Restriction Map of THI13/YDL244W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

THI13/YDL244W on chromosome IV from coordinates 16204 to 17226.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26472

BplI | AccI MboI | |SfeI* | DpnI | |Hpy166II | |BstKTI BsrI TspEI \ \\ \ \\ \ \ ATGTCTACAGACAAGATCACATTTTTGTTGAACTGGCAACCAACCCCATACCATATTCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATGTCTGTTCTAGTGTAAAAACAACTTGACCGTTGGTTGGGGTATGGTATAAGGT // / // / / || SfeI* || MboI BsrI |AccI |DpnI Hpy166II BstKTI M S T D K I T F L L N W Q P T P Y H I P C L Q T R S H F C * T G N Q P H T I F Q V Y R Q D H I F V E L A T N P I P Y S N ----:----|----:----|----:----|----:----|----:----|----:----| X D V S L I V N K N F Q C G V G Y W I G X T * L C S * M K T S S A V L G M G Y E H R C V L D C K Q Q V P L W G W V M N W FokI | XbaI | SetI | AjuI | |MaeI | |Hpy178III* | || BseGI AjuI MaeIII | || | AjuI CviJI | SetI | || BsrDI | |MaeI \ \ \ \ \\ \ \ \\ ATTTTCTTGGCTCAAACCAAAGGTTACTTCAAGGAGCAAGGTCTAGACATTGCCATCCTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGAACCGAGTTTGGTTTCCAATGAAGTTCCTCGTTCCAGATCTGTAACGGTAGGAT / / / / / // /// // / | AjuI CviJI SetI MaeIII |SetI ||XbaI |AjuI MaeI TspEI AjuI || BseGI |Hpy178III* |BsrDI |MaeI FokI I F L A Q T K G Y F K E Q G L D I A I L F S W L K P K V T S R S K V * T L P S * F L G S N Q R L L Q G A R S R H C H P R ----:----|----:----|----:----|----:----|----:----|----:----| I K K A * V L P * K L S C P R S M A M R L K R P E F W L N S * P A L D L C Q W G N E Q S L G F T V E L L L T * V N G D * BseMII |BspCNI |Hpy188I || MaeIII || Tsp45I || | Hin4II* || | |BseGI || | || DdeI || | || | AjuI || | || | |TspRI || | || | ||MseI || | || | ||FokI || | || | |||TspEI || | || | |||| MboI || | || | |||| XhoII || | || | |||| | DpnI || | || | |||| | |BstKTI || | || | |||| | || BinI* || | || | |||| | || | SalI || | || | |||| | || | |TaqI || | || | |||| | || | |AccI || | || | |||| | || | |SetI || | || | |||| | || | ||HindII || | || | |||| | || | ||Hpy166II || | || | |||| | || | ||| FatI || | || | |||| | || | ||| |CviAII BccI || | || | |||| | || | ||| || NlaIII \ \\ \ \\ \ \\\\ \ \\ \ \\\ \\ \ GAACCAACCAATCCTTCGGATGTCACTGAGTTAATTGGATCTGGTAAGGTCGACATGGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGTTGGTTAGGAAGCCTACAGTGACTCAATTAACCTAGACCATTCCAGCTGTACCCA / /// // / / / / // // / / /// // BccI ||| || | | | | || || | | ||| |FatI ||| || | | | | || || | | ||| CviAII ||| || | | | | || || | | ||NlaIII ||| || | | | | || || | | ||SalI ||| || | | | | || || | | |AccI ||| || | | | | || || | | |TaqI ||| || | | | | || || | | Hpy166II ||| || | | | | || || | | HindII ||| || | | | | || || | BinI* ||| || | | | | || || | SetI ||| || | | | | || || XhoII ||| || | | | | || || MboI ||| || | | | | || |DpnI ||| || | | | | || BstKTI ||| || | | | | |TspEI ||| || | | | | FokI ||| || | | | MseI ||| || | | DdeI ||| || | Tsp45I ||| || | MaeIII ||| || AjuI ||| |Hin4II* ||| |BseGI ||| TspRI ||Hpy188I |BspCNI BseMII E P T N P S D V T E L I G S G K V D M G N Q P I L R M S L S * L D L V R S T W V T N Q S F G C H * V N W I W * G R H G F ----:----|----:----|----:----|----:----|----:----|----:----| S G V L G E S T V S N I P D P L T S M P L V L W D K P H * Q T L Q I Q Y P R C P F W G I R R I D S L * N S R T L D V H T BinI* |CviJI ||FatI |||CviAII |||| MboI |||| |BbvI |||| |NlaIII |||| ||DpnI |||| |||BstKTI |||| |||| CspCI |||| |||| | StyI |||| |||| | SecI* |||| |||| | |PflMI |||| |||| | |BsiYI* |||| |||| | ||SetI |||| |||| | ||| TseI |||| |||| | ||| CviJI |||| |||| | ||| |BisI |||| |||| | ||| ||BlsI |||| |||| | ||| ||| StyI |||| |||| | ||| ||| SecI* |||| |||| | ||| ||| | MwoI |||| |||| | ||| ||| | | AsuI* BsrI |||| |||| | ||| ||| | | |CviJI | MaeIII |||| |||| | ||| ||| | | |HaeIII | Tsp45I |||| |||| | ||| ||| | | |BmgT120I | | MmeI |||| |||| | ||| ||| | | || SecI* | | | TspRI |||| |||| | ||| ||| | | || DsaI* | | | CspCI |||| |||| | ||| ||| | | || | BfiI | | | | SetI \\\\ \\\\ \ \\\ \\\ \ \ \\ \ \ \ \ \ \ \ TTGAAAGCCATGATCCACACCTTGGCTGCCAAGGCCCGTGGTTTCCCAGTGACCTCTGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGGTACTAGGTGTGGAACCGACGGTTCCGGGCACCAAAGGGTCACTGGAGACAA // /// // / ///// //// // / / / / || ||| || | ||||MwoI |||| || | | | Tsp45I || ||| || | ||||TseI |||| || | | | MaeIII || ||| || | |||BisI |||| || | | CspCI || ||| || | ||BlsI |||| || | | SetI || ||| || | |CviJI |||| || | MmeI || ||| || | SecI* |||| || TspRI || ||| || | StyI |||| || BsrI || ||| || BsiYI* |||| |DsaI* || ||| || PflMI |||| |SecI* || ||| || SetI |||| BfiI || ||| |CspCI |||AsuI* || ||| |BbvI ||BmgT120I || ||| MboI |HaeIII || ||DpnI |CviJI || |BstKTI SecI* || |FatI StyI || CviAII |NlaIII CviJI BinI* L K A M I H T L A A K A R G F P V T S V * K P * S T P W L P R P V V S Q * P L L E S H D P H L G C Q G P W F P S D L C C ----:----|----:----|----:----|----:----|----:----|----:----| K F A M I W V K A A L A R P K G T V E T N S L W S G C R P Q W P G H N G L S R Q Q F G H D V G Q S G L G T T E W H G R N AgeI BetI* BtsI SgrAI TatI TspRI Cfr10I |Csp6I |Hin4I MnlI BsiYI* ||RsaI |Hin4I MnlI | HphI |HpaII ||| MseI || BslFI \ \ \ \\ \\\ \ \\ \ GCCTCTTTGTTGGACGAACCATTCACCGGTGTCTTGTACTTAAAGGGCAGTGGTATCACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGAAACAACCTGCTTGGTAAGTGGCCACAGAACATGAATTTCCCGTCACCATAGTGA / / / / // /// / / / / / MnlI | HphI | |Cfr10I ||| | | | | TspRI MnlI | |SgrAI ||| | | | BtsI | |BetI* ||| | | Hin4I | |AgeI ||| | | Hin4I | HpaII ||| | TspRI BsiYI* ||| MseI ||TatI |Csp6I RsaI A S L L D E P F T G V L Y L K G S G I T P L C W T N H S P V S C T * R A V V S L L F V G R T I H R C L V L K G Q W Y H * ----:----|----:----|----:----|----:----|----:----|----:----| A E K N S S G N V P T K Y K F P L P I V Q R K T P R V M * R H R T S L P C H Y * G R Q Q V F W E G T D Q V * L A T T D S BarI |Eco57I |Eco57MI || Hin4I ApoI || Hin4I BcgI || | MboI TspEI || | | DpnI | BarI TspRI || | | |BstKTI | BinI* | BbvII* || | | || MaeIII | | HphI | |BsrI || | | || | MaeII | | |MboI | |Eam1105I || | | || | |MboII | | |XhoII | || BcgI || | | || | || SetI | | || DpnI | || |MboII || | | || | || TaiI | | || |BstKTI \ \\ \\ \\ \ \ \\ \ \\ \ \ \ \\ \\ GAAGACTTCCAGTCCCTAAAGGGCAAGAAGATCGGTTACGTTGGTGAATTTGGTAAGATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGAAGGTCAGGGATTTCCCGTTCTTCTAGCCAATGCAACCACTTAAACCATTCTAG / // / / / / / // / //// / / / / / // / BslFI || | | | | Hin4I || | |||| | | | | | || XhoII || | | | | Hin4I || | |||| | | | | | || MboI || | | | Eco57MI || | |||| | | | | | |DpnI || | | | Eco57I || | |||| | | | | | BstKTI || | | BarI || | |||| | | | | HphI || | BbvII* || | |||| | | | BinI* || | MboII || | |||| | | TspEI || BcgI || | |||| | | ApoI |Eam1105I || | |||| | BarI BsrI || | |||| BcgI || | |||MaeII || | ||MaeIII || | |MboII || | TaiI || | SetI || MboI |DpnI BstKTI E D F Q S L K G K K I G Y V G E F G K I K T S S P * R A R R S V T L V N L V R S R L P V P K G Q E D R L R W * I W * D P ----:----|----:----|----:----|----:----|----:----|----:----| S S K W D R F P L F I P * T P S N P L I Q L S G T G L P C S S R N R Q H I Q Y S F V E L G * L A L L D T V N T F K T L D TspDTI |BbvII* || AciI BsaBI || | MboII | TaqI TspDTI || | NspBII* | ClaI TspEI | Tsp4CI* CviJI || | | Hpy188I \ \ \ \ \ \ \\ \ \ \ CAAATCGATGAATTGACCAAGCACTACGGTATGAAGCCAGAAGACTACACCGCTGTCAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGCTACTTAACTGGTTCGTGATGCCATACTTCGGTCTTCTGATGTGGCGACAGTCT / / / / / / / // / BsaBI ClaI TspEI | Tsp4CI* CviJI TspDTI || Hpy188I TaqI TspDTI |NspBII* |AciI BbvII* MboII Q I D E L T K H Y G M K P E D Y T A V R K S M N * P S T T V * S Q K T T P L S D N R * I D Q A L R Y E A R R L H R C Q M ----:----|----:----|----:----|----:----|----:----|----:----| W I S S N V L C * P I F G S S * V A T L G F R H I S W A S R Y S A L L S C R Q * L D I F Q G L V V T H L W F V V G S D S SfaNI | SetI | | MboI | | | DpnI TatI | | | |TaqI |Csp6I | | | |ClaI ||RsaI | | | |BstKTI ||TspDTI | | | || Cfr10I ||| Hin4II* | | | || |HpaII TaqI \\\ \ \ \ \ \\ \\ \ TGTGGTATGAATGTCGCCAAGTACATCATTGAAGGTAAGATCGATGCCGGTATCGGTATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATACTTACAGCGGTTCATGTAGTAACTTCCATTCTAGCTACGGCCATAGCCATAG / /// / / // // // | ||Hin4II* SetI | || |ClaI |Cfr10I | ||TatI | || |TaqI HpaII | |Csp6I | || MboI | RsaI | |DpnI TspDTI | BstKTI SfaNI C G M N V A K Y I I E G K I D A G I G I V V * M S P S T S L K V R S M P V S V S W Y E C R Q V H H * R * D R C R Y R Y R ----:----|----:----|----:----|----:----|----:----|----:----| H P I F T A L Y M M S P L I S A P I P I I H Y S H R W T C * Q L Y S R H R Y R Y T T H I D G L V D N F T L D I G T D T D AccI SetI |Hpy166II || SfaNI CviJI || | AluI MboII || | CviJI |DdeI || | | SetI |EspI* || | | |AlwNI CviRI* TspEI TsoI ||BarI || | | || Hpy188I \ \ \ \\\ \\ \ \ \\ \ GAATGTATGCAACAAGTTGAATTGGAAGAATACTTGGCTAAGCAAGGTAGACCAGCTTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACATACGTTGTTCAACTTAACCTTCTTATGAACCGATTCGTTCCATCTGGTCGAAGA / / / / // / / // / / // TaqI CviRI* TspEI | || | SetI || | | |Hpy188I TsoI | || EspI* || | | MwoI | || DdeI || | AlwNI | |CviJI || | CviJI | MboII || | SfaNI BarI || | AluI || SetI |AccI Hpy166II E C M Q Q V E L E E Y L A K Q G R P A S N V C N K L N W K N T W L S K V D Q L L M Y A T S * I G R I L G * A R * T S F * ----:----|----:----|----:----|----:----|----:----|----:----| S H I C C T S N S S Y K A L C P L G A E R I Y A V L Q I P L I S P * A L Y V L K F T H L L N F Q F F V Q S L L T S W S R Csp6I CviJI |RsaI MwoI BarI TspEI | Cac8I MwoI || Tsp4CI* \ \ \ \ \ \ \\ \ GATGCTAAAATGTTGAGAATTGACAAGTTGGCTTGCTTGGGTTGCTGTTGTTTCTGTACC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGATTTTACAACTCTTAACTGTTCAACCGAACGAACCCAACGACAACAAAGACATGG / / / / / /// BarI TspEI | | MwoI ||Tsp4CI* | Cac8I |Csp6I CviJI RsaI D A K M L R I D K L A C L G C C C F C T M L K C * E L T S W L A W V A V V S V P C * N V E N * Q V G L L G L L L F L Y R ----:----|----:----|----:----|----:----|----:----|----:----| S A L I N L I S L N A Q K P Q Q Q K Q V Q H * F T S F Q C T P K S P N S N N R Y I S F H Q S N V L Q S A Q T A T T E T G MboII | MboII | BsiYI* | | SetI | | |BdaI ApoI | | |BdaI CviRI* TspEI TspDTI | | ||Hpy188I Hpy178III* \ \ \ \ \ \\\ \ GTTCTTTACATCTGCAACGATGAATTTTTGAAGAAGAACCCTGAAAAGGTCAGAAAGTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAAATGTAGACGTTGCTACTTAAAAACTTCTTCTTGGGACTTTTCCAGTCTTTCAAG / / / // / / / / CviRI* TspEI TspDTI || | | | Hpy188I ApoI || | | BdaI || | | BdaI || | SetI || MboII |BsiYI* MboII V L Y I C N D E F L K K N P E K V R K F F F T S A T M N F * R R T L K R S E S S S L H L Q R * I F E E E P * K G Q K V L ----:----|----:----|----:----|----:----|----:----|----:----| T R * M Q L S S N K F F F G S F T L F N R E K C R C R H I K S S S G Q F P * F T N K V D A V I F K Q L L V R F L D S L E BdaI BdaI | MaeII | | SetI | | TaiI | | | MaeI CviJI | | | | CviJI | Hin4II* | | | | | Hin4II* | | Hpy178III* | | | | | | BsiYI* | | | BccI | | | | | | | CviJI \ \ \ \ \ \ \ \ \ \ \ \ TTGAAAGCCATCAAGAAGGCAACCGACTACGTTCTAGCCGACCCTGTGAAGGCTTGGAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGGTAGTTCTTCCGTTGGCTGATGCAAGATCGGCTGGGACACTTCCGAACCTTT / // / / / / / // / / / | || | BccI BdaI | | || | BsiYI* CviJI | || | BdaI | | || Hin4II* | || Hpy178III* | | |CviJI | |Hin4II* | | MaeI | CviJI | MaeII Hpy178III* TaiI SetI L K A I K K A T D Y V L A D P V K A W K * K P S R R Q P T T F * P T L * R L G K E S H Q E G N R L R S S R P C E G L E R ----:----|----:----|----:----|----:----|----:----|----:----| K F A M L F A V S * T R A S G T F A Q F R S L W * S P L R S R E L R G Q S P K S Q F G D L L C G V V N * G V R H L S P F MnlI CviJI | MboI | MfeI | | DpnI TaqI | TspEI | | |BstKTI \ \ \ \ \ \\ GAATACATCGACTTCAAGCCTCAATTGAACAACGATCTATCCTACAAGCAATATCAAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTAGCTGAAGTTCGGAGTTAACTTGTTGCTAGATAGGATGTTCGTTATAGTTTCT / / / / // / TaqI CviJI | MnlI || MboI TspEI |DpnI MfeI BstKTI E Y I D F K P Q L N N D L S Y K Q Y Q R N T S T S S L N * T T I Y P T S N I K D I H R L Q A S I E Q R S I L Q A I S K M ----:----|----:----|----:----|----:----|----:----|----:----| S Y M S K L G * N F L S R D * L C Y * L L I C R S * A E I S C R D I R C A I D F F V D V E L R L Q V V I * G V L L I L S MaeIII BstEII Ksp632I* Hpy166II | SetI | TatI | MaeIII | | AgeI | Bsp1407I | Tsp45I | | BetI* | |Csp6I | Tsp4CI* | | Cfr10I MboII | ||HphI | | Hin4II* | | |HpaII MaeIII TspDTI | ||RsaI | | | BsrI | | ||MboII \ \ \ \\\ \ \ \ \ \ \ \\\ TGTTACGCTTACTTCTCTTCATCTTTGTACAATGTTCACCGTGACTGGAAGAAGGTTACC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACAATGCGAATGAAGAGAAGTAGAAACATGTTACAAGTGGCACTGACCTTCTTCCAATGG // / //// / / // / / / |MboII | |||| | | || BsrI SetI BstEII MaeIII | |||| | | |Tsp45I MaeIII TspDTI | |||| | | |MaeIII MboII | |||| | | Hin4II* | |||| | Tsp4CI* | |||| Hpy166II | |||Bsp1407I | |||TatI | ||Csp6I | |RsaI | HphI Ksp632I* C Y A Y F S S S L Y N V H R D W K K V T V T L T S L H L C T M F T V T G R R L P L R L L L F I F V Q C S P * L E E G Y R ----:----|----:----|----:----|----:----|----:----|----:----| H * A * K E E D K Y L T * R S Q F F T V I N R K S R K M K T C H E G H S S S P * T V S V E R * R Q V I N V T V P L L N G TsoI | Tth111I | | Hpy178III* MaeIII | | |TaqI | Tsp4CI* CviJI Hin4I | | || BsmAI Hin4I \ \ \ \ \ \ \\ \ \ GGTTACGGTAAGAGATTAGCCATTCTGCCACCAGACTATGTCTCGAACTACACTAATGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATGCCATTCTCTAATCGGTAAGACGGTGGTCTGATACAGAGCTTGATGTGATTACTT // / // / / // / / || Tsp4CI* |Hin4I TsoI | || | Hin4I || MaeIII CviJI | || BsmAI |Cfr10I | |TaqI |BetI* | Hpy178III* |AgeI Tth111I HpaII G Y G K R L A I L P P D Y V S N Y T N E V T V R D * P F C H Q T M S R T T L M N L R * E I S H S A T R L C L E L H * * I ----:----|----:----|----:----|----:----|----:----|----:----| P * P L L N A M R G G S * T E F * V L S R N R Y S I L W E A V L S H R S S C * H T V T L S * G N Q W W V I D R V V S I F SetI | BssKI | EcoRII | | ScrFI | | BseBI | | |CfrI BinI* | | ||TspDTI |SetI | | |||BalI || MboI | | |||CviJI || Hpy188I CviJI | | |||HaeIII || |MboII | TsoI | | |||| Ksp632I* || ||DpnI | | BccI | | |||| |MnlI || |||BstKTI | | | TspDTI \ \ \\\\ \\ \\ \\\\ \ \ \ \ TACCTGTCCTGGCCAGAACCAGAAGAGGTTTCTGATCCTTTGGAAGCCCAAAGATTGATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGACAGGACCGGTCTTGGTCTTCTCCAAAGACTAGGAAACCTTCGGGTTTCTAACTAC / // / / / / / / //// / // // SetI || | | | | | | |||| MboI |TsoI |TspDTI || | | | | | | |||DpnI CviJI BccI || | | | | | | ||BstKTI || | | | | | | |MboII || | | | | | | Hpy188I || | | | | | BinI* || | | | | SetI || | | | Ksp632I* || | | MnlI || | CfrI || EcoRII || HaeIII || BssKI || CviJI || BalI |BseBI |ScrFI TspDTI Y L S W P E P E E V S D P L E A Q R L M T C P G Q N Q K R F L I L W K P K D * W P V L A R T R R G F * S F G S P K I D G ----:----|----:----|----:----|----:----|----:----|----:----| Y R D Q G S G S S T E S G K S A W L N I I G T R A L V L L P K Q D K P L G F I S V Q G P W F W F L N R I R Q F G L S Q H MwoI |SapI |Ksp632I* Csp6I || AluI Hpy178III* |BplI || CviJI | CviRI* |RsaI Hpy178III* || | MseI CviJI | | Hin4II* |SetI | MboII CviJI || | SetI \ \ \ \ \\ \ \ \ \\ \ \ GCTATTCATCAAGAAAAATGCAGACAGGAAGGTACTTTCAAGAGATTGGCTCTTCCAGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAAGTAGTTCTTTTTACGTCTGTCCTTCCATGAAAGTTCTCTAACCGAGAAGGTCGA / / // // // // / / / /// CviJI | || || |Csp6I |MboII | | | ||BplI | || || RsaI | | | | |Ksp632I* | || |SetI | | | | |SapI | || BplI | | | | CviJI | |Hin4II* | | | | AluI | CviRI* | | | SetI Hpy178III* | | MwoI | CviJI Hpy178III* A I H Q E K C R Q E G T F K R L A L P A L F I K K N A D R K V L S R D W L F Q L Y S S R K M Q T G R Y F Q E I G S S S L ----:----|----:----|----:----|----:----|----:----|----:----| A I * * S F H L C S P V K L L N A R G A P * E D L F I C V P L Y K * S I P E E L S N M L F F A S L F T S E L S Q S K W S TAA --- ATT / MseI * X X --- * K L # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 1 BspACI,SsiI AgeI 2 AsiGI,BshTI,CspAI,PinAI AjuI 2 AluI 2 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BalI 1 MlsI,MluNI,MscI,Msp20I BarI 2 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 BcgI 1 BdaI 2 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BinI* 4 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BplI 1 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 BtsI 1 Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 18 CviKI-1 CviRI* 3 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 1 AcuI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 2 FokI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI Hin4I 3 Hin4II* 6 HpyAV HindII 1 HincII HpaII 3 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 5 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 8 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 1 MunI MmeI 1 MnlI 4 MseI 3 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PflMI 1 BasI,AccB7I,Van91I RsaI 5 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 16 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SgrAI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 6 TatI 3 TseI 1 ApeKI TsoI 3 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 8 TasI,Tsp509I,Sse9I TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AhaIII* AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BamHI BbvCI Bce83I* BceAI BciVI BclI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BsmI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI CauII* Cfr9I DinI DraII DraIII DrdI EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I FalI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin6I HindIII HinfI HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI McrI* MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SauI* ScaI SchI SduI SexAI SfiI SfoI SgfI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI TfiI TspGWI TspMI TstI VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769