI* BccI SetI MseI || | || Hin4I || | |PstI || | HinfI || | TfiI || AlwNI |Hpy188I HinfI TfiI E P E S E S A E K E K K E E K D G G L I S Q N Q N L Q R K K R K R R K M E V * L A R I R I C R E R K E R G E R W R F N Y ----:----|----:----|----:----|----:----|----:----|----:----| S G S D S D A S F S F F S S F S P P K I L A L I L I Q L S L F S L P S L H L N L L W F * F R C L F F L F L L F I S T * N FatI NcoI StyI SecI* DsaI* |CviAII Hpy188I || NlaIII \ \\ \ ACTCAAACTACTATTATCTCATCTGACAAACTTATTATTCCTTACGATAAACCATGGTAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTTGATGATAATAGAGTAGACTGTTTGAATAATAAGGAATGCTATTTGGTACCATA / / // / Hpy188I | || Bce83I* | |DsaI* | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII T Q T T I I S S D K L I I P Y D K P W Y L K L L L S H L T N L L F L T I N H G M S N Y Y Y L I * Q T Y Y S L R * T M V * ----:----|----:----|----:----|----:----|----:----|----:----| V * V V I I E D S L S I I G * S L G H Y * E F * * * R M Q C V * * E K R Y V M T S L S S N D * R V F K N N R V I F W P I ApoI TspEI Bce83I* |MmeI || BinI* || | MboI || | BamHI || | XhoII || | | DpnI || | | NlaIV || | | TspDTI || | | |BstKTI || | | || SmlI || | | || | BinI* StyI || | | || | | BsiYI* SecI* || | | || | | | MnlI TspEI | MboII \\ \ \ \\ \ \ \ \ \ \ \ GAAATTCCATTGGATCCTCAAGTTGGACAAAATGATGATGTTGAAGAATTATCCAAGGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAGGTAACCTAGGAGTTCAACCTGTTTTACTACTACAACTTCTTAATAGGTTCCTT / / / /// / / / / / / / MmeI | | ||| | | | MnlI | | SecI* | | ||| | | BinI* | | StyI | | ||| | | SmlI | MboII | | ||| | BsiYI* TspEI | | ||| XhoII | | ||| BamHI | | ||| MboI | | ||NlaIV | | ||DpnI | | |BstKTI | | TspDTI | BinI* TspEI ApoI E I P L D P Q V G Q N D D V E E L S K E K F H W I L K L D K M M M L K N Y P R N N S I G S S S W T K * * C * R I I Q G T ----:----|----:----|----:----|----:----|----:----|----:----| S I G N S G * T P C F S S T S S N D L S H F E M P D E L Q V F H H H Q L I I W P F N W Q I R L N S L I I I N F F * G L F AluI CviJI MnlI SetI MaeI | SetI MnlI \ \ \ \ \ \ CAGATTGAGAAACTTTTTGAAAGAGGTAAGCAAACGCTAGAAGCTGACAACCAAACTTAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTAACTCTTTGAAAAACTTTCTCCATTCGTTTGCGATCTTCGACTGTTGGTTTGAATG / / / / / / MnlI SetI | | CviJI MnlI | | AluI | SetI MaeI Q I E K L F E R G K Q T L E A D N Q T Y R L R N F L K E V S K R * K L T T K L T D * E T F * K R * A N A R S * Q P N L L ----:----|----:----|----:----|----:----|----:----|----:----| C I S F S K S L P L C V S S A S L W V * V S Q S V K Q F L Y A F A L L Q C G F K L N L F K K F S T L L R * F S V V L S V BslFI BtgZI TspDTI | Hpy166II | Cac8I FatI | | MlyI HinfI | | CviJI |CviAII | | PleI BseRI | | HaeIII || NlaIII Hpy188I \ \ \ \ \ \ \ \\ \ \ TATGAGGAGTTTACAAAGGACTCATCGCAGGCCAAGTTCATGTCCCAAATCCTATCGGAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCCTCAAATGTTTCCTGAGTAGCGTCCGGTTCAAGTACAGGGTTTAGGATAGCCTG //// / / / / / / // / // |||| | | | | HaeIII | |FatI | |Tsp4CI* |||| | | | | CviJI | CviAII | Hin4I |||| | | | | BslFI NlaIII | Hin4I |||| | | | Cac8I Hpy188I |||| | | TspDTI |||| | HinfI |||| BseRI |||PleI ||MlyI |BtgZI Hpy166II Y E E F T K D S S Q A K F M S Q I L S D M R S L Q R T H R R P S S C P K S Y R T * G V Y K G L I A G Q V H V P N P I G R ----:----|----:----|----:----|----:----|----:----|----:----| * S S N V F S E D C A L N M D W I R D S S H P T * L P S M A P W T * T G F G I P I L L K C L V * R L G L E H G L D * R V Acc65I HgiCI* Tsp4CI* |Csp6I ||RsaI ||NlaIV |||Hin4I Hpy178III* |||Hin4I Hin4I | TfiI BsrDI ||||KpnI BceAI MnlI MaeIII Hin4I | HinfI | CviRI* \\\\\ \ \ \ \ \ \ \ \ GGTACCCTCAACGATAAAATATCTGCCGTAACTTTACTCATTCAAGATTCGCCATTGCAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGGGAGTTGCTATTTTATAGACGGCATTGAAATGAGTAAGTTCTAAGCGGTAACGTA / /// / / // / // / | ||HgiCI* | MnlI |MaeIII | |BsrDI CviRI* | ||Acc65I BceAI Hin4I | HinfI | |Csp6I Hin4I | TfiI | NlaIV Hpy178III* | RsaI KpnI G T L N D K I S A V T L L I Q D S P L H V P S T I K Y L P * L Y S F K I R H C I Y P Q R * N I C R N F T H S R F A I A * ----:----|----:----|----:----|----:----|----:----|----:----| P V R L S L I D A T V K S M * S E G N C R Y G * R Y F I Q R L K V * E L N A M A T G E V I F Y R G Y S * E N L I R W Q M TaqI DdeI TspDTI |Hpy178III* \ \ \\ AACACTAAGTCTTTAGAAACTCTGGTTTCATATTGTGGCAAAAAATCGAGAAACTCTGCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGATTCAGAAATCTTTGAGACCAAAGTATAACACCGTTTTTTAGCTCTTTGAGACGA / / // DdeI TspDTI |Hpy178III* TaqI N T K S L E T L V S Y C G K K S R N S A T L S L * K L W F H I V A K N R E T L L H * V F R N S G F I L W Q K I E K L C F ----:----|----:----|----:----|----:----|----:----|----:----| L V L D K S V R T E Y Q P L F D L F E A Y C * T K L F E P K M N H C F I S F S Q V S L R * F S Q N * I T A F F R S V R S BdaI BdaI |BseMII MseI ||BspCNI |PmeI ||| MnlI |AhaIII* ||| | AluI || Hin4II* MseI ||| | CviJI \\ \ \ \\\ \ \ TTACAGAGTTTAAACGCTTTGAAGGATTTATTCTTAAATGGTCTTTTGCCCAACAGAAAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCTCAAATTTGCGAAACTTCCTAAATAAGAATTTACCAGAAAACGGGTTGTCTTTC // / / /// / / / || Hin4II* MseI ||| | | CviJI |MseI ||| | | AluI AhaIII* ||| | SetI PmeI ||| MnlI ||BspCNI |BseMII BdaI BdaI L Q S L N A L K D L F L N G L L P N R K Y R V * T L * R I Y S * M V F C P T E S T E F K R F E G F I L K W S F A Q Q K A ----:----|----:----|----:----|----:----|----:----|----:----| K C L K F A K F S K N K F P R K G L L F K V S N L R K S P N I R L H D K A W C F * L T * V S Q L I * E * I T K Q G V S L BssKI EcoRII | ScrFI | BseBI | |SetI DdeI | ||BdaI BbvCI | ||BdaI Bpu10I | |||SfaNI CviRI* |SetI SetI | |||CviJI |TspEI \\ \ \ \\\\ \\ CTGAGGTATTTCAAAAATCAACCTGGCTTATCTATGATGCTAAACAAGAAAACTCTTGCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCCATAAAGTTTTTAGTTGGACCGAATAGATACTACGATTTGTTCTTTTGAGAACGT // / // / / / |Bpu10I | || | SfaNI CviRI* |BbvCI | || EcoRII |DdeI | || BssKI SetI | || CviJI | |BseBI | |ScrFI | BdaI | BdaI SetI L R Y F K N Q P G L S M M L N K K T L A * G I S K I N L A Y L * C * T R K L L Q E V F Q K S T W L I Y D A K Q E N S C N ----:----|----:----|----:----|----:----|----:----|----:----| S L Y K L F * G P K D I I S F L F V R A A S T N * F D V Q S I * S A L C S F E Q Q P I E F I L R A * R H H * V L F S K C MseI TaqI |AhaIII* XmnI AsuII || MboII |Tsp4CI* \ \\ \ \\ ATTTTCTATTTCGAAGATTATTTAAAGAAACTGTTCTTTCGTGTTTTAGAAGTCTTGGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGATAAAGCTTCTAATAAATTTCTTTGACAAGAAAGCACAAAATCTTCAGAACCTT / / // / TspEI AsuII |MboII Tsp4CI* TaqI |MseI XmnI AhaIII* I F Y F E D Y L K K L F F R V L E V L E F S I S K I I * R N C S F V F * K S W K F L F R R L F K E T V L S C F R S L G S ----:----|----:----|----:----|----:----|----:----|----:----| I K * K S S * K F F S N K R T K S T K S L K R N R L N N L S V T R E H K L L R P N E I E F I I * L F Q E K T N * F D Q F BinI* | MboI | | DpnI MaeII FatI | | |BstKTI | SetI SspI |CviAII | | || TspEI | TaiI | MseI || NlaIII \ \ \\ \ \ \ \ \ \\ \ GTGCTTTCCCACGATCCAATTATTCACGTTAGATTACAAATATTAAATCATGTATTTGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACGAAAGGGTGCTAGGTTAATAAGTGCAATCTAATGTTTATAATTTAGTACATAAACTA / // / / / / / / / // | || MboI | | MaeII | | | |FatI | |DpnI | TaiI | | | CviAII | BstKTI | SetI | | NlaIII BinI* TspEI | MseI SspI V L S H D P I I H V R L Q I L N H V F D C F P T I Q L F T L D Y K Y * I M Y L I A F P R S N Y S R * I T N I K S C I * F ----:----|----:----|----:----|----:----|----:----|----:----| T S E W S G I I * T L N C I N F * T N S L A K G R D L * E R * I V F I L D H I Q H K G V I W N N V N S * L Y * I M Y K I ApoI TspEI | MseI | |TspEI SetI TspEI \ \\ \ \ TTATTGACCAACCAACCAGAGCAGGAATTTAATTTATTGAGATTAGGTGTAAATAAAATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTGGTTGGTTGGTCTCGTCCTTAAATTAAATAACTCTAATCCACATTTATTTTAA / / / / / | | TspEI SetI TspEI | MseI TspEI ApoI L L T N Q P E Q E F N L L R L G V N K I Y * P T N Q S R N L I Y * D * V * I K L I D Q P T R A G I * F I E I R C K * N W ----:----|----:----|----:----|----:----|----:----|----:----| K N V L W G S C S N L K N L N P T F L I N I S W G V L A P I * N I S I L H L Y F * Q G V L W L L F K I * Q S * T Y I F N TfiI HgaI HinfI |Hin4II* | HphI || TaqI AcyI | |MboII || AsuII |MmeI FokI \ \\ \\ \ \\ \ GGTGATATTGATTCCAAAGTTTCTTCGAAGGCGTCATATTTACTACTGAAGTTGGAACAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTATAACTAAGGTTTCAAAGAAGCTTCCGCAGTATAAATGATGACTTCAACCTTGTT // / / / / / / / |HinfI | | | | AcyI FokI SetI |MboII | | | MmeI |TfiI | | AsuII HphI | | TaqI | HgaI Hin4II* G D I D S K V S S K A S Y L L L K L E Q V I L I P K F L R R R H I Y Y * S W N K * Y * F Q S F F E G V I F T T E V G T S ----:----|----:----|----:----|----:----|----:----|----:----| P S I S E L T E E F A D Y K S S F N S C Q H Y Q N W L K K S P T M N V V S T P V T I N I G F N R R L R * I * * Q L Q F L AluI CviJI | SetI | BseGI | | Eco57I EcoRV | | Eco57MI | BsmAI | | |Hpy188I SfaNI TspDTI | Eco31I \ \ \\ \ \ \ \ GCTCATCCGAATATGAAATCTATTGTCATTGATGCTATCGTTGATATCGCATTGAGACCG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTAGGCTTATACTTTAGATAACAGTAACTACGATAGCAACTATAGCGTAACTCTGGC / / / // / / | | Hpy188I |TspDTI EcoRV Eco31I | Eco57MI SfaNI BsmAI | Eco57I CviJI BseGI AluI A H P N M K S I V I D A I V D I A L R P L I R I * N L L S L M L S L I S H * D R S S E Y E I Y C H * C Y R * Y R I E T E ----:----|----:----|----:----|----:----|----:----|----:----| A * G F I F D I T M S A I T S I A N L G L E D S Y S I * Q * Q H * R Q Y R M S V S M R I H F R N D N I S D N I D C Q S R AciI MseI MseI | BsmI TaqII |AhaIII* | BccI \ \ \ \\ \ \ AATGCGGATTATCATACCACTTACTATTCTGTTATTACTTTAAACCAAACCATCTTAAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGCCTAATAGTATGGTGAATGATAAGACAATAATGAAATTTGGTTTGGTAGAATTTT / / / // / / | | TaqII |MseI | BccI | AciI AhaIII* MseI BsmI N A D Y H T T Y Y S V I T L N Q T I L K M R I I I P L T I L L L L * T K P S * K C G L S Y H L L F C Y Y F K P N H L K K ----:----|----:----|----:----|----:----|----:----|----:----| F A S * * V V * * E T I V K F W V M K F S H P N D Y W K S N Q * * K L G F W R L I R I I M G S V I R N N S * V L G D * F MboI | DpnI | |MlyI | |PleI | |BstKTI | || Hpy188I | || | HinfI | || | | BbvII* ApoI | || | | | MboII TspEI TspEI \ \\ \ \ \ \ \ \ AGATCAGAAGACTCTGTTGCTAATAAATTAGTAAAAACATACTTCACTTTGTTTGAAAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGTCTTCTGAGACAACGATTATTTAATCATTTTTGTATGAAGTGAAACAAACTTTTT //// / / / |||Hpy188I | BbvII* TspEI |||MboI | MboII |||PleI HinfI ||MlyI |DpnI BstKTI R S E D S V A N K L V K T Y F T L F E K D Q K T L L L I N * * K H T S L C L K N I R R L C C * * I S K N I L H F V * K I ----:----|----:----|----:----|----:----|----:----|----:----| L D S S E T A L L N T F V Y K V K N S F F I L L S Q Q * Y I L L F M S * K T Q F S * F V R N S I F * Y F C V E S Q K F F Hpy178III* | MseI | VspI MseI MaeIII MnlI \ \ \ \ \ TTCTTGATTAATACTGATAAAGACAATACCAATGGCGTTGTTAAGAGTAACTCAAAGTCG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAACTAATTATGACTATTTCTGTTATGGTTACCGCAACAATTCTCATTGAGTTTCAGC / / / / / / | | VspI MseI | MnlI | | MseI MaeIII | Hpy178III* TspEI ApoI F L I N T D K D N T N G V V K S N S K S S * L I L I K T I P M A L L R V T Q S R L D * Y * * R Q Y Q W R C * E * L K V V ----:----|----:----|----:----|----:----|----:----|----:----| N K I L V S L S L V L P T T L L L E F D I R S * Y Q Y L C Y W H R Q * S Y S L T E Q N I S I F V I G I A N N L T V * L R Hpy166II MseI | FalI FalI |AhaIII* | FalI FalI BseRI || MboII | | Tsp4CI* \ \ \\ \ \ \ \ TATGAGGAGAAAAGAAAGAAGAACTTTAAAAAGGGTAAACACGGTGGTAAATCTGTAAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCCTCTTTTCTTTCTTCTTGAAATTTTTCCCATTTGTGCCACCATTTAGACATTTT / / /// / / / FalI BseRI ||| | | Tsp4CI* FalI ||| | Hpy166II ||| FalI ||| FalI ||MboII |MseI AhaIII* Y E E K R K K N F K K G K H G G K S V K M R R K E R R T L K R V N T V V N L * K * G E K K E E L * K G * T R W * I C K N ----:----|----:----|----:----|----:----|----:----|----:----| Y S S F L F F F K L F P L C P P L D T F T H P S F F S S S * F P Y V R H Y I Q L I L L F S L L V K F L T F V T T F R Y F TspEI TaqI TspGWI TspDTI |TspDTI TspRI \ \ \ \\ \ ATCGAAAAAACGGAAAATGAAGTTTTAGATGAAAAGAACTCAAAATTATTCAGTGCTTTG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTTTTTGCCTTTTACTTCAAAATCTACTTTTCTTGAGTTTTAATAAGTCACGAAAC / / / / // TaqI TspGWI TspDTI | |TspRI | TspEI TspDTI I E K T E N E V L D E K N S K L F S A L S K K R K M K F * M K R T Q N Y S V L C R K N G K * S F R * K E L K I I Q C F V ----:----|----:----|----:----|----:----|----:----|----:----| I S F V S F S T K S S F F E F N N L A K F R F F P F H L K L H F S S L I I * H K D F F R F I F N * I F L V * F * E T S Q MseI HgaI |HpaI DdeI |HindII | Hpy188I BspCNI TatI |Hpy166II BsmI | |TfiI |AlwNI |Csp6I || SetI CviRI* | |HinfI |BseMII ||RsaI \\ \ \ \ \\ \\ \\\ TTAACAGGTATCAATCGTGCATTCCCATTCGCTCAGATTCCAGCGTCTGTCTATGAAGTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTCCATAGTTAGCACGTAAGGGTAAGCGAGTCTAAGGTCGCAGACAGATACTTCAT // / / / // / / // // || SetI | CviRI* || | | |BseMII |Csp6I |MseI BsmI || | | BspCNI RsaI Hpy166II || | | AlwNI HindII || | HinfI HpaI || | TfiI || HgaI |DdeI Hpy188I L T G I N R A F P F A Q I P A S V Y E V * Q V S I V H S H S L R F Q R L S M K Y N R Y Q S C I P I R S D S S V C L * S T ----:----|----:----|----:----|----:----|----:----|----:----| N V P I L R A N G N A * I G A D T * S T T L L Y * D H M G M R E S E L T Q R H L * C T D I T C E W E S L N W R R D I F Y MseI NdeI TspDTI BseRI |MnlI SetI MnlI \ \ \ \\ \ \ CATATGGAAACTCTTTTCAAAATCACACACTCCTCTAACTTTAACACCTCAATCCAAGCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GTATACCTTTGAGAAAAGTTTTAGTGTGTGAGGAGATTGAAATTGTGGAGTTAGGTTCGT / / / / / / / / | | TspDTI BseRI | | SetI MnlI | NdeI | MseI TatI MnlI H M E T L F K I T H S S N F N T S I Q A I W K L F S K S H T P L T L T P Q S K H Y G N S F Q N H T L L * L * H L N P S I ----:----|----:----|----:----|----:----|----:----|----:----| C I S V R K L I V C E E L K L V E I W A V Y P F E K * F * V S R * S * C R L G L M H F S K E F D C V G R V K V G * D L C Tsp4CI* | MboI | | DpnI | | |TaqI MseI MaeIII | | |ClaI VspI Tsp45I | | |TspRI |HphI | Tsp4CI* | | |BstKTI \\ \ \ \ \ \\ TTAGTTTTGATTAATCAAGTCACCGTCAAAGCAAAGTTGAACAGTGATCGATATTATAGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAAAACTAATTAGTTCAGTGGCAGTTTCGTTTCAACTTGTCACTAGCTATAATATCT / / / / / // // | VspI Tsp4CI* | | || |ClaI | MseI Tsp45I | | || |TaqI HphI MaeIII | | || MboI | | |DpnI | | BstKTI | Tsp4CI* TspRI L V L I N Q V T V K A K L N S D R Y Y R * F * L I K S P S K Q S * T V I D I I E S F D * S S H R Q S K V E Q * S I L * N ----:----|----:----|----:----|----:----|----:----|----:----| N T K I L * T V T L A F N F L S R Y * L M L K S * D L * R * L L T S C H D I N Y * N Q N I L D G D F C L Q V T I S I I S BsiYI* | MboII | | BsrI | | |Hpy166II | | || DdeI | | || |HphI | | || |Ksp632I* \ \ \\ \\ ACATTATACGAAAGTTTATTTGACCCCAGACTGGTGAACTCTTCTAAGCAGGGTATTTAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAATATGCTTTCAAATAAACTGGGGTCTGACCACTTGAGAAGATTCGTCCCATAAATG / / / / / // | | | | | |Ksp632I* | | | | | DdeI | | | | HphI | | | Hpy166II | | BsrI | MboII BsiYI* T L Y E S L F D P R L V N S S K Q G I Y H Y T K V Y L T P D W * T L L S R V F T I I R K F I * P Q T G E L F * A G Y L L ----:----|----:----|----:----|----:----|----:----|----:----| V N Y S L K N S G L S T F E E L C P I * F M I R F N I Q G W V P S S K * A P Y K C * V F T * K V G S Q H V R R L L T N V AclI MaeII ApoI SfaNI | SetI TspEI |MseI CviRI* | TaiI CviJI \ \\ \ \ \ \ TTGAATTTACTATACAAATCATTAAAACAAGATGCACTCAACGTTGAACGAGTAGAAGCC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTAAATGATATGTTTAGTAATTTTGTTCTACGTGAGTTGCAACTTGCTCATCTTCGG / // / / / / TspEI |SfaNI | | MaeII CviJI ApoI MseI | | AclI | TaiI | SetI CviRI* L N L L Y K S L K Q D A L N V E R V E A * I Y Y T N H * N K M H S T L N E * K P E F T I Q I I K T R C T Q R * T S R S L ----:----|----:----|----:----|----:----|----:----|----:----| K F K S Y L D N F C S A S L T S R T S A S S N V I C I M L V L H V * R Q V L L L Q I * * V F * * F L I C E V N F S Y F G MaeII Hpy178III* | SetI |MboII | TaiI || ApoI | | HgiCI* || TspEI | | Hpy99I MboII || EcoRI | | | NlaIV | BsrI \\ \ \ \ \ \ \ \ TTTGTCAAGAGAATTCTTCAAGTTTGTTCTCATTGGTTGAACGTCGGCACCATTACTGGT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AAACAGTTCTCTTAAGAAGTTCAAACAAGAGTAACCAACTTGCAGCCGTGGTAATGACCA / / / // / / / / / | | EcoRI || | | | | BsrI | | TspEI || | | | MboII | | ApoI || | | HgiCI* | Hpy178III* || | NlaIV MboII || MaeII |Hpy99I TaiI SetI F V K R I L Q V C S H W L N V G T I T G L S R E F F K F V L I G * T S A P L L V C Q E N S S S L F S L V E R R H H Y W F ----:----|----:----|----:----|----:----|----:----|----:----| K T L L I R * T Q E * Q N F T P V M V P R Q * S F E E L K N E N T S R R C W * Q K D L S N K L N T R M P Q V D A G N S T TsoI MseI VspI BsrI CviJI Tsp4CI* MboII \ \ \ \ \ TTTTTCTTCTTATTAATCCAGTTGGCTAAAACAGTTCCACAAATAAAAAATCTTCTAACC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAGAAGAATAATTAGGTCAACCGATTTTGTCAAGGTGTTTATTTTTTAGAAGATTGG / // / / / | |BsrI CviJI Tsp4CI* MboII | VspI | MseI TsoI F F F L L I Q L A K T V P Q I K N L L T F S S Y * S S W L K Q F H K * K I F * P F L L I N P V G * N S S T N K K S S N Q ----:----|----:----|----:----|----:----|----:----|----:----| K K K K N I W N A L V T G C I F F R R V N K R R I L G T P * F L E V F L F D E L K E E * * D L Q S F C N W L Y F I K * G SfaNI | TfiI | HinfI | | Hpy188I | | | Ksp632I* | | | |MnlI BsrI | | | ||CviRI* | Hin4I | | | ||| TspDTI | | TsoI | | | ||| | Hin4I MboII BseRI \ \ \ \ \ \ \\\ \ \ \ \ AACACGCCAGTTGATTACGAGTATGAATCTGATGCAGAAGAGGAGCAAGGGGACAAGGAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGCGGTCAACTAATGCTCATACTTAGACTACGTCTTCTCCTCGTTCCCCTGTTCCTG / / / // / //// / / | TsoI | || | |||Hin4I | BseRI Hin4I | || | ||TspDTI MboII BsrI | || | |Ksp632I* | || | CviRI* | || MnlI | |Hpy188I | HinfI | TfiI SfaNI N T P V D Y E Y E S D A E E E Q G D K D T R Q L I T S M N L M Q K R S K G T R T H A S * L R V * I * C R R G A R G Q G H ----:----|----:----|----:----|----:----|----:----|----:----| L V G T S * S Y S D S A S S S C P S L S W C A L Q N R T H I Q H L L P A L P C P V R W N I V L I F R I C F L L L P V L V CfrI XmaIII* |Hpy99I ||CviJI ||HaeIII |||AciI |||BisI |||McrI* ||||BlsI |||||TauI |||||| BinI* |||||| Cac8I |||||| | MboI |||||| | | DpnI Hin4II* |||||| | | |BceAI |BslFI |||||| | | |BstKTI MboII \\ \\\\\\ \ \ \\ \ ATAAAAAGGAAGGAATACGACGGCCGCAAGCGTGATCCAAAGTTCGCCAATGCTGAAAAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTTCCTTCCTTATGCTGCCGGCGTTCGCACTAGGTTTCAAGCGGTTACGACTTTTT / / / ///// // // // / | BslFI | ||||| || || |BceAI MboII Hin4II* | ||||| || || MboI | ||||| || |DpnI | ||||| || BstKTI | ||||| |BinI* | ||||| Cac8I | ||||AciI | |||XmaIII* | |||CfrI | |||BisI | ||BlsI | |HaeIII | |CviJI | |TauI | McrI* Hpy99I I K R K E Y D G R K R D P K F A N A E K * K G R N T T A A S V I Q S S P M L K N K K E G I R R P Q A * S K V R Q C * K I ----:----|----:----|----:----|----:----|----:----|----:----| M F L F S Y S P R L R S G F N A L A S F C L F S P I R R G C A H D L T R W H Q F Y F P L F V V A A L T I W L E G I S F F FokI TspDTI | TspDTI BseGI Tsp4CI* NdeI \ \ \ \ \ \ TCTTCTTTATGGGAAATCAACAACTTCATCAATCATTTTCATCCTACTGTGAAAACATAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGAAATACCCTTTAGTTGTTGAAGTAGTTAGTAAAAGTAGGATGACACTTTTGTATA / / / / / / TspDTI | FokI BseGI Tsp4CI* NdeI TspDTI S S L W E I N N F I N H F H P T V K T Y L L Y G K S T T S S I I F I L L * K H M F F M G N Q Q L H Q S F S S Y C E N I C ----:----|----:----|----:----|----:----|----:----|----:----| D E K H S I L L K M L * K * G V T F V Y I K K I P F * C S * * D N E D * Q S F M R R * P F D V V E D I M K M R S H F C I BssKI EcoRII |SecI* ||ScrFI ||BseBI AluI ||BsiYI* MaeIII CviJI |||SetI CviRI* Tsp45I | SetI |||PshAI \ \ \ \ \\\\ GCAAACGCCTATGTGACAGGAGAAACAGAGCAAATAGCTAAACCAGACCTGGGTCTATTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTGCGGATACACTGTCCTCTTTGTCTCGTTTATCGATTTGGTCTGGACCCAGATAAA / / / / / / / CviRI* Tsp45I | CviJI | | EcoRII MaeIII | AluI | | BssKI SetI | | SecI* | PshAI | BseBI | ScrFI BsiYI* SetI A N A Y V T G E T E Q I A K P D L G L F Q T P M * Q E K Q S K * L N Q T W V Y L K R L C D R R N R A N S * T R P G S I Y ----:----|----:----|----:----|----:----|----:----|----:----| A F A * T V P S V S C I A L G S R P R N H L R R H S L L F L A F L * V L G P D I C V G I H C S F C L L Y S F W V Q T * K DrdI | AccI | |SfeI* | |Hpy166II MnlI \ \\ \ ACTCTATCACACTTCCTTGACAGATTTGTCTACAGAAGTGCCAAGCAGACCAATACAGCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGATAGTGTGAAGGAACTGTCTAAACAGATGTCTTCACGGTTCGTCTGGTTATGTCGT / // / / DrdI || SfeI* MnlI |AccI Hpy166II T L S H F L D R F V Y R S A K Q T N T A L Y H T S L T D L S T E V P S R P I Q Q S I T L P * Q I C L Q K C Q A D Q Y S K ----:----|----:----|----:----|----:----|----:----|----:----| V R D C K R S L N T * L L A L C V L V A * E I V S G Q C I Q R C F H W A S W Y L S * * V E K V S K D V S T G L L G I C C MnlI | CviJI | | BsiI* | | Hpy178III* Csp6I | | | MlyI HinfI |RsaI CviRI* | | | PleI | Tth111I |SetI | SetI | | | |MseI | | DdeI \\ \ \ \ \ \ \\ \ \ \ AGAGGTACATCTATTATGCAACCTCTGTTTAGTGGCTCACGAGTTAATGACTCTGTCTTA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCATGTAGATAATACGTTGGAGACAAATCACCGAGTGCTCAATTACTGAGACAGAAT / // / / / / / /// / // / | |Csp6I | SetI | | | ||| MseI || DdeI | RsaI CviRI* | | | ||PleI |Tth111I SetI | | | |MlyI HinfI | | | BsiI* | | Hpy178III* | CviJI MnlI R G T S I M Q P L F S G S R V N D S V L E V H L L C N L C L V A H E L M T L S * R Y I Y Y A T S V * W L T S * * L C L S ----:----|----:----|----:----|----:----|----:----|----:----| L P V D I I C G R N L P E R T L S E T K L L Y M * * A V E T * H S V L * H S Q R S T C R N H L R Q K T A * S N I V R D * Hpy188I | SfaNI | |BslFI | || FatI | || CviRI* | || |CviAII | || ||EcoT22I | || ||| NlaIII | || ||| |BssKI | || ||| |EcoRII | || ||| ||SecI* | || ||| |||ScrFI | || ||| |||BseBI | || ||| ||||PshAI | || ||| ||||| AsuI* | || ||| ||||| AvaII | || ||| ||||| DraII | || ||| ||||| PpuMI | || ||| ||||| SanDI TspRI | || ||| ||||| |NlaIV | BbvII* | || ||| ||||| |BmgT120I | |CviJI | || ||| ||||| || Hpy166II | ||BsrI MseI | || ||| ||||| ||NlaIV | TsoI | ||| MboII \ \ \\ \\\ \\\\\ \\\ \ \ \ \\\ \ GTTAAGGCATCTGATATTATGCATGACCAGGGTCCCGTGAACACTGAAGACTGGCTAACT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTCCGTAGACTATAATACGTACTGGTCCCAGGGCACTTGTGACTTCTGACCGATTGA / / /// // / //// // // / MseI Hpy188I ||| || | |||| |TsoI || BbvII* ||| || | |||| Hpy166II || MboII ||| || | |||| TspRI |CviJI ||| || | |||SanDI BsrI ||| || | |||PpuMI ||| || | |||DraII ||| || | |||AvaII ||| || | |||AsuI* ||| || | ||BmgT120I ||| || | ||NlaIV ||| || | |NlaIV ||| || | EcoRII ||| || | BssKI ||| || | SecI* ||| || PshAI ||| || BseBI ||| || ScrFI ||| |FatI ||| CviAII ||CviRI* ||NlaIII ||BslFI |SfaNI EcoT22I V K A S D I M H D Q G P V N T E D W L T L R H L I L C M T R V P * T L K T G * L * G I * Y Y A * P G S R E H * R L A N * ----:----|----:----|----:----|----:----|----:----|----:----| T L A D S I I C S W P G T F V S S Q S V L * P M Q Y * A H G P D R S C Q L S A L N L C R I N H M V L T G H V S F V P * S Eco57I Eco57I MboII ApoI Eco57MI Eco57MI EcoRV | SetI TspEI MboII | SspI \ \ \ \ \ \ \ \ AAAAAAGTTGAAGATATCAAACCTGAAGATAAATTCTTTTATCAATATTTCACTACCAAG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCAACTTCTATAGTTTGGACTTCTATTTAAGAAAATAGTTATAAAGTGATGGTTC / / // // / / Eco57MI | |MboII |MboII | SspI Eco57I | SetI TspEI Eco57MI EcoRV ApoI Eco57I K K V E D I K P E D K F F Y Q Y F T T K K K L K I S N L K I N S F I N I S L P R K S * R Y Q T * R * I L L S I F H Y Q E ----:----|----:----|----:----|----:----|----:----|----:----| L F T S S I L G S S L N K * * Y K V V L * F L Q L Y * V Q L Y I R K D I N * * W F F N F I D F R F I F E K I L I E S G L BccI TspEI |AciI | SfaNI || NspBII* | |TaqI \\ \ \ \\ AAAACCGCTGATGGAAAAGGAAAGAAATCTAACAAAGCATCTAATTTCGATAGTGATGAC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGGCGACTACCTTTTCCTTTCTTTAGATTGTTTCGTAGATTAAAGCTATCACTACTG / / / // | NspBII* | |SfaNI | AciI | TaqI BccI TspEI K T A D G K G K K S N K A S N F D S D D K P L M E K E R N L T K H L I S I V M T N R * W K R K E I * Q S I * F R * * * R ----:----|----:----|----:----|----:----|----:----|----:----| F V A S P F P F F D L L A D L K S L S S S F R Q H F L F S I * C L M * N R Y H H F G S I S F S L F R V F C R I E I T I V BseGI | ApoI | TspEI | | FokI | | | TsoI | | | |TspDTI | | | || TspDTI | | | || | MseI | | | || | |BsmAI | | | || | |Eco31I | | | || | || TaqI | | | || | || |Hpy178III* \ \ \ \\ \ \\ \\ GAAATGGATGAAAATGAAATTTGGAGTGCTTTGGTTAAATCGAGACCAGATGTTGAAGAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACCTACTTTTACTTTAAACCTCACGAAACCAATTTAGCTCTGGTCTACAACTTCTA / // / / / / // BseGI || | TspDTI | | |Hpy178III* || FokI | | TaqI |TspDTI | Eco31I |TspEI | BsmAI |ApoI MseI TsoI E M D E N E I W S A L V K S R P D V E D K W M K M K F G V L W L N R D Q M L K M N G * K * N L E C F G * I E T R C * R * ----:----|----:----|----:----|----:----|----:----|----:----| S I S S F S I Q L A K T L D L G S T S S R F P H F H F K S H K P * I S V L H Q L F H I F I F N P T S Q N F R S W I N F I MboII | TfiI | HinfI | | Eco57I MboII | | Eco57MI | Hpy99I | | | SpeI | | Tsp4CI* | | | |MaeI | | | Hpy166II | | | || MaeIII | | | | TspRI | | | || Tsp45I \ \ \ \ \ \ \ \ \\ \ GATAGCGACGACAGTGAACTTGACTTCGCTGAAGATGATTTCAGCGATTCAACTAGTGAC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCGCTGCTGTCACTTGAACTGAAGCGACTTCTACTAAAGTCGCTAAGTTGATCACTG // / / / / // // / || | | Hpy166II MboII |HinfI || Tsp45I || | Tsp4CI* |TfiI || MaeIII || TspRI | |SpeI |MboII | MaeI Hpy99I Eco57MI Eco57I D S D D S E L D F A E D D F S D S T S D I A T T V N L T S L K M I S A I Q L V T * R R Q * T * L R * R * F Q R F N * * R ----:----|----:----|----:----|----:----|----:----|----:----| S L S S L S S S K A S S S K L S E V L S H Y R R C H V Q S R Q L H N * R N L * H I A V V T F K V E S F I I E A I * S T V DdeI Bpu10I |SetI || AluI || CviJI Hin4II* || | SetI | MboII || | | TspDTI | |TspDTI || | | | MfeI | || TseI || | | | TspEI | || |BisI || | | | | SfaNI | || ||BlsI || | | | | |HgaI | || |||CviJI MwoI \\ \ \ \ \ \\ \ \\ \\\\ \ GATGAACCTAAGCTGGACGCAATTGATGATGAAGATGCTAAAAGTGAAGGCAGCCAAGAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTGGATTCGACCTGCGTTAACTACTACTTCTACGATTTTCACTTCCGTCGGTTCTT / /// / / / / / / /// / SetI ||| TspDTI | | HgaI | TspDTI ||| MwoI ||CviJI | SfaNI | MboII ||CviJI ||AluI TspEI Hin4II* ||TseI |Bpu10I MfeI |BisI |DdeI BlsI SetI D E P K L D A I D D E D A K S E G S Q E M N L S W T Q L M M K M L K V K A A K K * T * A G R N * * * R C * K * R Q P R K ----:----|----:----|----:----|----:----|----:----|----:----| S S G L S S A I S S S S A L L S P L W S R H V * A P R L Q H H L H * F H L C G L I F R L Q V C N I I F I S F T F A A L F BbvI |MboI || DpnI || |BstKTI || ||Hin4II* || ||Hpy178III* || ||| StuI || ||| CviJI || ||| HaeIII || ||| |MnlI || ||| || TaqI || ||| || | EcoNI || ||| || | MboII BccI || ||| || | | BsiYI* Tsp4CI* || ||| || | | | MnlI | TaqI \\ \\\ \\ \ \ \ \ \ \ AGCGATCAAGAAGAAGGCCTCGATGAGGATATTTTTTACAGTTTCGATGGAGAACAAGAC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTAGTTCTTCTTCCGGAGCTACTCCTATAAAAAATGTCAAAGCTACCTCTTGTTCTG //// / / /// / / / / |||| | | ||| MnlI | BccI TaqI |||| | | ||EcoNI Tsp4CI* |||| | | |TaqI |||| | | BsiYI* |||| | | MboII |||| | HaeIII |||| | CviJI |||| | StuI |||| | MnlI |||| Hpy178III* |||MboI ||Hin4II* ||BbvI |DpnI BstKTI S D Q E E G L D E D I F Y S F D G E Q D A I K K K A S M R I F F T V S M E N K T R S R R R P R * G Y F L Q F R W R T R Q ----:----|----:----|----:----|----:----|----:----|----:----| L S * S S P R S S S I K * L K S P S C S F R D L L L G R H P Y K K C N R H L V L A I L F F A E I L I N K V T E I S F L V AclI MboII MaeII Hin4II* |TseI | SetI | Ksp632I* ||BisI | TaiI | |MnlI |||BlsI \ \ \ \\ \\\\ AATAGTGATAAAAAACGTTCCTTCGCTGAAAGTAGTGAAGAGGACGAGAGCAGCGAAGAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCACTATTTTTTGCAAGGAAGCGACTTTCATCACTTCTCCTGCTCTCGTCGCTTCTT / / / / / / /// | MaeII | | Ksp632I* | ||TseI | AclI | MnlI | |BisI TaiI Hin4II* | BlsI SetI MboII N S D K K R S F A E S S E E D E S S E E I V I K N V P S L K V V K R T R A A K K * * * K T F L R * K * * R G R E Q R R R ----:----|----:----|----:----|----:----|----:----|----:----| L L S L F R E K A S L L S S S S L L S S C Y H Y F V N R R Q F Y H L P R S C R L I T I F F T G E S F T T F L V L A A F F MnlI |MboII || MboII || | MboII MboII || | | SetI BciVI BbvI | MboII || | | | AciI |MwoI MboII \ \ \ \\ \ \ \ \ \\ \ GAAAAAGAAGAAGAAGAAAATAAAGAGGTATCCGCAAAAAGAGCAAAGAAGAAGCAGAGA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTCTTCTTCTTCTTTTATTTCTCCATAGGCGTTTTTCTCGTTTCTTCTTCGTCTCT / / // / // / // / | MboII || | |SetI | |BciVI MboII MboII || | MboII | MwoI BbvI || MboII AciI |MboII MnlI E K E E E E N K E V S A K R A K K K Q R K K K K K K I K R Y P Q K E Q R R S R E K R R R R K * R G I R K K S K E E A E K ----:----|----:----|----:----|----:----|----:----|----:----| S F S S S S F L S T D A F L A F F F C L L F L L L L F Y L P I R L F L L S S A S F F F F F F I F L Y G C F S C L L L L S AccI |Hpy166II || AgeI || BetI* || Cfr10I BcgI SfaNI || |HpaII | CviRI* | Hpy99I SspI MboI \\ \\ \ \ \ \ \ \ AAGAATATGCTCAAAAGTCTACCGGTATTTGCATCTGCCGACGATTATGCTCAATATTTA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTATACGAGTTTTCAGATGGCCATAAACGTAGACGGCTGCTAATACGAGTTATAAAT // /// / / / / / || ||BcgI CviRI* | SfaNI SspI BcgI || |Cfr10I Hpy99I || |BetI* || |AgeI || HpaII |AccI Hpy166II K N M L K S L P V F A S A D D Y A Q Y L R I C S K V Y R Y L H L P T I M L N I * E Y A Q K S T G I C I C R R L C S I F R ----:----|----:----|----:----|----:----|----:----|----:----| F F I S L L R G T N A D A S S * A * Y K F S Y A * F D V P I Q M Q R R N H E I N L I H E F T * R Y K C R G V I I S L I * DpnI BcgI |BstKTI ||Hpy178III* ||| TfiI ||| HinfI ||| | Hpy188I ||| | | MaeI \\\ \ \ \ GATCAAGATTCAGACTAG 3070 ----:----|----:--- CTAGTTCTAAGTCTGATC // / / // / || | | || MaeI || | | |Hpy188I || | | HinfI || | | TfiI || | Hpy178III* || MboI |DpnI BstKTI D Q D S D * I K I Q T X S R F R L X ----:----|----:--- S * S E S * L D L N L S I L I * V L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 6 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AluI 6 AluBI AlwNI 2 CaiI ApoI 9 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvCI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 2 BpuEI BceAI 4 BcgI 1 BciVI 1 BfuI BdaI 2 BetI* 1 BsaWI BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BplI 2 Bpu10I 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BseRI 5 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstAPI 1 BstKTI 9 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 3 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 6 CviJI 18 CviKI-1 CviRI* 12 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 9 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 6 FauI 1 SmuI FokI 4 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I Hin4I 4 Hin4II* 9 HpyAV HindII 1 HincII HinfI 16 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 10 Hpy99I 6 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 5 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 36 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 4 SchI MmeI 2 MnlI 21 MseI 20 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 2 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PleI 4 PpsI PmeI 1 MssI PpuMI 1 Psp5II,PspPPI PshAI 3 BstPAI,BoxI PstI 1 RsaI 3 AfaI SanDI 1 ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 27 SfaNI 11 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 12 TaqII 2 TatI 1 TauI 1 TfiI 12 PfeI TseI 2 ApeKI TsoI 4 Tsp45I 3 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 16 TspEI 22 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 5 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 3 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AflII AflIII AjuI AlfI AloI ApaI ApaLI AscI AvaI AvrII BaeI BalI BarI BclI BfiI BglI BmeT110I BmtI BsaAI BsaBI BsaXI BsePI BseSI BseYI BsgI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstEII BstXI BstZ17I CauII* Cfr9I CspCI DinI DraIII Eam1105I EciI Ecl136II Eco47III EcoICRI EcoP15I EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI MauBI MluI MroNI MslI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PpiI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI XbaI XcmI XhoI XmaCI XmaI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769