Restriction Map of SSB1/YDL229W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SSB1/YDL229W on chromosome IV from coordinates 44065 to 45906.


SetI Csp6I StyI | Eco57I TaqI |RsaI CviJI SetI SecI* | Eco57MI ClaI |SetI SetI \ \ \ \ \ \ \\ \ ATGGCTGAAGGTGTTTTCCAAGGTGCTATCGGTATCGATTTAGGTACAACCTACTCTTGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACTTCCACAAAAGGTTCCACGATAGCCATAGCTAAATCCATGTTGGATGAGAACA / / / / / / / // / / | SetI | | Eco57MI | | || SetI BsaXI CviJI | | Eco57I | | |Csp6I | SecI* | | RsaI | StyI | SetI SetI ClaI TaqI M A E G V F Q G A I G I D L G T T Y S C W L K V F S K V L S V S I * V Q P T L V G * R C F P R C Y R Y R F R Y N L L L C ----:----|----:----|----:----|----:----|----:----|----:----| X A S P T K W P A I P I S K P V V * E Q X P Q L H K G L H * R Y R N L Y L R S K H S F T N E L T S D T D I * T C G V R T TspGWI TspEI MaeIII HinfI | TfiI |MnlI | HphI |MaeIII BsaXI | HinfI || BsaXI | SetI |Tsp45I \ \ \ \\ \ \ \ \\ GTTGCTACTTACGAATCCTCCGTTGAAATTATTGCCAACGAACAAGGTAACAGAGTCACC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGATGAATGCTTAGGAGGCAACTTTAATAACGGTTGCTTGTTCCATTGTCTCAGTGG / / / / / / / / / / TspGWI HinfI | | TspEI | | | | Tsp45I TfiI | BsaXI | | | | MaeIII MnlI | | | HinfI | | MaeIII | HphI SetI V A T Y E S S V E I I A N E Q G N R V T L L L T N P P L K L L P T N K V T E S P C Y L R I L R * N Y C Q R T R * Q S H P ----:----|----:----|----:----|----:----|----:----|----:----| T A V * S D E T S I I A L S C P L L T V H Q * K R I R R Q F * Q W R V L Y C L * N S S V F G G N F N N G V F L T V S D G TseI PleI |BisI |MlyI ||BbvI || GsuI BbvI ||BlsI || Eco57MI AjuI SfaNI ||| HphI || | BccI | Hpy178III* | MboII ||| AjuI \\ \ \ \ \ \ \ \\\ \ CCATCTTTCGTTGCTTTCACTCCAGAAGAAAGATTGATTGGTGATGCTGCCAAGAACCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGAAAGCAACGAAAGTGAGGTCTTCTTTCTAACTAACCACTACGACGGTTCTTGGTT // / / / // /// // / || BccI AjuI Hpy178III* |SfaNI ||| |BbvI SetI |Eco57MI |BbvI ||| HphI |GsuI MboII ||TseI PleI |BisI MlyI AjuI BlsI P S F V A F T P E E R L I G D A A K N Q H L S L L S L Q K K D * L V M L P R T K I F R C F H S R R K I D W * C C Q E P S ----:----|----:----|----:----|----:----|----:----|----:----| G D K T A K V G S S L N I P S A A L F W G M K R Q K * E L L F I S Q H H Q W S G W R E N S E S W F F S Q N T I S G L V L TseI MboII AluI BbvII* Hin4I CviJI | SfaNI Hin4I |BisI | | Tsp4CI* | TfiI ||BlsI | | | TspRI DdeI | HinfI ||SetI | | | | TaqI EspI* | | TaqI \\\ \ \ \ \ \ \ \ \ \ GCTGCTTTGAACCCAAGAAACACTGTCTTCGATGCTAAGCGTTTGATTGGTAGAAGATTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGAAACTTGGGTTCTTTGTGACAGAAGCTACGATTCGCAAACTAACCATCTTCTAAG //// // // / / / / / |||TseI || || SfaNI TaqI EspI* Hin4I Hpy99I ||BisI || |Tsp4CI* DdeI Hin4I HinfI |BlsI || BbvII* TfiI CviJI |TspRI AluI MboII A A L N P R N T V F D A K R L I G R R F L L * T Q E T L S S M L S V * L V E D S C F E P K K H C L R C * A F D W * K I R ----:----|----:----|----:----|----:----|----:----|----:----| A A K F G L F V T K S A L R K I P L L N L Q K S G L F C Q R R H * A N S Q Y F I S S Q V W S V S D E I S L T Q N T S S E FatI |Hin4I |Hin4I |CviAII SetI || NlaIII | TaqI || | BssKI | | BccI || | EcoRII | | |AcyI || | | ScrFI | | |MaeII || | | BseBI | | ||ZraI Hpy99I || | | |SetI | | |||Hpy99I |MboII || | | |BbvII* | | ||||TaqI || TfiI || | | || CviJI | | ||||SetI || HinfI || | | || HaeIII | | ||||TaiI || Hpy99I || | | || | MboII | | ||||AatII || | XmnI || | | || | |TspDTI | | ||||| Hpy99I \\ \ \ \\ \ \ \\ \ \\ \ \ \\\\\ \ GACGACGAATCTGTTCAAAAGGACATGAAGACCTGGCCTTTCAAGGTTATCGACGTCGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGCTTAGACAAGTTTTCCTGTACTTCTGGACCGGAAAGTTCCAATAGCTGCAGCTA // / // / / // / / / / / / //// / / || MboII |XmnI | | || | | | | SetI | |||| | BfiI |Hpy99I HinfI | | || | | | TspDTI | |||| TaqI TaqI TfiI | | || | | | BbvII* | |||MaeII | | || | | | MboII | |||AcyI | | || | | EcoRII | ||ZraI | | || | | HaeIII | |Hpy99I | | || | | BssKI | |BccI | | || | | CviJI | AatII | | || | BseBI | TaqI | | || | ScrFI | TaiI | | || SetI | SetI | | |FatI Hpy99I | | CviAII | NlaIII Hin4I Hin4I D D E S V Q K D M K T W P F K V I D V D T T N L F K R T * R P G L S R L S T S M R R I C S K G H E D L A F Q G Y R R R W ----:----|----:----|----:----|----:----|----:----|----:----| S S S D T * F S M F V Q G K L T I S T S R R R I Q E F P C S S R A K * P * R R R V V F R N L L V H L G P R E L N D V D I BfiI MaeIII BstEII PflMI ApoI | BsrI TaqI BsiYI* MboII TspEI \ \ \ \ \ \ GGTAACCCAGTCATCGAAGTCCAATACTTGGAAGAAACCAAGACTTTCTCCCCACAAGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGGGTCAGTAGCTTCAGGTTATGAACCTTCTTTGGTTCTGAAAGAGGGGTGTTCTT // / / / |BstEII TaqI BsiYI* MboII |MaeIII PflMI BsrI G N P V I E V Q Y L E E T K T F S P Q E V T Q S S K S N T W K K P R L S P H K K * P S H R S P I L G R N Q D F L P T R N ----:----|----:----|----:----|----:----|----:----|----:----| P L G T M S T W Y K S S V L V K E G C S H Y G L * R L G I S P L F W S K R G V L T V W D D F D L V Q F F G L S E G W L F TspDTI | AluI Hin4II* | CviJI | BceAI AjuI | |DdeI | | Eco57I AciI Hin4II* TspEI | ||SetI | | Eco57MI \ \ \ \ \\\ \ \ \ ATTTCCGCTATGGTTTTGACCAAGATGAAGGAAATTGCTGAAGCTAAGATTGGTAAGAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGGCGATACCAAAACTGGTTCTACTTCCTTTAACGACTTCGATTCTAACCATTCTTC / / / / / / / / / / /// | AciI | AjuI | | | | | | ||AjuI TspEI Hin4II* | | | | | | |SetI ApoI | | | | | | Eco57MI | | | | | | Eco57I | | | | | | BceAI | | | | | Hin4II* | | | | DdeI | | | CviJI | | | AluI | | SetI | TspDTI TspEI I S A M V L T K M K E I A E A K I G K K F P L W F * P R * R K L L K L R L V R R F R Y G F D Q D E G N C * S * D W * E G ----:----|----:----|----:----|----:----|----:----|----:----| I E A I T K V L I F S I A S A L I P L F F K R * P K S W S S P F Q Q L * S Q Y S N G S H N Q G L H L F N S F S L N T L L Tsp4CI* SfaNI SetI | BseYI |AluI | AjuI | | AluI |CviJI | | BslFI | | GsaI || SetI | | | CviJI | | CviJI Hpy99I || | StyI | | | HaeIII | | | SetI MseI | HgaI || | SecI* \ \ \ \ \ \ \ \ \ \ \ \\ \ \ GTTGAAAAGGCCGTCATTACTGTCCCAGCTTACTTTAACGACGCTCAAAGACAAGCTACC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTTTCCGGCAGTAATGACAGGGTCGAATGAAATTGCTGCGAGTTTCTGTTCGATGG // / / / / // /// / |BslFI | | | BseYI |Hpy99I ||| SfaNI HaeIII | | | CviJI MseI ||CviJI CviJI | | | AluI ||AluI | | SetI |HgaI | GsaI SetI Tsp4CI* V E K A V I T V P A Y F N D A Q R Q A T L K R P S L L S Q L T L T T L K D K L P * K G R H Y C P S L L * R R S K T S Y Q ----:----|----:----|----:----|----:----|----:----|----:----| T S F A T M V T G A * K L S A * L C A V P Q F P R * * Q G L K S * R R E F V L * N F L G D N S D W S V K V V S L S L S G Cfr10I |HpaII ||BseGI AclI |||HgiCI* MaeII AciI |||| NlaIV | SetI BisI |||| | FokI | TaiI BcgI BbvI SetI |BlsI \\\\ \ \ \ \ \ \ \ \\ AAGGATGCCGGTGCCATTTCTGGTTTGAACGTTTTGCGTATCATCAACGAACCTACTGCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTACGGCCACGGTAAAGACCAAACTTGCAAAACGCATAGTAGTTGCTTGGATGACGG / / /// / / / / / / / /// | | ||| | FokI | | BcgI | BbvI ||BisI | | ||| HgiCI* | MaeII SetI |BlsI | | ||NlaIV | AclI TauI | | |Cfr10I TaiI | | HpaII SetI | BseGI SecI* StyI K D A G A I S G L N V L R I I N E P T A R M P V P F L V * T F C V S S T N L L P G C R C H F W F E R F A Y H Q R T Y C R ----:----|----:----|----:----|----:----|----:----|----:----| L S A P A M E P K F T K R I M L S G V A W P H R H W K Q N S R K A Y * * R V * Q L I G T G N R T Q V N Q T D D V F R S G TseI FatI TauI AflIII NspBII* BspLU11I* |BisI |CviAII ||BlsI || NspI ||| MwoI Tsp4CI* || NlaIII ||| | BcgI | MaeI SetI Hpy188I || | TaqII \\\ \ \ \ \ \ \ \\ \ \ GCTGCTATTGCTTACGGTCTAGGTGCTGGTAAGTCCGAAAAGGAAAGACATGTTTTGATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGATAACGAATGCCAGATCCACGACCATTCAGGCTTTTCCTTTCTGTACAAAACTAA //// / / // / / // / |||MwoI BcgI | |MaeI Hpy188I | || TaqII |||TseI | SetI | |BspLU11I* ||BisI Tsp4CI* | |AflIII |BlsI | |FatI NspBII* | CviAII AciI NlaIII NspI A A I A Y G L G A G K S E K E R H V L I L L L L T V * V L V S P K R K D M F * F C Y C L R S R C W * V R K G K T C F D F ----:----|----:----|----:----|----:----|----:----|----:----| A A I A * P R P A P L D S F S L C T K I R Q * Q K R D L H Q Y T R F P F V H K S S S N S V T * T S T L G F L F S M N Q N Csp6I CviRI* TaqI |RsaI TaqI | BsrDI Hpy166II \ \\ \ \ \ \ TTCGATTTGGGTGGTGGTACTTTCGATGTTTCCTTGTTGCACATTGCTGGTGGTGTTTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTAAACCCACCACCATGAAAGCTACAAAGGAACAACGTGTAACGACCACCACAAATG / // / / / TaqI |Csp6I TaqI CviRI* Hpy166II RsaI BsrDI TspRI F D L G G G T F D V S L L H I A G G V Y S I W V V V L S M F P C C T L L V V F T R F G W W Y F R C F L V A H C W W C L H ----:----|----:----|----:----|----:----|----:----|----:----| K S K P P P V K S T E K N C M A P P T * K R N P H H Y K R H K R T A C Q Q H H K E I Q T T T S E I N G Q Q V N S T T N V BetI* Tsp4CI* |HpaII | MseI || MaeIII OliI Hpy178III* | |TspRI || | TaqII MslI |MmeI TaqI BstXI \ \\ \\ \ \ \ \\ \ \ ACTGTTAAATCTACTTCCGGTAACACTCACTTGGGTGGTCAAGATTTCGACACCAACTTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAATTTAGATGAAGGCCATTGTGAGTGAACCCACCAGTTCTAAAGCTGTGGTTGAAC / / // / / / / / / | MseI || MaeIII MslI | | TaqI BstXI Tsp4CI* |BetI* OliI | Hpy178III* |TaqII MmeI HpaII T V K S T S G N T H L G G Q D F D T N L L L N L L P V T L T W V V K I S T P T C C * I Y F R * H S L G W S R F R H Q L V ----:----|----:----|----:----|----:----|----:----|----:----| V T L D V E P L V * K P P * S K S V L K C Q * I * K R Y C E S P H D L N R C W S S N F R S G T V S V Q T T L I E V G V Q CviJI | ApoI BbvII* Hpy188I | TspEI | BsrI | AjuI | EcoRI | MboII | |Hpy99I | | AjuI | | MboII | |EcoP15I | | | Hpy178III* | | | SfaNI | || EcoP15I \ \ \ \ \ \ \ \ \ \\ \ TTGGAACACTTCAAGGCTGAATTCAAGAAGAAGACTGGTTTGGACATCTCCGACGATGCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTGTGAAGTTCCGACTTAAGTTCTTCTTCTGACCAAACCTGTAGAGGCTGCTACGG // / / // / // / / |AjuI | Hpy178III* || BbvII* || | EcoP15I CviJI EcoRI || MboII || EcoP15I TspEI |MboII |Hpy188I ApoI BsrI |Hpy99I SfaNI AjuI L E H F K A E F K K K T G L D I S D D A W N T S R L N S R R R L V W T S P T M P G T L Q G * I Q E E D W F G H L R R C Q ----:----|----:----|----:----|----:----|----:----|----:----| N S C K L A S N L F F V P K S M E S S A T P V S * P Q I * S S S Q N P C R R R H Q F V E L S F E L L L S T Q V D G V I G MboII | TseI | |BisI | ||BlsI | ||| FalI | ||| FalI | ||| | MwoI | ||| | | AluI AluI | ||| | | CviJI CviJI BbvI | ||| | | |DdeI MboII MaeIII | SetI | MmeI | ||| | | ||SetI | SetI Tsp45I \ \ \ \ \ \\\ \ \ \\\ \ \ \ AGAGCTTTGAGAAGATTGAGAACTGCTGCTGAAAGAGCTAAGAGAACCTTATCTTCTGTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGAAACTCTTCTAACTCTTGACGACGACTTTCTCGATTCTCTTGGAATAGAAGACAG / / / / / /// / / / / / / / | CviJI | BbvI | ||| | | | | | SetI FalI | AluI MmeI | ||| | | | | MboII FalI SetI | ||| | | | DdeI | ||| | | CviJI | ||| | | AluI | ||| | SetI | ||| MwoI | ||TseI | |BisI | BlsI | FalI | FalI MboII R A L R R L R T A A E R A K R T L S S V E L * E D * E L L L K E L R E P Y L L S S F E K I E N C C * K S * E N L I F C H ----:----|----:----|----:----|----:----|----:----|----:----| L A K L L N L V A A S L A L L V K D E T W L K S F I S F Q Q Q F L * S F R I K Q S S Q S S Q S S S S F S S L S G * R R D TaqI AsuII | TfiI Tsp4CI* HindII Hin4I | HphI FalI | MlyI Hpy166II Hin4I | HinfI FalI | PleI |HinfI | Tsp4CI* | | MboII \ \ \ \\ \ \ \ \ \ ACTCAAACTACCGTTGAAGTTGACTCTTTGTTTGACGGTGAAGATTTCGAATCCTCTTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTTGATGGCAACTTCAACTGAGAAACAAACTGCCACTTCTAAAGCTTAGGAGAAAC / / // / / / / // // Tsp45I | || | | Hin4I Tsp4CI* || |HinfI MaeIII | || | | Hin4I || |TfiI | || | HinfI || MboII | || Hpy166II |AsuII | || HindII |TaqI | |PleI HphI | MlyI Tsp4CI* T Q T T V E V D S L F D G E D F E S S L L K L P L K L T L C L T V K I S N P L * S N Y R * S * L F V * R * R F R I L F D ----:----|----:----|----:----|----:----|----:----|----:----| V * V V T S T S E K N S P S S K S D E K * E F * R Q L Q S K T Q R H L N R I R K S L S G N F N V R Q K V T F I E F G R Q MaeI |MnlI || Hin4I BbvII* || Hin4I | MboII || |AluI | |AciI || |CviJI | |BisI || ||MaeI | ||BlsI AccI NlaIV || |||SetI | |||TauI |Hpy166II | SetI \\ \\\\ \ \\\\ \\ \ \ ACTAGAGCTAGATTTGAAGACTTGAACGCCGCATTGTTCAAGTCTACTTTGGAACCTGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTCGATCTAAACTTCTGAACTTGCGGCGTAACAAGTTCAGATGAAACCTTGGACAA // // / / ///// // / || || | MaeI ||||AciI |AccI NlaIV || || CviJI |||BisI Hpy166II SetI || || AluI ||BlsI || |SetI |TauI || MaeI BbvII* |MnlI MboII Hin4I Hin4I T R A R F E D L N A A L F K S T L E P V L E L D L K T * T P H C S S L L W N L L * S * I * R L E R R I V Q V Y F G T C * ----:----|----:----|----:----|----:----|----:----|----:----| V L A L N S S K F A A N N L D V K S G T S * L * I Q L S S R R M T * T * K P V Q S S S S K F V Q V G C Q E L R S Q F R N DdeI |BseGI || MboI || BglII || XhoII || | DpnI || | |BstKTI SfaNI || | || FokI BsmAI Hpy99I Hin4II* || | || |DdeI | TaqI | DrdI TstI \ \\ \ \\ \\ \ \ \ \ \ GAACAAGTTTTGAAGGATGCTAAGATCTCTAAGTCTCAAATCGACGAAGTTGTCTTGGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTCAAAACTTCCTACGATTCTAGAGATTCAGAGTTTAGCTGCTTCAACAGAACCAA / / / /// / / /// / / | SfaNI | ||| | FokI ||| DrdI TstI Hin4II* | ||| | DdeI ||TaqI | ||| XhoII |BsmAI | ||| BglII Hpy99I | ||| MboI | ||DpnI | |BstKTI | DdeI BseGI E Q V L K D A K I S K S Q I D E V V L V N K F * R M L R S L S L K S T K L S W L T S F E G C * D L * V S N R R S C L G W ----:----|----:----|----:----|----:----|----:----|----:----| S C T K F S A L I E L D * I S S T T K T Q V L K S P H * S R * T E F R R L Q R P F L N Q L I S L D R L R L D V F N D Q N AsuI* ApoI AvaII TspEI |BmgT120I NlaIV EcoRI ||SetI TstI Hpy188I Tsp4CI* \ \ \\\ \ \ \ GGTGGTTCCACCAGAATTCCAAAGGTCCAAAAGTTGTTGTCTGACTTCTTTGACGGTAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCAAGGTGGTCTTAAGGTTTCCAGGTTTTCAACAACAGACTGAAGAAACTGCCATTC / / / // / / NlaIV | | |AvaII Hpy188I Tsp4CI* | | |AsuI* | | |TstI | | BmgT120I | SetI EcoRI TspEI ApoI G G S T R I P K V Q K L L S D F F D G K V V P P E F Q R S K S C C L T S L T V S W F H Q N S K G P K V V V * L L * R * A ----:----|----:----|----:----|----:----|----:----|----:----| P P E V L I G F T W F N N D S K K S P L Q H N W W F E L P G F T T T Q S R Q R Y T T G G S N W L D L L Q Q R V E K V T L TspDTI | MwoI AluI | Tsp4CI* CviJI | | TseI MfeI MseI | BbvI | | |BisI TspEI | EcoP15I | SetI | | ||BlsI SetI \ \ \ \ \ \ \ \\\ \ CAATTGGAAAAATCTATTAACCCAGATGAAGCTGTTGCTTACGGTGCTGCTGTTCAAGGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAACCTTTTTAGATAATTGGGTCTACTTCGACAACGAATGCCACGACGACAAGTTCCA / / / / / / // / /// / TspEI | EcoP15I | CviJI | || | ||TseI SetI MfeI MseI | AluI | || | |BisI SetI | || | BlsI | || Tsp4CI* | |MwoI | TspDTI BbvI Q L E K S I N P D E A V A Y G A A V Q G N W K N L L T Q M K L L L T V L L F K V I G K I Y * P R * S C C L R C C C S R C ----:----|----:----|----:----|----:----|----:----|----:----| C N S F D I L G S S A T A * P A A T * P A I P F I * * G L H L Q Q K R H Q Q E L L Q F F R N V W I F S N S V T S S N L T Hpy178III* | Cfr10I | |HpaII | ||CfrI | ||| CviJI StyI | ||| HaeIII Hpy188I SecI* \ \\\ \ \ \ GCTATCTTGACCGGCCAATCCACATCTGACGAAACCAAGGACTTGTTGTTGTTAGATGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAGAACTGGCCGGTTAGGTGTAGACTGCTTTGGTTCCTGAACAACAACAATCTACAA / // / / / | || CfrI Hpy188I SecI* | |Cfr10I StyI | |HaeIII | |CviJI | HpaII Hpy178III* A I L T G Q S T S D E T K D L L L L D V L S * P A N P H L T K P R T C C C * M L Y L D R P I H I * R N Q G L V V V R C C ----:----|----:----|----:----|----:----|----:----|----:----| A I K V P W D V D S S V L S K N N N S T H * R S R G I W M Q R F W P S T T T L H S D Q G A L G C R V F G L V Q Q Q * I N CviRI* | MaeIII | Tsp45I | | SetI | | | FatI | | | AflIII | | | BspLU11I* | | | |CviAII | | | || NspI | | | || NlaIII MaeI SetI | | | || | HphI TstI \ \ \ \ \ \\ \ \ \ GCTCCATTATCTCTAGGTGTTGGTATGCAAGGTGACATGTTCGGTATCGTTGTTCCAAGA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTAATAGAGATCCACAACCATACGTTCCACTGTACAAGCCATAGCAACAAGGTTCT // / / // // / / |MaeI | SetI || || HphI TstI SetI CviRI* || |BspLU11I* || |AflIII || |FatI || CviAII |Tsp45I |MaeIII NlaIII NspI A P L S L G V G M Q G D M F G I V V P R L H Y L * V L V C K V T C S V S L F Q E S I I S R C W Y A R * H V R Y R C S K K ----:----|----:----|----:----|----:----|----:----|----:----| A G N D R P T P I C P S M N P I T T G L Q E M I E L H Q Y A L H C T R Y R Q E L S W * R * T N T H L T V H E T D N N W S SetI | MmeI | |MboII | || FatI | || AflIII | || BspLU11I* | || |CviAII BarI | || || NspI | PsrI | || || NlaIII | Hpy178III* | || || | AjuI | | BccI | || || | | BarI Tsp4CI* | | |TstI | || || | | | PsrI \ \ \ \\ \ \\ \\ \ \ \ \ AACACTACTGTTCCAACCATCAAGAGAAGAACCTTTACTACATGTGCTGACAACCAAACC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGATGACAAGGTTGGTAGTTCTCTTCTTGGAAATGATGTACACGACTGTTGGTTTGG / / / / / / / / / / //// / | | PsrI | | | SetI | | | |||| PsrI | BarI | | BccI | | | |||BarI Tsp4CI* | Hpy178III* | | | ||BspLU11I* TstI | | | ||AflIII | | | ||FatI | | | |CviAII | | | AjuI | | NlaIII | | NspI | MboII MmeI N T T V P T I K R R T F T T C A D N Q T T L L F Q P S R E E P L L H V L T T K P H Y C S N H Q E K N L Y Y M C * Q P N H ----:----|----:----|----:----|----:----|----:----|----:----| F V V T G V M L L L V K V V H A S L W V F C * Q E L W * S F F R * * M H Q C G F V S S N W G D L S S G K S C T S V V L G SetI |Hpy166II || MaeII || AflIII || | SetI || | TaiI BsrI || | | MseI | AccI || | | |HpaI | |Hpy166II || | | |HindII Tsp4CI* | ||AjuI || | | |Hpy166II | BfiI | ||| StyI || | | ||HphI | TspEI | ||| SecI* || | | ||| Tsp4CI* TaqII \ \ \ \\\ \ \\ \ \ \\\ \ \ ACCGTTCAATTCCCAGTCTACCAAGGTGAACGTGTTAACTGTAAAGAAAACACTTTGTTG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAAGTTAAGGGTCAGATGGTTCCACTTGCACAATTGACATTTCTTTTGTGAAACAAC / / / / // / / // / / // / / | BfiI | | || | | || | | || Tsp4CI* TaqII Tsp4CI* | | || | | || | | |MseI | | || | | || | | Hpy166II | | || | | || | | HindII | | || | | || | | HphI | | || | | || | | HpaI | | || | | || | AflIII | | || | | || MaeII | | || | | |TaiI | | || | | |SetI | | || | | Hpy166II | | || | SecI* | | || | StyI | | || SetI | | |AccI | | Hpy166II | AjuI TspEI BsrI T V Q F P V Y Q G E R V N C K E N T L L P F N S Q S T K V N V L T V K K T L C W R S I P S L P R * T C * L * R K H F V G ----:----|----:----|----:----|----:----|----:----|----:----| V T * N G T * W P S R T L Q L S F V K N W R E I G L R G L H V H * S Y L F C K T G N L E W D V L T F T N V T F F V S Q Q Cac8I | AluI | CviJI HphI ApoI | PvuII | MboII TspEI SfaNI | NspBII* | |BcgI EcoRI BseGI | | SetI | || AluI | FokI | MslI | | | Hpy166II | || CviJI | |TaqI HphI | | MboII | | | | BsrI | || | SetI \ \\ \ \ \ \ \ \ \ \ \ \ \\ \ \ GGTGAATTCGACTTGAAGAACATCCCAATGATGCCAGCTGGTGAACCAGTCTTGGAAGCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTAAGCTGAACTTCTTGTAGGGTTACTACGGTCGACCACTTGGTCAGAACCTTCGA / /// / /// / / // / / / / | ||HphI BseGI ||MboII | | |BsrI | | | CviJI | |FokI |MslI | | | | | | AluI | TaqI SfaNI | | | | | SetI EcoRI | | | | MboII TspEI | | | | BcgI ApoI | | | HphI | | Hpy166II | NspBII* | PvuII | CviJI | AluI Cac8I SetI G E F D L K N I P M M P A G E P V L E A V N S T * R T S Q * C Q L V N Q S W K L * I R L E E H P N D A S W * T S L G S Y ----:----|----:----|----:----|----:----|----:----|----:----| P S N S K F F M G I I G A P S G T K S A P H I R S S S C G L S A L Q H V L R P L T F E V Q L V D W H H W S T F W D Q F S TaqI | Hpy99I | | AccI Tsp4CI* | | |Hpy166II | Hin4II* | | || AgeI | |BceAI | | || BetI* | || Hpy178III* | | || Cfr10I SfaNI | || | BcgI | | || |MboII | TaqI | || | | MaeIII | | || |HpaII | AsuII | || | | | SetI | | || |BbvII* \ \ \ \\ \ \ \ \ \ \ \\ \\ ATCTTCGAAGTTGATGCTAACGGTATCTTGAAGGTTACTGCCGTCGAAAAGTCTACCGGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAAGCTTCAACTACGATTGCCATAGAACTTCCAATGACGGCAGCTTTTCAGATGGCCA / / / / / / / / / /// /// AsuII | | | | SetI | | TaqI ||| ||BbvII* SfaNI | | | | | Hpy99I ||| |Cfr10I TaqI | | | | MaeIII ||| |BetI* | | | Hpy178III* ||| |AgeI | | BceAI ||| HpaII | | BcgI ||MboII | Hin4II* |AccI Tsp4CI* Hpy166II I F E V D A N G I L K V T A V E K S T G S S K L M L T V S * R L L P S K S L P V L R S * C * R Y L E G Y C R R K V Y R * ----:----|----:----|----:----|----:----|----:----|----:----| I K S T S A L P I K F T V A T S F D V P * R R L Q H * R Y R S P * Q R R F T * R D E F N I S V T D Q L N S G D F L R G T Hpy188I | TspEI | | TsoI MboII | | | BccI BarI BbvII* | | | | BarI \ \ \ \ \ \ \ AAGTCTTCTAACATCACTATCTCTAACGCTGTTGGTAGATTGTCTTCTGAAGAAATTGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAAGATTGTAGTGATAGAGATTGCGACAACCATCTAACAGAAGACTTCTTTAACTT / / / / // // / BarI | BbvII* | || || MboII MboII | || |BccI | || TspEI | |BarI | TsoI Hpy188I K S S N I T I S N A V G R L S S E E I E S L L T S L S L T L L V D C L L K K L K V F * H H Y L * R C W * I V F * R N * K ----:----|----:----|----:----|----:----|----:----|----:----| L D E L M V I E L A T P L N D E S S I S Y T K * C * * R * R Q Q Y I T K Q L F Q L R R V D S D R V S N T S Q R R F F N F MseI Eco57I Eco57MI |HpaI |HindII Eco57I |Hpy166II Eco57MI || Ksp632I* TseI | MwoI || | AluI CviJI | |HindIII || | CviJI MboII | || AluI || | | BbvI |BisI | || CviJI MboII || | | SetI TsoI ||BlsI | || | SetI TspDTI \ \\ \ \ \ \ \\\ \ \\ \ \ \ AAGATGGTTAACCAAGCTGAAGAGTTCAAGGCTGCCGATGAAGCTTTTGCCAAGAAGCAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACCAATTGGTTCGACTTCTCAAGTTCCGACGGCTACTTCGAAAACGGTTCTTCGTG / // / // // ///// // / / / / | || | || |TsoI ||||| || | | | TspDTI | || | || BbvI ||||| || | | HindIII | || | |Ksp632I* ||||| || | CviJI | || | CviJI ||||| || | AluI | || | AluI ||||| || SetI | || SetI ||||| |MwoI | |MseI ||||| Eco57MI | Hpy166II ||||| Eco57I | HindII ||||TseI | HpaI |||BisI Eco57MI ||BlsI Eco57I |CviJI MboII K M V N Q A E E F K A A D E A F A K K H R W L T K L K S S R L P M K L L P R S T D G * P S * R V Q G C R * S F C Q E A R ----:----|----:----|----:----|----:----|----:----|----:----| F I T L W A S S N L A A S S A K A L F C F S P * G L Q L T * P Q R H L K Q W S A L H N V L S F L E L S G I F S K G L L V TaqI | MnlI | |BccI | || BsaXI TspRI AluI BsaXI | || | MaeIII |BsrI CviJI | BsaBI MaeII | || | Tsp45I |Tth111I |MaeI | |TfiI | SetI | || | Tsp4CI* ||MboII ||SetI | |HinfI | TaiI | || | | BfiI ||BbvII* \\\ \ \\ \ \ \ \\ \ \ \ \\\ GAAGCTAGACAAAGATTGGAATCCTACGTTGCCTCCATCGAACAAACTGTCACTGACCCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGATCTGTTTCTAACCTTAGGATGCAACGGAGGTAGCTTGTTTGACAGTGACTGGGT / / / / / / / / // // // / / / // | | MaeI | | | | MaeII || || || | | | |Tth111I | CviJI | | | TaiI || || || | | | MboII | AluI | | | SetI || || || | | BsrI SetI | | HinfI || || || | Tsp45I | | TfiI || || || | MaeIII | BsaBI || || || BfiI BsaXI || || |TspRI || || Tsp4CI* || |BccI || BsaXI |MnlI TaqI E A R Q R L E S Y V A S I E Q T V T D P K L D K D W N P T L P P S N K L S L T Q S * T K I G I L R C L H R T N C H * P S ----:----|----:----|----:----|----:----|----:----|----:----| S A L C L N S D * T A E M S C V T V S G R L * V F I P I R R Q R W R V F Q * Q G F S S L S Q F G V N G G D F L S D S V W TseI AluI CviJI SetI |BisI TspEI NlaIV ||BlsI Ksp632I* | MboII ||SetI BbvI | MnlI | | BbvI ||SfaNI | Hpy188I \ \ \ \ \ \\\ \ \ GTCTTGTCTTCTAAATTGAAGAGAGGTTCCAAGTCCAAGATTGAAGCTGCTTTGTCCGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAACAGAAGATTTAACTTCTCTCCAAGGTTCAGGTTCTAACTTCGACGAAACAGGCTA / /// / / / / / //// / / / BbvII* ||TspEI | | MboII BbvI | |||| | | BbvI || | NlaIV | |||| | Hpy188I || SetI | |||| SfaNI |Ksp632I* | |||TseI MnlI | ||BisI | |BlsI | CviJI | AluI SetI V L S S K L K R G S K S K I E A A L S D S C L L N * R E V P S P R L K L L C P M L V F * I E E R F Q V Q D * S C F V R C ----:----|----:----|----:----|----:----|----:----|----:----| T K D E L N F L P E L D L I S A A K D S L R T K * I S S L N W T W S Q L Q K T R D Q R R F Q L S T G L G L N F S S Q G I EcoP15I | TseI | MwoI BbvII* | CviJI | MboII | |BisI CviRI* | | BccI CviJI | ||BlsI | TaqI | | | TspEI |TspDTI \ \\\ \ \ \ \ \ \ \\ GCTTTGGCTGCTTTGCAAATCGAAGACCCATCTGCTGATGAATTGAGAAAGGCTGAAGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACCGACGAAACGTTTAGCTTCTGGGTAGACGACTACTTAACTCTTTCCGACTTCAA / ///// / / / / / // | ||||TseI CviRI* TaqI | BccI TspEI |CviJI | |||BisI BbvII* TspDTI | ||BlsI MboII | |CviJI | EcoP15I MwoI A L A A L Q I E D P S A D E L R K A E V L W L L C K S K T H L L M N * E R L K L F G C F A N R R P I C * * I E K G * S W ----:----|----:----|----:----|----:----|----:----|----:----| A K A A K C I S S G D A S S N L F A S T H K P Q K A F R L G M Q Q H I S F P Q L S Q S S Q L D F V W R S I F Q S L S F N Eco57I Eco57MI |MaeIII |Tsp45I || MboII || | StyI || | SecI* || | | MboII || | | BbvII* || | | | CviJI || | | | HaeIII || | | | |FatI Ksp632I* || | | | ||CviAII | HphI || | | | ||| NlaIII MseI \ \ \\ \ \ \ \\\ \ \ GGTTTGAAGAGAGTTGTCACCAAGGCCATGTCTTCTCGTTAA 1810 1820 1830 1840 ----:----|----:----|----:----|----:----|-- CCAAACTTCTCTCAACAGTGGTTCCGGTACAGAAGAGCAATT / / / / / / //// // / | | | | | | |||| |FatI MseI | | | | | | |||| CviAII | | | | | | |||BbvII* | | | | | | ||NlaIII | | | | | | |HaeIII | | | | | | |CviJI | | | | | | SecI* | | | | | | StyI | | | | | MboII | | | | Tsp45I | | | | MaeIII | | | MboII | | Eco57MI | | Eco57I | HphI Ksp632I* G L K R V V T K A M S S R * V * R E L S P R P C L L V X F E E S C H Q G H V F S L X ----:----|----:----|----:----|----:----|-- P K F L T T V L A M D E R * Q N S S L Q * W P W T K E N T Q L S N D G L G H R R T L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 4 AgeI 1 AsiGI,BshTI,CspAI,PinAI AjuI 4 AluI 14 AluBI ApoI 4 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 2 BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 9 BpiI,BpuAI,BstV2I,BbsI BccI 6 BceAI 2 BcgI 2 BetI* 2 BsaWI BfiI 3 BmrI,BmuI BglII 1 BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 1 BsaBI 1 Bse8I,BseJI BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspLU11I* 3 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 1 BstXI 1 Cac8I 1 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 5 CviJI 23 CviKI-1 CviRI* 3 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 1 MalI DrdI 1 AasI,DseDI Eco57I 5 AcuI Eco57MI 6 EcoP15I 4 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 5 FokI 3 GsaI 1 GsuI 1 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 4 Hin4II* 4 HpyAV HindII 3 HincII HindIII 1 HinfI 7 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 6 Hpy99I 8 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 9 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 23 MfeI 1 MunI MlyI 2 SchI MmeI 3 MnlI 4 MseI 6 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 3 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PsrI 1 PvuII 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 5 BseDI,BssECI,BsaJI SetI 38 SfaNI 8 LweI StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 16 TaqII 3 TauI 2 TfiI 5 PfeI TseI 8 ApeKI TsoI 2 Tsp45I 5 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI TstI 2 Tth111I 1 PflFI,PsyI,AspI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BbvCI Bce83I* BciVI BclI BdaI BglI BinI* BmeT110I BmtI BplI Bpu10I BsaAI BseMII BsePI BseRI BseSI BsgI BsiI* BsmI Bsp120I Bsp1407I BspCNI BspHI BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CspCI DinI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I FauI FnuDII* FseI FspAI GlaI HaeII HgiAI* HgiJII* HhaI Hin6I HinP1I HspAI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TspMI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769