Restriction Map of YDR015C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YDR015C on chromosome IV from coordinates 478199 to 477960.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32253

EMBOSS_001 SapI MboII Ksp632I* | MboII | MnlI MboII | | MboII | | StyI TspDTI TspDTI | | CviJI | | SecI* | CviJI \ \ \ \ \ \ \ \ \ ATGTCTTGTTCGTTTCATATATCAAGTCCTTTAGGCTCTTCTTCTTCCTTGGAGGGCTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAACAAGCAAAGTATATAGTTCAGGAAATCCGAGAAGAAGAAGGAACCTCCCGAAA / / / // // // / TspDTI | | |CviJI || || CviJI | | MboII || |MboII | MboII || TspDTI MboII || SecI* || StyI |Ksp632I* |SapI MnlI M S C S F H I S S P L G S S S S L E G F C L V R F I Y Q V L * A L L L P W R A F V L F V S Y I K S F R L F F F L G G L F ----:----|----:----|----:----|----:----|----:----|----:----| X D Q E N * I D L G K P E E E E K S P K X T K N T E Y I L D K L S K K K R P P S H R T R K M Y * T R * A R R R G Q L A K AsuI* AvaII DraII MwoI PpuMI | AluI |NlaIV | CviJI |BmgT120I | |MnlI || SetI MnlI | ||SetI || |StyI BslFI Hin4II* SetI CviJI | ||| TaqI || |SecI* | MboI \ \ \ \ \\\ \ \\ \\ \ \ TCTTCATTGAAGGTGGTGGTTGTAGCCTGTCAAGCTCTTTCGAGGGACCTCCTTGGTATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTAACTTCCACCACCAACATCGGACAGTTCGAGAAAGCTCCCTGGAGGAACCATAA / / / / / / / /// / / Hin4II* SetI | | | CviJI | ||PpuMI | MnlI | | | AluI | ||DraII SecI* | | | MnlI | ||AvaII StyI | | SetI | ||AsuI* | MwoI | |BmgT120I CviJI | NlaIV | SetI TaqI S S L K V V V V A C Q A L S R D L L G I L H * R W W L * P V K L F R G T S L V L F I E G G G C S L S S S F E G P P W Y * ----:----|----:----|----:----|----:----|----:----|----:----| E E N F T T T T A Q * A R E L S R R P I K K M S P P P Q L R D L E K S P G G Q Y R * Q L H H N Y G T L S K R P V E K T N EciI | BsiYI* | |BsiYI* DpnI AcyI | || CviJI |BstKTI HgaI | Hpy178III* | || | AciI \\ \ \ \ \ \\ \ \ GATCTTGTTCTCTTACTCCTTTTTTGGCGTCCAGATAAGCACCCCCATTGGGGCTTCCGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAACAAGAGAATGAGGAAAAAACCGCAGGTCTATTCGTGGGGGTAACCCCGAAGGCG // / / / / /// / / || MboI HgaI | Hpy178III* ||BsiYI* CviJI AciI |BslFI AcyI |BsiYI* |DpnI EciI BstKTI D L V L L L L F W R P D K H P H W G F R I L F S Y S F F G V Q I S T P I G A S A S C S L T P F L A S R * A P P L G L P P ----:----|----:----|----:----|----:----|----:----|----:----| S R T R K S R K Q R G S L C G W Q P K R Q D Q E R V G K K A D L Y A G G N P S G I K N E * E K K P T W I L V G M P A E A DdeI BspCNI TspEI SetI | Hpy188I |BseMII TspEI | MseI \ \ \ \\ \ \ \ CACCTGTGTTCTCAGACAGATTTTTGGCACGAAGTTGTTGTTTTTCCAATTCCAAATTAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGACACAAGAGTCTGTCTAAAAACCGTGCTTCAACAACAAAAAGGTTAAGGTTTAATT / // // / // SetI |DdeI |BseMII TspEI |MseI Hpy188I BspCNI TspEI H L C S Q T D F W H E V V V F P I P N * T C V L R Q I F G T K L L F F Q F Q I X P V F S D R F L A R S C C F S N S K L X ----:----|----:----|----:----|----:----|----:----|----:----| W R H E * V S K Q C S T T T K G I G F * G G T N E S L N K A R L Q Q K E L E L N V Q T R L C I K P V F N N N K W N W I L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 1 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BmgT120I 1 BseMII 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BspCNI 1 BstKTI 1 CviJI 5 CviKI-1 DdeI 1 BstDEI,HpyF3I DpnI 1 MalI DraII 1 EcoO109I EciI 1 HgaI 1 CseI Hin4II* 1 HpyAV Hpy178III* 1 Hpy188III Hpy188I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MnlI 3 MseI 1 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIV 1 BspLI,BmiI,PspN4I PpuMI 1 Psp5II,PspPPI SapI 1 LguI,PciSI,BspQI SecI* 2 BseDI,BssECI,BsaJI SetI 4 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaqI 1 TspDTI 2 TspEI 2 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsmAI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI CviRI* DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FatI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI MaeI MaeII MaeIII MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SauI* ScaI SchI ScrFI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I SwaI TaiI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769