Restriction Map of REG1/YDR028C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

REG1/YDR028C on chromosome IV from coordinates 500879 to 497835.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27680

EMBOSS_001 FatI HindII |CviAII Hpy166II Cfr10I || NspI | MaeI TspEI |HpaII || NlaIII \ \ \ \\ \\ \ ATGTCAACAAATCTAGCAAATTACTTCGCCGGTAAGAAAGATATTGAAAACGAGCATGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTGTTTAGATCGTTTAATGAAGCGGCCATTCTTTCTATAACTTTTGCTCGTACAT / / / // / // Hpy166II MaeI TspEI |Cfr10I | |FatI HindII HpaII | CviAII NlaIII NspI M S T N L A N Y F A G K K D I E N E H V C Q Q I * Q I T S P V R K I L K T S M * V N K S S K L L R R * E R Y * K R A C K ----:----|----:----|----:----|----:----|----:----|----:----| X D V F R A F * K A P L F S I S F S C T X T L L D L L N S R R Y S L Y Q F R A H H * C I * C I V E G T L F I N F V L M Y Cac8I | CviJI | |FatI | ||CviAII CspCI | ||| NlaIII | TspDTI TspEI MaeIII \ \\\ \ \ \ \ \ AATAGAAATGCGAGCCATGAAAGTAATAGCAAAAGTGATGTCAAAATTAGTGGTAACGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTTTACGCTCGGTACTTTCATTATCGTTTTCACTACAGTTTTAATCACCATTGCTA / // // / / / / | || |FatI | TspDTI TspEI MaeIII | || CviAII CspCI | |NlaIII | CviJI Cac8I N R N A S H E S N S K S D V K I S G N D I E M R A M K V I A K V M S K L V V T I * K C E P * K * * Q K * C Q N * W * R * ----:----|----:----|----:----|----:----|----:----|----:----| F L F A L W S L L L L L S T L I L P L S L Y F H S G H F Y Y C F H H * F * H Y R I S I R A M F T I A F T I D F N T T V I AsuI* DraII |NlaIV |BmgT120I ||CviJI ||HaeIII |||MboII |||| BccI |||| | TaqI Eco57I |||| | ClaI Eco57MI |||| | |Hin4II* CspCI | Hpy99I |||| | || CviJI MwoI \ \ \ \\\\ \ \\ \ \ AACGACAACGACGAAGATATGGGGCCTTCAGTATCGATGGCTGTTCAAGCGAAAAATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGTTGCTGCTTCTATACCCCGGAAGTCATAGCTACCGACAAGTTCGCTTTTTACTA / // /// / / / / / | |Eco57MI ||DraII | | | | MwoI | |Eco57I ||AsuI* | | | CviJI | Hpy99I || | | ClaI CspCI || | | TaqI || | Hin4II* || BccI |BmgT120I |HaeIII |MboII |CviJI NlaIV N D N D E D M G P S V S M A V Q A K N D T T T T K I W G L Q Y R W L F K R K M M R Q R R R Y G A F S I D G C S S E K * * ----:----|----:----|----:----|----:----|----:----|----:----| L S L S S S I P G E T D I A T * A F F S Y R C R R L Y P A K L I S P Q E L S F H V V V V F I H P R * Y R H S N L R F I I MboI | DpnI | |BstKTI | || AsuI* | || |BmgT120I | || ||CviJI MseI | || ||HaeIII SetI | || ||| Hpy178III* \ \ \\ \\\ \ GATGATTTCCATAAATCAACTTTCAACCTTAAAAGAACAAGATCAATGGGCCTTCTTGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAAAGGTATTTAGTTGAAAGTTGGAATTTTCTTGTTCTAGTTACCCGGAAGAACTA / / // / // / / SetI MseI || MboI |AsuI* | Hin4II* |DpnI | Hpy178III* BstKTI BmgT120I HaeIII CviJI D D F H K S T F N L K R T R S M G L L D M I S I N Q L S T L K E Q D Q W A F L M * F P * I N F Q P * K N K I N G P S * * ----:----|----:----|----:----|----:----|----:----|----:----| S S K W L D V K L R L L V L D I P R R S H H N G Y I L K * G * F F L I L P G E Q I I E M F * S E V K F S C S * H A K K I TspEI | Hin4II* SetI Hin4II* TspDTI | | MaeI | Hpy188I \ \ \ \ \ \ \ GAATATATTGACCCTACCAAGAAATTGCTAGGAAGGTCAGACGACTTATATGATAACGAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATATAACTGGGATGGTTCTTTAACGATCCTTCCAGTCTGCTGAATATACTATTGCTG / // / / / / TspDTI || | SetI Hpy188I Hin4I || MaeI Hin4I |TspEI Hin4II* E Y I D P T K K L L G R S D D L Y D N D N I L T L P R N C * E G Q T T Y M I T T I Y * P Y Q E I A R K V R R L I * * R Q ----:----|----:----|----:----|----:----|----:----|----:----| S Y I S G V L F N S P L D S S K Y S L S H I Y Q G * W S I A L F T L R S I H Y R F I N V R G L F Q * S P * V V * I I V V TspDTI | MboII | | FalI | | FalI | | TspEI | | | Eco57I | | | Eco57MI | | | | MboII Hin4I | | | | |Hin4I Hpy188I Hin4I | | | | |Hin4I | BdaI FalI | SspI | | | | || TspEI | BdaI FalI \ \ \ \ \ \ \\ \ \ \ \ AATGAATATTATGACAACTCATCTAATAATTCTTCAAGCAATTCTTCAGATGATGATTAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTATAATACTGTTGAGTAGATTATTAAGAAGTTCGTTAAGAAGTCTACTACTAATA / / / / / / / / / / SspI TspDTI | | | MboII | | | FalI | | Hin4I | | | FalI | | Hin4I | | BdaI | | TspEI | | BdaI | Eco57MI | Hpy188I | Eco57I TspEI MboII FalI FalI N E Y Y D N S S N N S S S N S S D D D Y M N I M T T H L I I L Q A I L Q M M I M * I L * Q L I * * F F K Q F F R * * L * ----:----|----:----|----:----|----:----|----:----|----:----| L S Y * S L E D L L E E L L E E S S S * C H I N H C S M * Y N K L C N K L H H N I F I I V V * R I I R * A I R * I I I I MnlI | AciI | BsaXI CviJI | | TstI | TstI | | MroNI | BsaXI | | SgrAI | | Hpy178III* | | Cfr10I | | | TspGWI | | Sse232I* | | | | BceAI | | |HpaII | | | | | BdaI | | ||NaeI | | | | | BdaI | | ||Cac8I AluI | | | | | | SetI | | ||| AciI CviJI \ \ \ \ \ \ \ \ \ \\\ \ \ GATGACGGCTATCAGGAACACTCAACCTCCGTTTCTCCACCGCCGGCGGATAATGATAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCCGATAGTCCTTGTGAGTTGGAGGCAAAGAGGTGGCGGCCGCCTATTACTATCG / // // // / / / /// / / / | |CviJI |TspGWI |BdaI | | | ||| AciI | CviJI | BsaXI | |BdaI | | | ||Sse232I* | EciI TstI | |SetI | | | ||Cfr10I | AluI | BceAI | | | ||SgrAI SetI Hpy178III* | | | ||MroNI | | | |HpaII | | | Cac8I | | | NaeI | | AciI | BsaXI | TstI MnlI D D G Y Q E H S T S V S P P P A D N D S M T A I R N T Q P P F L H R R R I M I A * R L S G T L N L R F S T A G G * * * L ----:----|----:----|----:----|----:----|----:----|----:----| S S P * * S C E V E T E G G G A S L S L H H R S D P V S L R R K E V A P P Y H Y I V A I L F V * G G N R W R R R I I I A Hin4I Hin4I | FatI | AflIII | BspLU11I* | |CviAII | || NspI SetI | || NlaIII EciI MaeII | || | HindII | MseI | SetI | || | Hpy166II | |TspEI | TaiI CviJI | || | | Eam1105I \ \\ \ \ \ \ \\ \ \ \ TACTTAATTCCACAAGATGATAATGACGTAGTGGTAGAGCCAGAAAGACATGTTGACTAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAATTAAGGTGTTCTACTATTACTGCATCACCATCTCGGTCTTTCTGTACAACTGATA / / / / / / / // / / | TspEI | MaeII | Hin4I | || | Eam1105I MseI TaiI | Hin4I | || Hpy166II SetI CviJI | || HindII | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI Y L I P Q D D N D V V V E P E R H V D Y T * F H K M I M T * W * S Q K D M L T I L N S T R * * * R S G R A R K T C * L S ----:----|----:----|----:----|----:----|----:----|----:----| * K I G C S S L S T T T S G S L C T S * S S L E V L H Y H R L P L A L F V H Q S V * N W L I I I V Y H Y L W F S M N V I Hin4I Hin4I MaeIII |TfiI Tsp45I |HinfI | FatI || TspDTI | |CviAII || |Hpy188I | || MslI || || ApoI TspEI | || |NlaIII || || TspEI | FokI BseGI \ \\ \\ \\ \\ \ \ \ \ CTGTCACATGAATGGAAAGAATCAGAAATTTCTAATTCTTGGAAATATATCATCCTAAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGTGTACTTACCTTTCTTAGTCTTTAAAGATTAAGAACCTTTATATAGTAGGATTTC // // / /// / / / / || || Hin4I ||| TspEI | FokI BseGI || || Hin4I ||| ApoI TspEI || |FatI ||Hpy188I || CviAII |HinfI || MslI |TfiI |Tsp45I TspDTI |MaeIII NlaIII L S H E W K E S E I S N S W K Y I I L K C H M N G K N Q K F L I L G N I S S * R V T * M E R I R N F * F L E I Y H P K E ----:----|----:----|----:----|----:----|----:----|----:----| R D C S H F S D S I E L E Q F Y I M R F D T V H I S L I L F K * N K S I Y * G L Q * M F P F F * F N R I R P F I D D * L BsaBI |BbvI |MboI TseI FatI || DpnI |BisI |CviAII || |BstKTI ||BlsI || NlaIII || ||MaeI ||| MaeI SetI || | MnlI \\ \\\ \\\ \ \ \\ \ \ AAAAAGAAAAGAGATGTTGATCTAGTAAATGCTGCTAGGTTAGAAAATGCCTCATGGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCTTTTCTCTACAACTAGATCATTTACGACGATCCAATCTTTTACGGAGTACCTCT / // / / /// // / // / | || | MaeI ||| |MaeI | || MnlI | || MboI ||| SetI | |FatI | || BbvI ||TseI | CviAII | |DpnI |BisI NlaIII | BstKTI BlsI BsaBI K K K R D V D L V N A A R L E N A S W R K R K E M L I * * M L L G * K M P H G E K E K R C * S S K C C * V R K C L M E N ----:----|----:----|----:----|----:----|----:----|----:----| F F F L S T S R T F A A L N S F A E H L S F S F L H Q D L L H Q * T L F H R M S F L F S I N I * Y I S S P * F I G * P S HphI | Tsp4CI* | | MaeIII | | Tsp45I FatI | | | TsoI |CviAII | | | |TspRI MseI || NlaIII | | | || SetI |TspEI \\ \ \ \ \ \\ \ \\ ACATGGGCAAAAGCAAGAAACAACTTGAAAACAGTGTCACCTGAAGTGGTTAATTGGTCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACCCGTTTTCGTTCTTTGTTGAACTTTTGTCACAGTGGACTTCACCAATTAACCAGT / // // / / / / / / / | |FatI || | | | Tsp45I | | Eco57MI | CviAII || | | | MaeIII | | Eco57I NlaIII || | | SetI | TspEI || | TsoI MseI || Tsp4CI* |TspRI HphI T W A K A R N N L K T V S P E V V N W S H G Q K Q E T T * K Q C H L K W L I G Q M G K S K K Q L E N S V T * S G * L V K ----:----|----:----|----:----|----:----|----:----|----:----| V H A F A L F L K F V T D G S T T L Q D F M P L L L F C S S F L T V Q L P * N T C P C F C S V V Q F C H * R F H N I P * Eco57I Eco57MI | TfiI | HinfI TfiI | | TsoI AsuI* HinfI | | Hpy188I |CviJI Hin4II* | | | MaeIII |HaeIII | Hpy188I | | | Tsp45I CviJI |BmgT120I | | SetI \ \ \ \ \ \\ \ \ \ AAAGATTCTGATGTGACTTGGCTATATGGCCCTATTGTAAGAGATTCTGAAGGTAATGCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTAAGACTACACTGAACCGATATACCGGGATAACATTCTCTAAGACTTCCATTACGG // / / /// / // / |Hpy188I | CviJI ||AsuI* | || SetI HinfI Tsp45I |BmgT120I | |Hpy188I TfiI MaeIII HaeIII | HinfI TsoI CviJI | TfiI Hin4II* K D S D V T W L Y G P I V R D S E G N A K I L M * L G Y M A L L * E I L K V M P R F * C D L A I W P Y C K R F * R * C P ----:----|----:----|----:----|----:----|----:----|----:----| F S E S T V Q S Y P G I T L S E S P L A L L N Q H S K A I H G * Q L L N Q L Y H F I R I H S P * I A R N Y S I R F T I G Eco57I Eco57MI | FatI | |CviAII | || MboI | || |MboII | || |NlaIII | || ||DpnI | || |||XbaI | || |||BstKTI Hpy188I | || ||||MnlI | BseGI | || ||||MaeI | | ApoI | || ||||MboII | | TspEI | || ||||Hpy178III* | | | FokI \ \\ \\\\\ \ \ \ \ CAAAGTGAAGAAGAACATGATCTAGAAAGAGGATATGGTTCGGATGATGAAAATTCCAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCACTTCTTCTTGTACTAGATCTTTCTCCTATACCAAGCCTACTACTTTTAAGGTTC / / ///// // / / / // Eco57MI | ||||| |XbaI | BseGI | |TspDTI Eco57I | ||||| Hpy178III* Hpy188I | FokI | ||||| MaeI TspEI | ||||MboI ApoI | |||MboII | |||MnlI | ||DpnI | |BstKTI | |FatI | CviAII | MboII NlaIII Q S E E E H D L E R G Y G S D D E N S K K V K K N M I * K E D M V R M M K I P R K * R R T * S R K R I W F G * * K F Q E ----:----|----:----|----:----|----:----|----:----|----:----| W L S S S C S R S L P Y P E S S S F E L G F H L L V H D L F L I H N P H H F N W L T F F F M I * F S S I T R I I F I G L BbvI | TaqI | |MboI | || DpnI | || |PvuI | || |McrI* | || |BstKTI | || || TseI | || || |BisI | || || ||BlsI | || || |||TseI | || || |||AluI | || || |||CviJI | || || |||PvuII | || || |||NspBII* | || || |||| Hpy188I ApoI | || || ||||BisI | BbvI TspEI ApoI | || || |||||BlsI | | TspEI TspDTI TspEI | || || |||||SetI | | | Ksp632I* \ \ \ \\ \\ \\\\\\ \ \ \ \ AGAATTTCAATGCCCACTAAAAATTCAAAGTCGATCGCAGCTGCTCCGAAACCAATTTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAAAGTTACGGGTGATTTTTAAGTTTCAGCTAGCGTCGACGAGGCTTTGGTTAAAAC / / / // / ////// / / / TspEI TspEI | || | |||||| | | TspEI ApoI ApoI | || | |||||| | BbvI | || | |||||| Hpy188I | || | |||||TseI | || | ||||BisI | || | |||BlsI | || | ||NspBII* | || | ||PvuII | || | ||CviJI | || | ||TseI | || | ||AluI | || | |BisI | || | BlsI | || | SetI | || MboI | |DpnI | BstKTI | McrI* | TaqI | PvuI BbvI R I S M P T K N S K S I A A A P K P I L E F Q C P L K I Q S R S Q L L R N Q F * N F N A H * K F K V D R S C S E T N F E ----:----|----:----|----:----|----:----|----:----|----:----| L I E I G V L F E F D I A A A G F G I K S F K L A W * F N L T S R L Q E S V L K S N * H G S F I * L R D C S S R F W N Q MboII MaeIII Tsp45I Tsp4CI* | MboII | | TspEI | | |MnlI MnlI \ \ \\ \ AAGAAGAGAACCGTCACAGAAATTATAGAGGACAACGCTTTATGGAAACTGAATGAGGCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCTCTTGGCAGTGTCTTTAATATCTCCTGTTGCGAAATACCTTTGACTTACTCCGT / / / / / / / Ksp632I* | | | | TspEI MnlI | | | MnlI | | Tsp45I | | MaeIII | MboII Tsp4CI* MboII K K R T V T E I I E D N A L W K L N E A R R E P S Q K L * R T T L Y G N * M R Q E E N R H R N Y R G Q R F M E T E * G K ----:----|----:----|----:----|----:----|----:----|----:----| F F L V T V S I I S S L A K H F S F S A S S S F R * L F * L P C R K I S V S H P L L S G D C F N Y L V V S * P F Q I L C FatI |CviAII || NspI || NlaIII || | TspDTI || | | BinI* || | | | MboI || | | | BamHI || | | | XhoII || | | | | DpnI FatI || | | | | NlaIV |CviAII || | | | | |BstKTI || NlaIII || | | | | || BinI* \\ \ \\ \ \ \ \ \\ \ AGAAAACACATGACAGAAATGAAACATGCTTCGGTAATAATGGATCCCAATGGCAACAAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTGTGTACTGTCTTTACTTTGTACGAAGCCATTATTACCTAGGGTTACCGTTGTTT / // / // / / // / / / | |FatI | || | | || | BinI* BcgI | CviAII | || | | || XhoII NlaIII | || | | || BamHI | || | | || MboI | || | | |NlaIV | || | | |DpnI | || | | BstKTI | || | BinI* | || TspDTI | |FatI | CviAII NlaIII NspI R K H M T E M K H A S V I M D P N G N K E N T * Q K * N M L R * * W I P M A T K K T H D R N E T C F G N N G S Q W Q Q K ----:----|----:----|----:----|----:----|----:----|----:----| L F C M V S I F C A E T I I S G L P L L L F V C S L F S V H K P L L P D W H C C S F V H C F H F M S R Y Y H I G I A V F CfrI | MwoI | CviJI | HaeIII | |AciI | |BisI | ||BlsI | |||TauI | |||BsrBI | ||||SmlI | ||||| BcgI | ||||| | MseI | ||||| | |BfiI BcgI | ||||| | |HpaI |MaeII | ||||| | |HindII || SetI | ||||| | |Hpy166II || TaiI | ||||| | || BsrI || |FatI | ||||| | || | TatI || ||CviAII | ||||| | || | |Csp6I || ||| SfaNI TaqI | ||||| | || | ||RsaI || ||| |NlaIII Bce83I* | ||||| | || | ||ScaI \\ \\\ \\ \ \ \\\\\ \ \\ \ \\\ AACGTCCATGACGATTTCGATGCTCTGGCCGCTCAAGTTAACGCCCAGTACTACCATTAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCAGGTACTGCTAAAGCTACGAGACCGGCGAGTTCAATTGCGGGTCATGATGGTAATA / / / // / / / / //// / / /// / /// | | | || | | TaqI | |||| | | ||| BsrI ||TatI | | | || | Bce83I* | |||| | | ||MseI |Csp6I | | | || SfaNI | |||| | | |Hpy166II ScaI | | | |FatI | |||| | | |HindII RsaI | | | CviAII | |||| | | |HpaI | | NlaIII | |||| | | BfiI | MaeII | |||| | SmlI TaiI | |||| BcgI SetI | |||BsrBI | |||AciI | ||CfrI | ||BisI | |BlsI | HaeIII | CviJI | TauI MwoI N V H D D F D A L A A Q V N A Q Y Y H Y T S M T I S M L W P L K L T P S T T I I R P * R F R C S G R S S * R P V L P L S ----:----|----:----|----:----|----:----|----:----|----:----| F T W S S K S A R A A * T L A W Y * W * F R G H R N R H E P R E L * R G T S G N V D M V I E I S Q G S L N V G L V V M I Ksp632I* | HinfI | | HindII | | Hpy166II | | | PleI TfiI | | | |MlyI HinfI | | | |MboII | TaqI Tsp4CI* | | | || Hpy188I TspEI \ \ \ \ \ \ \\ \ \ CCCAAAGAATCGAACAGTAGCGTTAGTTTGAAGAGTCAACACTCTGACAAAAAAGATAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTTTCTTAGCTTGTCATCGCAATCAAACTTCTCAGTTGTGAGACTGTTTTTTCTATTA / / / / // // / | | Tsp4CI* | || || Hpy188I | TaqI | || |PleI HinfI | || |MlyI TfiI | || MboII | |Hpy166II | |HindII | HinfI Ksp632I* P K E S N S S V S L K S Q H S D K K D N P K N R T V A L V * R V N T L T K K I I Q R I E Q * R * F E E S T L * Q K R * F ----:----|----:----|----:----|----:----|----:----|----:----| G L S D F L L T L K F L * C E S L F S L D W L I S C Y R * N S S D V S Q C F L Y G F F R V T A N T Q L T L V R V F F I I TfiI AciI HinfI ApoI | MaeIII | SfeI* TspEI | Tsp45I HphI \ \ \ \ \ \ TCTACCATACCGAATCCTGTAGGAGAAAATTCAAATGGTGGCGGTGACAAGGGAGAAGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGGTATGGCTTAGGACATCCTCTTTTAAGTTTACCACCGCCACTGTTCCCTCTTCTT / / / / / / / TspEI HinfI SfeI* TspEI AciI | HphI TfiI ApoI Tsp45I MaeIII S T I P N P V G E N S N G G G D K G E E L P Y R I L * E K I Q M V A V T R E K K Y H T E S C R R K F K W W R * Q G R R R ----:----|----:----|----:----|----:----|----:----|----:----| E V M G F G T P S F E F P P P S L P S S N * W V S D Q L L F N L H H R H C P L L R G Y R I R Y S F I * I T A T V L S F F SetI BbvII* |CviRI* ||MboII ||| MseI ||| MboII ||| |BspMI ||| |AhaIII* ||| || TspDTI ||| || | Hin6I ||| || | |GlaI ||| || | |Eco47III ||| || | ||HhaI ||| || | |||HaeII ||| || | |||| FatI SetI ||| || | |||| |CviAII |HindII ||| || | |||| || NlaIII |Hpy166II \\\ \\ \ \\\\ \\ \ \\ GACCTGCATTTAAAGTCAGCGCTTCATGTTCAAAACAATAGGTCAACGGCACAATCAAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGACGTAAATTTCAGTCGCGAAGTACAAGTTTTGTTATCCAGTTGCCGTGTTAGTTTG / / / // / //// / // / / SetI | | || | |||| | |FatI SetI Hpy166II | | || | |||| | CviAII HindII | | || | |||| NlaIII | | || | |||Hin6I | | || | ||Eco47III | | || | ||GlaI | | || | |HhaI | | || | HaeII | | || BspMI | | |MseI | | AhaIII* | | TspDTI | BbvII* | MboII CviRI* MboII D L H L K S A L H V Q N N R S T A Q S N T C I * S Q R F M F K T I G Q R H N Q T P A F K V S A S C S K Q * V N G T I K Q ----:----|----:----|----:----|----:----|----:----|----:----| S R C K F D A S * T * F L L D V A C D F L G A N L T L A E H E F C Y T L P V I L V Q M * L * R K M N L V I P * R C L * V MboI | DpnI Csp6I | |BstKTI |RsaI | || BinI* || FalI | || | SetI || FalI | || | |ApoI || | MboI | || | |FalI || | | DpnI | || | |FalI BceAI MaeI || | | |BstKTI CviJI | || | |TspEI \ \ \\ \ \ \\ \ \ \\ \ \\ AAAAGCATACTAGAAAATAGTACCAATGATCGTAAGGCTAACTTGGATCAAAACCTAAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGTATGATCTTTTATCATGGTTACTAGCATTCCGATTGAACCTAGTTTTGGATTTA / / /// // / / // / / / BceAI MaeI ||Csp6I || MboI CviJI || | | BinI* |RsaI |DpnI || | FalI FalI BstKTI || | FalI FalI || | SetI || MboI |DpnI BstKTI K S I L E N S T N D R K A N L D Q N L N K A Y * K I V P M I V R L T W I K T * I K H T R K * Y Q * S * G * L G S K P K F ----:----|----:----|----:----|----:----|----:----|----:----| L L M S S F L V L S R L A L K S * F R F C F C V L F Y Y W H D Y P * S P D F G L F A Y * F I T G I I T L S V Q I L V * I BseRI | SetI MnlI Hpy178III* | NlaIV MboII | MnlI MnlI TspEI \ \ \ \ \ \ \ \ TCTCCTGATAATAATAGGTTCCCCTCCTCAACATCTTCCTCCAATAGAGATAATGAAAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGACTATTATTATCCAAGGGGAGGAGTTGTAGAAGGAGGTTATCTCTATTACTTTTG / / / / / / / / / | | | | NlaIV MboII | MnlI MnlI | | | SetI MnlI | | BseRI | Hpy178III* TspEI ApoI S P D N N R F P S S T S S S N R D N E N L L I I I G S P P Q H L P P I E I M K T S * * * * V P L L N I F L Q * R * * K Q ----:----|----:----|----:----|----:----|----:----|----:----| E G S L L L N G E E V D E E L L S L S F N E Q Y Y Y T G R R L M K R W Y L Y H F R R I I I P E G G * C R G G I S I I F V FatI NcoI StyI SecI* DsaI* |CviAII || TspDTI || |NlaIII SspI || || BsaBI | MseI SetI MnlI SetI \\ \\ \ \ \ \ \ \ AATTCCATGGGATTATCATCAATATTAACCTCAAACCCAAGTGAAAAATCTAACAAACCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGTACCCTAATAGTAGTTATAATTGGAGTTTGGGTTCACTTTTTAGATTGTTTGGA /// // / / / / / ||| |DsaI* BsaBI | MseI MnlI SetI ||| |SecI* | SetI ||| |StyI SspI ||| |NcoI ||| |FatI ||| CviAII ||TspDTI |NlaIII TspEI N S M G L S S I L T S N P S E K S N K P I P W D Y H Q Y * P Q T Q V K N L T N L F H G I I I N I N L K P K * K I * Q T Y ----:----|----:----|----:----|----:----|----:----|----:----| L E M P N D D I N V E F G L S F D L L G C N W P I I M L I L R L G L H F I * C V I G H S * * * Y * G * V W T F F R V F R MseI MslI EcoRV \ \ ACTAAAAATAGACATATACATTTTAATGACAGGGTGGAACAATGTATGGCACTACGATAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTTTTATCTGTATATGTAAAATTACTGTCCCACCTTGTTACATACCGTGATGCTATA / / / | MseI EcoRV MslI T K N R H I H F N D R V E Q C M A L R Y L K I D I Y I L M T G W N N V W H Y D I * K * T Y T F * * Q G G T M Y G T T I S ----:----|----:----|----:----|----:----|----:----|----:----| V L F L C I C K L S L T S C H I A S R Y * * F Y V Y V N * H C P P V I Y P V V I S F I S M Y M K I V P H F L T H C * S I AluI CviJI | SetI TspDTI | | MnlI Hpy188I BseGI FokI | BtgZI TspDTI MseI \ \ \ \ \ \ \ \ \ \ CCAGCTTCACAATCGGAGGATGATGAAAGCGATGATGAAAATAAACAATATGTTGATGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGAAGTGTTAGCCTCCTACTACTTTCGCTACTACTTTTATTTGTTATACAACTACAA / / / / / // / | | MnlI Hpy188I BseGI |TspDTI TspDTI | CviJI FokI BtgZI | AluI SetI P A S Q S E D D E S D D E N K Q Y V D V Q L H N R R M M K A M M K I N N M L M L S F T I G G * * K R * * K * T I C * C * ----:----|----:----|----:----|----:----|----:----|----:----| G A E C D S S S S L S S S F L C Y T S T D L K V I P P H H F R H H F Y V I H Q H W S * L R L I I F A I I F I F L I N I N HinfI | BsrDI AclI | | NheI MaeII | | |MaeI |MaeIII | | ||Cac8I || SetI MlyI | | ||| BmtI || TaiI PleI | | ||| CviJI \\ \ \ \ \ \\\ \ AATAACAATGCGAACGTTACAACAATAAACAACAATAGGACTCCATTGCTAGCCATTCAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGTTACGCTTGCAATGTTGTTATTTGTTGTTATCCTGAGGTAACGATCGGTAAGTC / / / / // // / /// MseI | | MaeIII |PleI |HinfI | ||CviJI | MaeII MlyI BsrDI | ||NheI | AclI | |MaeI TaiI | Cac8I SetI BmtI N N N A N V T T I N N N R T P L L A I Q I T M R T L Q Q * T T I G L H C * P F S * Q C E R Y N N K Q Q * D S I A S H S A ----:----|----:----|----:----|----:----|----:----|----:----| L L L A F T V V I F L L L V G N S A M * * Y C H S R * L L L C C Y S E M A L W E I V I R V N C C Y V V I P S W Q * G N L Hin4I Hin4I |MaeI ||FokI TsoI AciI |||Hin4I Hpy99I \ \ \\\\ \ CATAAATCTATTCCTATCAACTCCGCAACTGAACATTTGAACAAAAATACTAGCGACGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTTAGATAAGGATAGTTGAGGCGTTGACTTGTAAACTTGTTTTTATGATCGCTGCTA / / / / // / TsoI AciI | | || FokI | | |Hpy99I | | MaeI | Hin4I Hin4I Hin4I H K S I P I N S A T E H L N K N T S D D I N L F L S T P Q L N I * T K I L A T M * I Y S Y Q L R N * T F E Q K Y * R R * ----:----|----:----|----:----|----:----|----:----|----:----| C L D I G I L E A V S C K F L F V L S S A Y I * E * * S R L Q V N S C F Y * R R M F R N R D V G C S F M Q V F I S A V I AciI |BisI MboII ||BlsI TspDTI ||MboII | MnlI |||TauI | | Hin4I |||CviJI | | Hin4I MslI |||HaeIII BseGI | | | Hin4I |Hpy188I |||TspDTI \ \ \ \ \ \\ \\\\ GATACATCCTCACAATCATCATCTTCATCACATTCTGATGATGAAGAACACGGCGGCCTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGTAGGAGTGTTAGTAGTAGAAGTAGTGTAAGACTACTACTTCTTGTGCCGCCGGAA / // // / / //// BseGI || || Hin4I Hpy188I |||HaeIII || |MnlI MslI |||CviJI || Hin4I ||BisI || Hin4I ||AciI |MboII |TspDTI TspDTI |MboII |BlsI TauI D T S S Q S S S S S H S D D E E H G G L I H P H N H H L H H I L M M K N T A A F Y I L T I I I F I T F * * * R T R R P L ----:----|----:----|----:----|----:----|----:----|----:----| S V D E C D D D E D C E S S S S C P P R H Y M R V I M M K M V N Q H H L V R R G I C G * L * * R * * M R I I F F V A A K MnlI | PfoI | BssKI | EcoRII | | ScrFI | | BseBI | | | MlyI | | | PleI | | | | SetI | | | | | Hpy188I | | | | | |HinfI | | | | | |TspDTI GsuI BceAI | | | | | || Hpy178III* Eco57MI | CviRI* | | | | | || | HphI Hin4I | TspEI \ \ \ \ \ \ \ \\ \ \ \ \ \ TACATAAATGCAAGATTTTCCAGGAGGTCTGACTCTGGAGTTCATTCACCAATAACAGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTATTTACGTTCTAAAAGGTCCTCCAGACTGAGACCTCAAGTAAGTGGTTATTGTCTA / / / / /// / / / / / | | MnlI | ||| | | | Hin4I Eco57MI | CviRI* | ||| | | Hpy178III* GsuI BceAI | ||| | | HphI | ||| | HinfI | ||| Hpy188I | ||| TspDTI | ||PleI | |MlyI | EcoRII | BssKI | PfoI | SetI BseBI ScrFI Y I N A R F S R R S D S G V H S P I T D T * M Q D F P G G L T L E F I H Q * Q I H K C K I F Q E V * L W S S F T N N R * ----:----|----:----|----:----|----:----|----:----|----:----| * M F A L N E L L D S E P T * E G I V S K C L H L I K W S T Q S Q L E N V L L L V Y I C S K G P P R V R S N M * W Y C I BslFI Hpy178III* | AluI | CviJI | Ecl136II | | FatI | | SetI | | SduI | | SacI | | HgiAI* | | HgiJII* | | |CviAII | | || Csp6I | | || NlaIII | | || |RsaI | | || ||MaeII CviJI | | || ||| SetI TspDTI | MnlI Hin4I | | || ||| TaiI \ \ \ \ \ \ \\ \\\ \ AATTCCTCTGTGGCTTCATCTACTACTTCCAGAGCTCATGTACGTCCCATAATAAAGTTG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGAGACACCGAAGTAGATGATGAAGGTCTCGAGTACATGCAGGGTATTATTTCAAC // // / //// / //// / |TspEI || Hin4I |||| | |||| MaeII TspDTI |MnlI |||| | |||Csp6I CviJI |||| | ||RsaI |||| | ||TaiI |||| | ||SetI |||| | |FatI |||| | CviAII |||| NlaIII |||Ecl136II |||CviJI |||AluI ||BslFI |HgiJII* |HgiAI* |SacI |SduI |SetI Hpy178III* N S S V A S S T T S R A H V R P I I K L I P L W L H L L L P E L M Y V P * * S C F L C G F I Y Y F Q S S C T S H N K V A ----:----|----:----|----:----|----:----|----:----|----:----| L E E T A E D V V E L A * T R G M I F N Y N R Q P K M * * K W L E H V D W L L T I G R H S * R S S G S S M Y T G Y Y L Q TspEI | Hin4I | Hin4I | | MboI | | | DpnI | | | |BstKTI | | | || Hpy188I | | | || | BinI* ApoI | | | || | | TfiI TspEI | | | || | | HinfI | Hin4I | | | || | | | Hpy188I | Hin4I Hpy178III* | | | || | | | | MboII | | MseI \ \ \ \ \\ \ \ \ \ \ \ \ \ CTTCCTGATACCACTTTGAATTATGGATCAGACGAAGAATCTGATAATGGCGAATTTAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGGACTATGGTGAAACTTAATACCTAGTCTGCTTCTTAGACTATTACCGCTTAAATTA / / / // / / // / / / / Hpy178III* | | || | BinI* || | Hin4I | MseI | | || Hpy188I || | Hin4I TspEI | | || MboI || MboII ApoI | | |DpnI |Hpy188I | | BstKTI HinfI | TspEI TfiI Hin4I Hin4I L P D T T L N Y G S D E E S D N G E F N F L I P L * I M D Q T K N L I M A N L M S * Y H F E L W I R R R I * * W R I * W ----:----|----:----|----:----|----:----|----:----|----:----| S G S V V K F * P D S S S D S L P S N L A E Q Y W K S N H I L R L I Q Y H R I * K R I G S Q I I S * V F F R I I A F K I MaeIII Tsp45I | GsuI MnlI | Eco57MI | SetI | | MaeII | |Hpy178III* | | | SetI | || CviJI | | | TaiI | || |MnlI Hin4I TaqII \ \ \ \ \ \\ \\ \ \ GGGTATGGTAATGCTGTGTCACATAACGTCAATACCTCCAGAGGCTATGATTACATATAC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CCCATACCATTACGACACAGTGTATTGCAGTTATGGAGGTCTCCGATACTAATGTATATG / / / / / / / / / | | | | SetI | | Hin4I TaqII | | | | MnlI | CviJI | | | MaeII | MnlI | | TaiI Hpy178III* | | SetI | Tsp45I | MaeIII Eco57MI GsuI G Y G N A V S H N V N T S R G Y D Y I Y G M V M L C H I T S I P P E A M I T Y T V W * C C V T * R Q Y L Q R L * L H I R ----:----|----:----|----:----|----:----|----:----|----:----| P Y P L A T D C L T L V E L P * S * M Y H T H Y H Q T V Y R * Y R W L S H N C I P I T I S H * M V D I G G S A I I V Y V TfiI HinfI | FatI | |CviAII BsrI | || MaeIII AccI TspRI BsrI TspDTI | || Tsp45I PsiI |Hpy166II Hin4I | HphI | BsrI | || |NlaIII \ \\ \ \ \ \ \ \ \\ \\ GATTATAACTCGGTCTACACTGGTGATACTTCCAGTTTTTTACCAGTAGATTCATGTGAC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATATTGAGCCAGATGTGACCACTATGAAGGTCAAAAAATGGTCATCTAAGTACACTG / // / / / / / / / // / PsiI || | BsrI | HphI | BsrI | || Tsp45I || Hin4I BsrI TspDTI | || MaeIII |AccI | |FatI Hpy166II | CviAII TspRI NlaIII HinfI TfiI D Y N S V Y T G D T S S F L P V D S C D I I T R S T L V I L P V F Y Q * I H V T L * L G L H W * Y F Q F F T S R F M * H ----:----|----:----|----:----|----:----|----:----|----:----| S * L E T * V P S V E L K K G T S E H S R N Y S P R C Q H Y K W N K V L L N M H I I V R D V S T I S G T K * W Y I * T V Eco57I Eco57MI | CviJI | |BsrDI | || Hin4I Hin4II* | || Hin4I CviRI* | Hpy178III* | || | CviRI* | EcoT22I \ \ \ \\ \ \ \ \ ATTGTAGATGTTCCTGAAGGAATGGACTTACAAACAGCCATTGCAGATGATAATGCATCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAACATCTACAAGGACTTCCTTACCTGAATGTTTGTCGGTAACGTCTACTATTACGTAGT / / / /// / / / | Hpy178III* | ||CviJI CviRI* | CviRI* Hin4II* | |BsrDI EcoT22I | Hin4I | Hin4I Eco57MI Eco57I I V D V P E G M D L Q T A I A D D N A S L * M F L K E W T Y K Q P L Q M I M H Q C R C S * R N G L T N S H C R * * C I K ----:----|----:----|----:----|----:----|----:----|----:----| M T S T G S P I S K C V A M A S S L A D C Q L H E Q L F P S V F L W Q L H Y H M N Y I N R F S H V * L C G N C I I I C * FatI AflIII SfaNI AciI BspLU11I* | ApoI |TspDTI |CviAII | TspEI || TfiI || NspI | | MseI || HinfI || NlaIII | | |Hin4I || | StyI || | Eco57I | | |Hin4I || | SecI* || | Eco57MI HindIII \ \ \\ \\ \ \ \\ \ \ \ AACTATGAATTTAACAATGCGGTAGAATCCAAGGAAAAACATGTTCCACAACTACACAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTGATACTTAAATTGTTACGCCATCTTAGGTTCCTTTTTGTACAAGGTGTTGATGTGTTT // / / / / / / / // / / || | MseI | AciI | SecI* | || Eco57MI SetI || TspEI TspDTI | StyI | || Eco57I || ApoI HinfI | |BspLU11I* |SfaNI TfiI | |AflIII Hin4I | |FatI Hin4I | CviAII NlaIII NspI N Y E F N N A V E S K E K H V P Q L H K T M N L T M R * N P R K N M F H N Y T K L * I * Q C G R I Q G K T C S T T T Q S ----:----|----:----|----:----|----:----|----:----|----:----| F * S N L L A T S D L S F C T G C S C L L S H I * C H P L I W P F V H E V V V C V I F K V I R Y F G L F F M N W L * V F AflIII | MaeII | |BtrI | || SetI | || TaiI | || |HindII | || |Hpy166II | || || FatI | || || |CviAII | || || || MboI | || || || NlaIII | || || || | DpnI AluI | || || || | |BstKTI CviJI | || || || | || NdeI Hpy99I | SetI | || || || | || |BinI* | TspEI \ \ \ \\ \\ \\ \ \\ \\ \ \ GCTTCAGCAAATAATACAACACGTCAACATGGATCGCATATGTTATTATATGACGACGAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTCGTTTATTATGTTGTGCAGTTGTACCTAGCGTATACAATAATATACTGCTGCTG / / / // / / //// / / / / | HindIII | || | | |||| MboI BinI* Hpy99I TspDTI CviJI | || | | |||DpnI NdeI AluI | || | | ||BstKTI | || | | |FatI | || | | CviAII | || | NlaIII | || Hpy166II | || HindII | |AflIII | |MaeII | BtrI TaiI SetI A S A N N T T R Q H G S H M L L Y D D D L Q Q I I Q H V N M D R I C Y Y M T T T F S K * Y N T S T W I A Y V I I * R R Q ----:----|----:----|----:----|----:----|----:----|----:----| A E A F L V V R * C P D C I N N Y S S S L K L L Y Y L V D V H I A Y T I I H R R S * C I I C C T L M S R M H * * I V V V MboII TspDTI | AluI SapI HinfI | CviJI Ksp632I* MlyI | BbvII* | | SetI | Hpy188I TspEI PleI | | MboII \ \ \ \ \ \ \ \ \ \ AATTACAGCTCTTCATCAGATAGCGAACAGCAATTTATTGAAGACTCACAATACAATAGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGTCGAGAAGTAGTCTATCGCTTGTCGTTAAATAACTTCTGAGTGTTATGTTATCA / / / / // / // / / | | | CviJI |Ksp632I* | |PleI | BbvII* | | | AluI |SapI | MlyI | MboII | | SetI Hpy188I TspEI HinfI | TspEI MboII N Y S S S S D S E Q Q F I E D S Q Y N S I T A L H Q I A N S N L L K T H N T I V L Q L F I R * R T A I Y * R L T I Q * * ----:----|----:----|----:----|----:----|----:----|----:----| L * L E E D S L S C C N I S S E C Y L L C N C S K M L Y R V A I * Q L S V I C Y I V A R * * I A F L L K N F V * L V I T Ksp632I* |MnlI ||Hpy99I MboII AccI ||| Hpy99I MboII | MboII |Hpy166II Hin4II* \\\ \ \ \ \ \\ \ AGCGACGACGAAGAGGAAGAAGATGACGATGACCAAGAAGTAGACGATAACCACGATGAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTGCTGCTTCTCCTTCTTCTACTGCTACTGGTTCTTCATCTGCTATTGGTGCTACTT / / / / / / // / // | | Ksp632I* MboII | MboII |AccI Hin4II* |BspCNI | Hpy99I MboII Hpy166II BseMII | MnlI Hpy99I S D D E E E E D D D D Q E V D D N H D E A T T K R K K M T M T K K * T I T T M K R R R R G R R * R * P R S R R * P R * R ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S S S S S S S W S T S S L W S S Y R R R L P L L H R H G L L L R Y G R H A V V F L F F I V I V L F Y V I V V I F Hpy178III* | MboI | XhoII BseMII | | DpnI |BspCNI DdeI MaeIII | | |BstKTI Csp6I || TsoI |TspDTI Tsp45I | | || TspEI |RsaI || |MnlI || TspRI | BseRI | | || BinI* || MboI \\ \\ \\ \ \ \ \ \ \\ \ \\ \ GGACTTTCACTGAGGAGAACATTGTCACTTGGGAAATCAGGATCTACCAATTCTTTGTAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGAAAGTGACTCCTCTTGTAACAGTGAACCCTTTAGTCCTAGATGGTTAAGAAACATG / // / / / / /// / / / // | || | DdeI | Tsp45I ||| | | TspEI |Csp6I | || TspDTI | MaeIII ||| | BinI* RsaI | |TspRI BseRI ||| XhoII | MnlI ||| MboI TsoI ||DpnI |BstKTI Hpy178III* G L S L R R T L S L G K S G S T N S L Y D F H * G E H C H L G N Q D L P I L C T T F T E E N I V T W E I R I Y Q F F V R ----:----|----:----|----:----|----:----|----:----|----:----| P S E S L L V N D S P F D P D V L E K Y L V K V S S F M T V Q S I L I * W N K T S K * Q P S C Q * K P F * S R G I R Q V DpnI BccI |BstKTI | BseRI ||MaeI MboII | | Ksp632I* MnlI TspEI \\\ \ \ \ \ \ \ GATCTAGCACAACCATCACTCTCTTCGGCAACTCCTCAACAAAAAAATCCTACTAATTTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGATCGTGTTGGTAGTGAGAGAAGCCGTTGAGGAGTTGTTTTTTTAGGATGATTAAAA // / / / // / / / || | MaeI MboII |BccI Ksp632I* MnlI TspEI || MboI BseRI |DpnI BstKTI D L A Q P S L S S A T P Q Q K N P T N F I * H N H H S L R Q L L N K K I L L I L S S T T I T L F G N S S T K K S Y * F Y ----:----|----:----|----:----|----:----|----:----|----:----| S R A C G D S E E A V G * C F F G V L K R D L V V M V R K P L E E V F F D * * N I * C L W * E R R C S R L L F I R S I K CviRI* | BceAI | | MwoI | | | CviJI | | | |BsrI SfaNI | | | || TspGWI | AccI | | | || | CviJI Eco57I | |Hpy166II | | | || | HaeIII Eco57MI \ \\ \ \ \ \\ \ \ \ ACAGGGGGTAAAACTGATGTAGACAAAGATGCACAACTGGCTGTCAGGCCGTATCCGTTG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCCCCATTTTGACTACATCTGTTTCTACGTGTTGACCGACAGTCCGGCATAGGCAAC // / // // / / / |SfaNI | || || | HaeIII Eco57MI |AccI | || || | CviJI Eco57I Hpy166II | || || TspGWI | || |CviJI | || BsrI | |BceAI | MwoI CviRI* T G G K T D V D K D A Q L A V R P Y P L Q G V K L M * T K M H N W L S G R I R * R G * N * C R Q R C T T G C Q A V S V E ----:----|----:----|----:----|----:----|----:----|----:----| V P P L V S T S L S A C S A T L G Y G N * L P Y F Q H L C L H V V P Q * A T D T C P T F S I Y V F I C L Q S D P R I R Q BciVI |Hin6I MnlI ||GlaI TspDTI |MboII |||HhaI | BsiYI* ||TseI |||MboII | |Ksp632I* Hpy188I |||MnlI ||||TspEI | || MnlI TspEI | Ksp632I* |||BisI \\\\\ \ \\ \ \ \ \ \\\\ AAGCGCAATTCCTCTTCAGGGAACTTCATATTCAATTCAGATAGTGAAGAAGAGAGTAGC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGCGTTAAGGAGAAGTCCCTTGAAGTATAAGTTAAGTCTATCACTTCTTCTCTCATCG / /// / // // // / // // | ||| | || |Ksp632I* |Hpy188I Ksp632I* || |MboII | ||| | || MnlI TspEI || |BlsI | ||| | |BsiYI* || MnlI | ||| | TspDTI |MboII | ||| TspEI MnlI | ||Hin6I | |MboII | |GlaI | HhaI BciVI K R N S S S G N F I F N S D S E E E S S S A I P L Q G T S Y S I Q I V K K R V A A Q F L F R E L H I Q F R * * R R E * Q ----:----|----:----|----:----|----:----|----:----|----:----| F R L E E E P F K M N L E S L S S S L L S A C N R K L S S * I * N L Y H L L S Y L A I G R * P V E Y E I * I T F F L T A TsoI | FauI | |Tsp4CI* | || AluI | || CviJI | || PvuII | || NspBII* | || | SetI BlsI | || | | MseI MboII BbvI BseRI AciI | || | | | TaqI \ \ \ \ \ \\ \ \ \ \ AGCGAGGAGGAACAAAGACCATTACCCGCTAACAGTCAGCTGGTTAATCGAAGCGTATTG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTCCTCCTTGTTTCTGGTAATGGGCGATTGTCAGTCGACCAATTAGCTTCGCATAAC // / / // / / / / / / |TseI | BseRI || | | | | | TaqI BisI BbvI || | | | | MseI || | | | NspBII* || | | | PvuII || | | | CviJI || | | | AluI || | | SetI || | FauI || Tsp4CI* |TsoI AciI S E E E Q R P L P A N S Q L V N R S V L A R R N K D H Y P L T V S W L I E A Y * R G G T K T I T R * Q S A G * S K R I E ----:----|----:----|----:----|----:----|----:----|----:----| L S S S C L G N G A L L * S T L R L T N C R P P V F V M V R * C D A P * D F R I A L L F L S W * G S V T L Q N I S A Y Q HgaI |TseI MaeIII BspCNI ||BisI Tsp45I |CviJI ||Hin4II* | BtsI DdeI |BseMII |||BlsI | TspRI | Hpy188I || MboII ||||CviJI \ \ \ \ \\ \ \\\\\ AAAGGCAGTGTGACACCAGCAAACATATCATCTCAGAAGAAAAAAGCCCTTCCAAAGCAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCGTCACACTGTGGTCGTTTGTATAGTAGAGTCTTCTTTTTTCGGGAAGGTTTCGTC / / / // // // //// TspRI | Tsp45I |DdeI || |MboII |||CviJI | MaeIII Hpy188I || CviJI |||TseI BtsI |BseMII ||BisI BspCNI |BlsI Hin4II* K G S V T P A N I S S Q K K K A L P K Q K A V * H Q Q T Y H L R R K K P F Q S S R Q C D T S K H I I S E E K S P S K A A ----:----|----:----|----:----|----:----|----:----|----:----| F P L T V G A F M D D * F F F A R G F C S L C H S V L L C I M E S S F L G E L A F A T H C W C V Y * R L L F F G K W L L BbvI | Hpy188I | | Hpy166II | | | HindIII | | | | AluI | | | | CviJI | | | | | SetI CviJI | | | | | | TspEI HphI |Hin4II* \ \ \ \ \ \ \ \ \\ CCAAAAGCGTCCGATAGTTCACAAAGCTTTAGAATTGTAAATAATACTCCTTCACCAGCC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTCGCAGGCTATCAAGTGTTTCGAAATCTTAACATTTATTATGAGGAAGTGGTCGG / / / / / / / / / / HgaI | BbvI | | | HindIII TspEI HphI Hin4II* Hpy188I | | CviJI CviJI | | AluI | SetI Hpy166II P K A S D S S Q S F R I V N N T P S P A Q K R P I V H K A L E L * I I L L H Q P K S V R * F T K L * N C K * Y S F T S R ----:----|----:----|----:----|----:----|----:----|----:----| G F A D S L E C L K L I T F L V G E G A A L L T R Y N V F S * F Q L Y Y E K V L W F R G I T * L A K S N Y I I S R * W G TfiI BsiYI* MnlI MaeI HinfI \ \ \ \ GAAGTGGGGGCGAGTGATGTTGCCATAGAGGGTTATTTCTCTCCTAGAAATGAATCTATC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCACCCCCGCTCACTACAACGGTATCTCCCAATAAAGAGAGGATCTTTACTTAGATAG / / / / BsiYI* MnlI MaeI HinfI TfiI E V G A S D V A I E G Y F S P R N E S I K W G R V M L P * R V I S L L E M N L S S G G E * C C H R G L F L S * K * I Y Q ----:----|----:----|----:----|----:----|----:----|----:----| S T P A L S T A M S P * K E G L F S D I R L P P S H H Q W L P N N R E * F H I * F H P R T I N G Y L T I E R R S I F R D AsuI* AvaII |BmgT120I || Hpy178III* BssKI || | MboI |SecI* || | | DpnI |HpaII || | | BccI ||ScrFI || | | |BstKTI ||CauII* || | | || DdeI ||| Hin4I || | | || | Hpy188I ||| Hin4I || | | || | | Hin4I BspCNI TspDTI ||| | BccI || | | || | | Hin4I |BseMII \ \\\ \ \ \\ \ \ \\ \ \ \ \\ AAGTCTGTTGTTTCCGGGGGAAATATGATGGACCATCAAGATCACTCAGAAATGGACACT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGACAACAAAGGCCCCCTTTATACTACCTGGTAGTTCTAGTGAGTCTTTACCTGTGA / / / / / // ///// / // // TspDTI | | | BccI |AvaII ||||| | |DdeI |BseMII | | BssKI |AsuI* ||||| | Hpy188I BspCNI | | SecI* | ||||| Hin4I | CauII* | ||||| Hin4I | HpaII | ||||MboI | ScrFI | |||BccI Hin4I | ||DpnI Hin4I | |BstKTI | Hpy178III* BmgT120I K S V V S G G N M M D H Q D H S E M D T S L L F P G E I * W T I K I T Q K W T L V C C F R G K Y D G P S R S L R N G H F ----:----|----:----|----:----|----:----|----:----|----:----| L D T T E P P F I I S W * S * E S I S V * T Q Q K R P F Y S P G D L D S L F P C L R N N G P S I H H V M L I V * F H V S AluI CviJI MaeI | SetI \ \ \ TTGGCAAAAGGATTTGAAAACTGCCATATAAATAATGCTAGTAAGCTAAAGGACAAGAAA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTTTTCCTAAACTTTTGACGGTATATTTATTACGATCATTCGATTTCCTGTTCTTT / / / | | CviJI | | AluI | SetI MaeI L A K G F E N C H I N N A S K L K D K K W Q K D L K T A I * I M L V S * R T R K G K R I * K L P Y K * C * * A K G Q E S ----:----|----:----|----:----|----:----|----:----|----:----| K A F P N S F Q W I F L A L L S F S L F K P L L I Q F S G Y L Y H * Y A L P C S Q C F S K F V A M Y I I S T L * L V L F TspGWI TfiI | HindIII Cac8I HgaI HinfI | | AluI | CviRI* MaeI | TaqI | | CviJI \ \ \ \ \ \ \ \ GTTGATAGCGTGCAAACCACTAGAAAAGAAGCGTCTTTGACGGATTCGAGTAATGAAAGC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTATCGCACGTTTGGTGATCTTTTCTTCGCAGAAACTGCCTAAGCTCATTACTTTCG / / / / / / / / / | CviRI* | HgaI | TaqI | | CviJI Cac8I MaeI HinfI | | AluI TfiI | SetI TspGWI V D S V Q T T R K E A S L T D S S N E S L I A C K P L E K K R L * R I R V M K A * * R A N H * K R S V F D G F E * * K L ----:----|----:----|----:----|----:----|----:----|----:----| T S L T C V V L F S A D K V S E L L S L L Q Y R A F W * F L L T K S P N S Y H F N I A H L G S S F F R R Q R I R T I F A TspDTI |DraIII || CviRI* || | MnlI || | | CviRI* || | | | BsmI || | | | | AlfI || | | | | AlfI || | | | | | SetI || | | | | | | BsgI || | | | | | | | Cac8I || | | | | | | | | TatI || | | | | | | | | |Csp6I || | | | | | | | | ||RsaI TstI SetI || | | | | | | | | ||ScaI CviRI* \ \\ \ \ \ \ \ \ \ \ \\\ \ TTACACAAAGTGGTGCAGAATGCAAGAGGTATGGCAAGCAAGTACTTGCACTCTTGGAAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTGTTTCACCACGTCTTACGTTCTCCATACCGTTCGTTCATGAACGTGAGAACCTTT / / / / / // / / /// / / | TspDTI | | | |SetI | Cac8I ||| CviRI* AlfI | DraIII | | | AlfI BsgI ||TatI AlfI HindIII | | | AlfI |Csp6I | | CviRI* ScaI | | BsmI RsaI | MnlI TstI CviRI* L H K V V Q N A R G M A S K Y L H S W K Y T K W C R M Q E V W Q A S T C T L G K T Q S G A E C K R Y G K Q V L A L L E K ----:----|----:----|----:----|----:----|----:----|----:----| K C L T T C F A L P I A L L Y K C E Q F S V C L P A S H L L Y P L C T S A S K S * V F H H L I C S T H C A L V Q V R P F AlfI AlfI | MaeIII | Tsp45I | | AcyI | | MaeII | | |ZraI | | || SetI | | || TaiI | | || AatII | | || | CviJI | | || | | TstI \ \ \\ \ \ \ AAGAGTGACGTCAAGCCACAAGAAAATGGAAATGACAGCAGTTAG 3010 3020 3030 3040 ----:----|----:----|----:----|----:----|----: TTCTCACTGCAGTTCGGTGTTCTTTTACCTTTACTGTCGTCAATC / // / | || CviJI | || TstI | |MaeII | |AcyI | Tsp45I | MaeIII | ZraI AatII TaiI SetI K S D V K P Q E N G N D S S * R V T S S H K K M E M T A V X E * R Q A T R K W K * Q Q L X ----:----|----:----|----:----|----:----|----: F L S T L G C S F P F S L L * F S H R * A V L F H F H C C N L T V D L W L F I S I V A T L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 8 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 3 AhaIII* 1 DraI AlfI 2 AluI 10 AluBI ApoI 8 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BceAI 4 BcgI 1 BciVI 1 BfuI BdaI 2 BfiI 1 BmrI,BmuI BinI* 6 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 4 BmtI 1 BspOI BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BseRI 4 BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspLU11I* 2 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 12 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 16 CviJI 31 CviKI-1 CviRI* 9 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 12 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 7 AcuI Eco57MI 9 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 4 FatI 16 FauI 1 SmuI FokI 4 GlaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 15 Hin4II* 8 HpyAV Hin6I 2 HinP1I,HspAI HindII 6 HincII HindIII 3 HinfI 14 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 18 Hpy99I 5 Ksp632I* 7 Eam1104I,EarI,Bst6I MaeI 12 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 12 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 24 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 4 SchI MnlI 23 MroNI 1 NgoMIV MseI 11 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 4 BstNSI,XceI PfoI 1 PleI 4 PpsI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 5 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI ScaI 2 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 32 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SgrAI 1 SmlI 1 SmoI Sse232I* 1 MreI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 6 TaqII 1 TatI 2 TauI 2 TfiI 10 PfeI TseI 5 ApeKI TsoI 5 Tsp45I 10 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 21 TspEI 29 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 4 TscAI TstI 2 XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AgeI AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BarI BbvCI BclI BetI* BglI BglII BmeT110I BplI Bpu10I BsaAI BsePI BseSI BseYI BsiI* BsmAI Bsp120I Bsp1407I BspHI BspMII* BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I Cfr9I DinI DrdI Eco31I EcoNI EcoP15I EcoRI EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GsaI HgiCI* KasI KpnI MauBI MfeI MluI MmeI MstI* NarI NmeAIII NotI NruI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI RsrII SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse8387I StuI SwaI TspMI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769