Restriction Map of CDC13/YDL220C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

CDC13/YDL220C on chromosome IV from coordinates 65018 to 62244.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 AluI CviJI Ecl136II |AvaI |XhoI |SmlI SapI |PspXI Ksp632I* ||TaqI |DdeI ||SetI ||SetI ||SduI |||BseMII ||SacI ||||BspCNI ||HgiAI* ||||| CviJI ||HgiJII* ||||| | DdeI MboII MnlI ||BmeT110I \\\\\ \ \ \ \ \\\ ATGGATACCTTAGAAGAGCCTGAGTGTCCTCCACATAAAAATCGTATTTTTGTGAGCTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTATGGAATCTTCTCGGACTCACAGGAGGTGTATTTTTAGCATAAAAACACTCGAGC / //// / // / / / / | |||DdeI | |MboII MnlI | | BmeT110I | ||| | DdeI | | TaqI | ||| CviJI | Ecl136II | ||Ksp632I* | CviJI | ||SapI | AluI | |BspCNI HgiJII* | BseMII HgiAI* SetI SacI SduI SetI M D T L E E P E C P P H K N R I F V S S W I P * K S L S V L H I K I V F L * A R G Y L R R A * V S S T * K S Y F C E L E ----:----|----:----|----:----|----:----|----:----|----:----| X S V K S S G S H G G C L F R I K T L E X P Y R L L A Q T D E V Y F D Y K Q S S H I G * F L R L T R W M F I T N K H A R CviJI Hin6I | BseYI |GlaI | |MwoI CviRI* ||HhaI Hin4II* | || GsaI |TspEI |||HaeII \ \ \\ \ \\ \\\\ AGTAAAGATTTTGAAGGCTATCCCAGCAAAGCAATAGTTCCCGTGCAATTCGTGGCGCTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTCTAAAACTTCCGATAGGGTCGTTTCGTTATCAAGGGCACGTTAAGCACCGCGAA / / / / / / / / //// | Hin4II* | | | BseYI | | |||Hin6I PspXI | | GsaI | | ||GlaI SmlI | MwoI | | |HhaI XhoI CviJI | | HaeII AvaI | TspEI CviRI* S K D F E G Y P S K A I V P V Q F V A L V K I L K A I P A K Q * F P C N S W R F * R F * R L S Q Q S N S S R A I R G A F ----:----|----:----|----:----|----:----|----:----|----:----| L L S K S P * G L L A I T G T C N T A S S Y L N Q L S D W C L L L E R A I R P A T F I K F A I G A F C Y N G H L E H R K MnlI MaeI TspEI MseI SetI | SetI | CviJI | MnlI MnlI \ \ \ \ \ \ \ \ \ TTAACCTCAATACACCTGACTGAAACAAAATGTTTGCTAGGCTTTTCTAATTTTGAGAGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGGAGTTATGTGGACTGACTTTGTTTTACAAACGATCCGAAAAGATTAAAACTCTCC / // / / / / / MseI |MnlI | CviJI | | MnlI SetI SetI MaeI | TspEI MnlI L T S I H L T E T K C L L G F S N F E R * P Q Y T * L K Q N V C * A F L I L R G N L N T P D * N K M F A R L F * F * E A ----:----|----:----|----:----|----:----|----:----|----:----| K V E I C R V S V F H K S P K E L K S L K L R L V G S Q F L I N A L S K * N Q S * G * Y V Q S F C F T Q * A K R I K L P BseRI | MboI | | DpnI | | |BstKTI MboI | | || SspI | DpnI | | || | MseI MnlI | |BstKTI | | || | MboII Hin4I CviJI \ \\ \ \ \\ \ \ \ \ CGAGGAGATCAATCCCAAGAAGATCAATATTTAATCAAACTGAAGTTCAAAGATAGGGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCCTCTAGTTAGGGTTCTTCTAGTTATAAATTAGTTTGACTTCAAGTTTCTATCCCCG // / / // / / / / / /// || MboI BseRI || | | | MseI Hin4I ||Eco57MI |DpnI || | | MboII ||Eco57I BstKTI || | SspI ||CviJI || MboI |MnlI |DpnI HgiJII* BstKTI SduI R G D Q S Q E D Q Y L I K L K F K D R G E E I N P K K I N I * S N * S S K I G A R R S I P R R S I F N Q T E V Q R * G L ----:----|----:----|----:----|----:----|----:----|----:----| R P S * D W S S * Y K I L S F N L S L P A L L D I G L L D I N L * V S T * L Y P S S I L G L F I L I * D F Q L E F I P A SduI Eco57I HgiJII* Eco57MI | Hpy188I | | SetI | | | BssKI | | | CviJI | | | | HpaII | | | | ScrFI | | | | Hin4I | | | | CauII* | | | | | MboI | | | | | | DpnI | | | | | | |BstKTI | | | | | | || BinI* \ \ \ \ \ \ \\ \ TCGGAGAGGTTAGCCCGGATCACTATTTCCTTACTTTGCCAATACTTTGATATTGAACTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTCTCCAATCGGGCCTAGTGATAAAGGAATGAAACGGTTATGAAACTATAACTTGAC / / / / //// / / / | | | | |||| MboI BinI* Hin4I | | | | |||DpnI | | | | ||BstKTI | | | | ||BssKI | | | | |HpaII | | | | CauII* | | | | ScrFI | | | CviJI | | Hin4I | SetI Hpy188I S E R L A R I T I S L L C Q Y F D I E L R R G * P G S L F P Y F A N T L I L N C G E V S P D H Y F L T L P I L * Y * T A ----:----|----:----|----:----|----:----|----:----|----:----| E S L N A R I V I E K S Q W Y K S I S S S P S T L G S * * K R V K G I S Q Y Q V R L P * G P D S N G * K A L V K I N F Q BspCNI MlyI |BseMII PleI ||Hin4I TfiI |||SfaNI HinfI |||BseMII | FokI Hin6I ||||BspCNI | | Hpy188I |GlaI |||||Tsp4CI* | | |HinfI ||HhaI |||||| DdeI Hin4I | | || DdeI ||BseGI |||||| | HphI SetI \ \ \ \\ \ \\\ \\\\\\ \ \ \ CCAGATTTAGATTCTGACTCAGGCGCATCCCCAACAGTAATACTGAGAGATATTCACCTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTAAATCTAAGACTGAGTCCGCGTAGGGGTTGTCATTATGACTCTCTATAAGTGGAA // // / / / /// /// // / / // / || || | | | ||| ||| || | SfaNI |DdeI SetI || || | | | ||| ||| || Tsp4CI* HphI || || | | | ||| ||| |BspCNI || || | | | ||| ||| BseMII || || | | | ||| ||BseMII || || | | | ||| |BspCNI || || | | | ||| Hin4I || || | | | ||Hin6I || || | | | |GlaI || || | | | BseGI || || | | | HhaI || || | | DdeI || || | HinfI || || FokI || |Hpy188I || HinfI || TfiI |PleI MlyI P D L D S D S G A S P T V I L R D I H L Q I * I L T Q A H P Q Q * Y * E I F T L R F R F * L R R I P N S N T E R Y S P * ----:----|----:----|----:----|----:----|----:----|----:----| G S K S E S E P A D G V T I S L S I * R A L N L N Q S L R M G L L L V S L Y E G W I * I R V * A C G W C Y Y Q S I N V K HindIII | AluI | CviJI SetI | | SetI \ \ \ \ GAAAGGTTATGTTTTTCAAGTTGTAAAGCTTTATATGTATCAAAACACGGGAACTATACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCCAATACAAAAAGTTCAACATTTCGAAATATACATAGTTTTGTGCCCTTGATATGA / / / / SetI | | HindIII | CviJI | AluI SetI E R L C F S S C K A L Y V S K H G N Y T K G Y V F Q V V K L Y M Y Q N T G T I L K V M F F K L * S F I C I K T R E L Y S ----:----|----:----|----:----|----:----|----:----|----:----| S L N H K E L Q L A K Y T D F C P F * V Q F T I N K L N Y L K I H I L V R S S Y F P * T K * T T F S * I Y * F V P V I S MnlI | MmeI | |DdeI Tsp4CI* \ \\ \ CTATTCTTAGAGGACATAAAACCGTTGGATTTGGTAAGTGTGATAAGCACCATATCTACA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAGAATCTCCTGTATTTTGGCAACCTAAACCATTCACACTATTCGTGGTATAGATGT // / / |MmeI DdeI Tsp4CI* MnlI L F L E D I K P L D L V S V I S T I S T Y S * R T * N R W I W * V * * A P Y L Q I L R G H K T V G F G K C D K H H I Y K ----:----|----:----|----:----|----:----|----:----|----:----| R N K S S M F G N S K T L T I L V M D V E I R L P C L V T P N P L H S L C W I * * E * L V Y F R Q I Q Y T H Y A G Y R C TseI |BisI ||BlsI ||| Cac8I TaqI ||| | BsmI BbvI Hpy188I Hpy188I \ \\\ \ \ \ \ \ AAATCGACAAATAGCAGCAAGCATTCGTCATCAGAACTTATTTCAGAATGTGATTTGAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGCTGTTTATCGTCGTTCGTAAGCAGTAGTCTTGAATAAAGTCTTACACTAAACTTG / /// / / / / TaqI ||| Cac8I | Hpy188I Hpy188I ||| BsmI BbvI ||TseI |BisI BlsI K S T N S S K H S S S E L I S E C D L N N R Q I A A S I R H Q N L F Q N V I * T I D K * Q Q A F V I R T Y F R M * F E Q ----:----|----:----|----:----|----:----|----:----|----:----| F D V F L L L C E D D S S I E S H S K F L I S L Y C C A N T M L V * K L I H N S F R C I A A L M R * * F K N * F T I Q V TspEI Esp3I MboII EcoRV | MseI BsmAI TspDTI \ \ \ \ \ \ AACTCACTTGTGGATATCTTCAACAATTTAATAGAAATGAATAGAGACGAGAAAAACAGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTGAACACCTATAGAAGTTGTTAAATTATCTTTACTTATCTCTGCTCTTTTTGTCC / / / / / / / MboII EcoRV | MseI BsmAI TspDTI SetI TspEI Esp3I N S L V D I F N N L I E M N R D E K N R T H L W I S S T I * * K * I E T R K T G L T C G Y L Q Q F N R N E * R R E K Q V ----:----|----:----|----:----|----:----|----:----|----:----| L E S T S I K L L K I S I F L S S F F L C S V Q P Y R * C N L L F S Y L R S F C V * K H I D E V I * Y F H I S V L F V P SetI |MseI ||AhaIII* |||ApoI TfiI |||TspEI HinfI Hpy178III* \\\\ \ \ TTTAAATTTGTAAAGTTGATTCACTACGATATAGAACTAAAAAAGTTCGTTCAAGACCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTAAACATTTCAACTAAGTGATGCTATATCTTGATTTTTTCAAGCAAGTTCTGGTT // / / / / || TspEI HinfI | BsiYI* || ApoI TfiI Hpy178III* |MseI AhaIII* F K F V K L I H Y D I E L K K F V Q D Q L N L * S * F T T I * N * K S S F K T N * I C K V D S L R Y R T K K V R S R P T ----:----|----:----|----:----|----:----|----:----|----:----| N L N T F N I * * S I S S F F N T * S W T * I Q L T S E S R Y L V L F T R E L G K F K Y L Q N V V I Y F * F L E N L V L CviJI |AciI |BisI ||BlsI |||TseI |||TauI ||||BisI |||||BlsI |||||| TspEI BsiYI* |||||| | MseI | SetI |||||| | VspI BbvI \ \ \\\\\\ \ \ \ CAAAAGGTATTATCGCAGAAATCAAAAGCCGCAGCAATTAATCCTTTCTTTGTGCCAAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCATAATAGCGTCTTTAGTTTTCGGCGTCGTTAATTAGGAAAGAAACACGGTTTA / /////// // / SetI ||||||TseI |VspI BbvI |||||BisI |MseI ||||BlsI TspEI |||AciI ||BisI |BlsI CviJI TauI Q K V L S Q K S K A A A I N P F F V P N K R Y Y R R N Q K P Q Q L I L S L C Q I K G I I A E I K S R S N * S F L C A K * ----:----|----:----|----:----|----:----|----:----|----:----| C F T N D C F D F A A A I L G K K T G F V F P I I A S I L L R L L * D K R Q A L L L Y * R L F * F G C C N I R E K H W I TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI ApoI |||| | MwoI BciVI TfiI TspEI |||| | | BbvI | MaeI SetI HinfI EcoRI |||| | | | MseI \ \ \ \ \ \\\\ \ \ \ \ AGACTAGGGATACCTTACATTGAATCCCAAAACGAATTCAACTCGCAGCTTATGACGCTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATCCCTATGGAATGTAACTTAGGGTTTTGCTTAAGTTGAGCGTCGAATACTGCGAA / / / / / /// / | MaeI SetI HinfI EcoRI ||| MwoI BciVI TfiI TspEI ||CviJI ApoI ||TseI ||AluI |BisI BlsI SetI R L G I P Y I E S Q N E F N S Q L M T L D * G Y L T L N P K T N S T R S L * R L T R D T L H * I P K R I Q L A A Y D A * ----:----|----:----|----:----|----:----|----:----|----:----| L S P I G * M S D W F S N L E C S I V S Y V L S V K C Q I G F R I * S A A * S A S * P Y R V N F G L V F E V R L K H R K FatI CviRI* |CviAII ||EcoT22I ||| NlaIII ||| | BinI* ||| | |Hin6I FatI ||| | ||GlaI |MnlI ||| | |||HhaI |CviAII ||| | |||| MboI HgaI TspDTI || NlaIII ||| | |||| XhoII \ \ \\ \ \\\ \ \\\\ \ AATGTAGATGAACCGACCACAGATATAAGCAACATGGGAGAGGAAATGCATGACAGCGCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTACATCTACTTGGCTGGTGTCTATATTCGTTGTACCCTCTCCTTTACGTACTGTCGCGT / / / / // / / // /// BbvI HgaI TspDTI | |FatI | | || ||Hin6I MseI | CviAII | | || |GlaI NlaIII | | || BinI* MnlI | | || HhaI | | |FatI | | CviAII | CviRI* | NlaIII EcoT22I N V D E P T T D I S N M G E E M H D S A M * M N R P Q I * A T W E R K C M T A Q C R * T D H R Y K Q H G R G N A * Q R R ----:----|----:----|----:----|----:----|----:----|----:----| L T S S G V V S I L L M P S S I C S L A * H L H V S W L Y L C C P L P F A H C R I Y I F R G C I Y A V H S L F H M V A C BssKI |HpaII |BsiYI* TfiI ||MnlI HinfI ||ScrFI | Hpy188I ||CauII* FokI DpnI | |TfiI ||| MnlI |AluI |MnlI | |HinfI MnlI ||| | SspI |CviJI |BstKTI | || BseRI |SetI ||| | XmnI || SetI \\ \ \\ \ \\ \\\ \ \ \\ \ GATCCCATTGAGGATTCAGATTCCTCAACTACCTCCTCTACCGGGAAATATTTCAGCTCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGGTAACTCCTAAGTCTAAGGAGTTGATGGAGGAGATGGCCCTTTATAAAGTCGAGT // / // / / / / / /// / / / / || XhoII || HinfI | MnlI | | ||| XmnI | | FokI || MboI || BseRI SetI | | ||| SspI | CviJI |DpnI || TfiI | | ||BssKI | AluI |MnlI |Hpy188I | | |MnlI SetI BstKTI HinfI | | CauII* TfiI | | HpaII | | ScrFI | MnlI BsiYI* D P I E D S D S S T T S S T G K Y F S S I P L R I Q I P Q L P P L P G N I S A Q S H * G F R F L N Y L L Y R E I F Q L K ----:----|----:----|----:----|----:----|----:----|----:----| S G M S S E S E E V V E E V P F Y K L E L D W Q P N L N R L * R R * R S I N * S I G N L I * I G * S G G R G P F I E A * BseGI | BsrI | | MaeIII BaeI Csp6I TspEI | | Tsp45I |SetI |RsaI | BstXI BaeI \ \ \ \\ \\ \ \ \ AAATCCTACATCCAGTCACAGACACCTGAAAGGAAAACAAGCGTACCAAATAATTGGCAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGGATGTAGGTCAGTGTCTGTGGACTTTCCTTTTGTTCGCATGGTTTATTAACCGTG / / / / / // / // | BsrI | | SetI || | |TspEI BseGI | BaeI || | BaeI Tsp45I || BstXI MaeIII |Csp6I RsaI K S Y I Q S Q T P E R K T S V P N N W H N P T S S H R H L K G K Q A Y Q I I G T I L H P V T D T * K E N K R T K * L A R ----:----|----:----|----:----|----:----|----:----|----:----| F D * M W D C V G S L F V L T G F L Q C L I R C G T V S V Q F S F L R V L Y N A F G V D L * L C R F P F C A Y W I I P V TfiI PpiI HinfI HindIII |HgaI | BetI* | AluI || Tsp4CI* | BspMII* | XmnI || | Hpy188I | |HpaII | CviJI || | | MluI | |Hpy178III* | | SetI || | | AflIII MslI | || MnlI Ksp632I* | | |MboII || | | | FnuDII* \ \ \\ \ \ \ \ \\ \\ \ \ \ \ GATGATGATTCCGGAAGCAAGAGGAAGAGAAAGCTTTCTTTCCACAGTCCGAACGCGTCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACTAAGGCCTTCGTTCTCCTTCTCTTTCGAAAGAAAGGTGTCAGGCTTGCGCAGG / / // / / / / / / / / / MslI | |BspMII* Ksp632I* | | | PpiI | | | AflIII | |BetI* | | HindIII | | | MluI | Hpy178III* | | MboII | | FnuDII* | HpaII | CviJI | Hpy188I | MnlI | XmnI | HgaI HinfI | AluI Tsp4CI* TfiI SetI D D D S G S K R K R K L S F H S P N A S M M I P E A R G R E S F L S T V R T R P * * F R K Q E E E K A F F P Q S E R V L ----:----|----:----|----:----|----:----|----:----|----:----| S S S E P L L L F L F S E K W L G F A D R H H N R F C S S S F A K K G C D S R T I I I G S A L P L S L K R E V T R V R G MaeI AciI | AluI | MnlI | CviJI | | CviJI | |MaeI CviJI | | | PpiI BccI | ||SetI |DdeI MnlI \ \ \ \ \ \ \\\ \\ \ TCAATCCGCAAAGCCATCAGTTATGAGCAACTTTCCCTAGCTAGTGTAGGCTCAGTTGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAGGCGTTTCGGTAGTCAATACTCGTTGAAAGGGATCGATCACATCCGAGTCAACTT / / / / /// / / / // | | CviJI BccI ||| MaeI | DdeI |SetI | PpiI ||CviJI CviJI MnlI MnlI ||AluI AciI |MaeI SetI S I R K A I S Y E Q L S L A S V G S V E Q S A K P S V M S N F P * L V * A Q L K N P Q S H Q L * A T F P S * C R L S * K ----:----|----:----|----:----|----:----|----:----|----:----| E I R L A M L * S C S E R A L T P E T S R L G C L W * N H A V K G L * H L S L Q * D A F G D T I L L K G * S T Y A * N F FatI SetI |CviAII |TspEI SetI || TfiI || TspDTI BspCNI || HinfI || | BsrI |BseMII TspEI || NlaIII || | MnlI \\ \ \\ \ \\ \ \ AGGTTAGAGGGCAAAATTGTTGGCATGAATCCACCTCAATTCGCCAGTATAAATGAGTTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAATCTCCCGTTTTAACAACCGTACTTAGGTGGAGTTAAGCGGTCATATTTACTCAAG // / / // / / / /// |BseMII | | || | SetI | ||MnlI BspCNI | | || HinfI | |BsrI | | || TfiI | TspEI | | |FatI TspDTI | | CviAII | NlaIII TspEI R L E G K I V G M N P P Q F A S I N E F G * R A K L L A * I H L N S P V * M S S V R G Q N C W H E S T S I R Q Y K * V Q ----:----|----:----|----:----|----:----|----:----|----:----| L N S P L I T P M F G G * N A L I F S N F T L P C F Q Q C S D V E I R W Y L H T P * L A F N N A H I W R L E G T Y I L E BsiYI* |Tth111I || AsuI* || AvaII TseI || DraII |BisI || PpuMI |BslFI || |BmgT120I ||BlsI || ||SetI |||AluI || ||BssKI SspI |||CviJI || ||EcoRII | CviRI* TspEI |||| SetI BbvI || |||HgaI \ \ \ \\\\ \ \ \\ \\\\ AAATATTGCACATTGAAATTATATTTTACGCAGCTCTTACCAAATGTCCCAGACAAGGTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATAACGTGTAACTTTAATATAAAATGCGTCGAGAATGGTTTACAGGGTCTGTTCCAG / / / /// / / / // // | CviRI* TspEI ||| BslFI BbvI | || |PpuMI SspI ||CviJI | || |DraII ||TseI | || |AvaII ||AluI | || |AsuI* |BisI | || BmgT120I BlsI | |Tth111I SetI | SetI BsiYI* K Y C T L K L Y F T Q L L P N V P D K V N I A H * N Y I L R S S Y Q M S Q T R S I L H I E I I F Y A A L T K C P R Q G P ----:----|----:----|----:----|----:----|----:----|----:----| L Y Q V N F N Y K V C S K G F T G S L T * I N C M S I I N * A A R V L H G L C P F I A C Q F * I K R L E * W I D W V L D ScrFI BseBI | HgiCI* | | NlaIV | | |BssKI | | |EcoRII | | || ScrFI | | || BseBI | | || |BcgI | | || || AcyI | | || || | MfeI | | || || | TspEI | | || || | | MwoI | | || || | | | CviRI* | | || || | | | | MboI | | || || | | | | | DpnI | | || || | | | | | |BstKTI | | || || | | | | | || BsaBI | | || || | | | | | || | Hin4I | | || || | | | | | || | |Hpy178III* TfiI AluI | | || || | | | | | || | || Hpy99I HinfI CviJI | | || || | | | | | || | || |BcgI | MboII Ecl136II \ \ \\ \\ \ \ \ \ \ \\ \ \\ \\ \ \ \ CTGGTGCCAGGCGTCAATTGCATTGAGATCGTTATCCCGACGAGAGAGCGAATCTGTGAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GACCACGGTCCGCAGTTAACGTAACTCTAGCAATAGGGCTGCTCTCTCGCTTAGACACTC / // / / / // // // // // / / / / | || | | | |MwoI |CviRI* || |BsaBI || BcgI | | Ecl136II | || | | | AcyI TspEI || Hin4I |Hpy178III* | | CviJI | || | | EcoRII MfeI || MboI Hpy99I | | AluI | || | | BssKI |DpnI | HgiJII* | || | BseBI BstKTI | HgiAI* | || | ScrFI | SacI | || HgiCI* | SduI | || BcgI | SetI | |NlaIV HinfI | |HgaI MboII | EcoRII TfiI | BssKI BseBI ScrFI L V P G V N C I E I V I P T R E R I C E W C Q A S I A L R S L S R R E S E S V S G A R R Q L H * D R Y P D E R A N L * A ----:----|----:----|----:----|----:----|----:----|----:----| R T G P T L Q M S I T I G V L S R I Q S G P A L R * N C Q S R * G S S L A F R H Q H W A D I A N L D N D R R S L S D T L SetI SduI SacI HgiAI* HgiJII* | SapI | Hin4I | Ksp632I* | | MseI | | |AhaIII* Hin4I | | || Hin4I Hin4I | | || Hin4I EcoRV | BsrI | | || Tsp4CI* | Hpy188I | | CviJI \ \ \\ \ \ \ \ \ \ CTCTTCGGTGTTTTAAACTGTCAAAGCGACAAGATATCGGATATTTTACTACTGGAAAAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAAGCCACAAAATTTGACAGTTTCGCTGTTCTATAGCCTATAAAATGATGACCTTTTC / / // / / / / / / Hin4I | || Tsp4CI* | Hpy188I Hin4I BsrI CviJI | |MseI EcoRV Hin4I | AhaIII* | Hin4I | Hin4I Ksp632I* SapI L F G V L N C Q S D K I S D I L L L E K S S V F * T V K A T R Y R I F Y Y W K S L R C F K L S K R Q D I G Y F T T G K A ----:----|----:----|----:----|----:----|----:----|----:----| S K P T K F Q * L S L I D S I K S S S F A R R H K L S D F R C S I P Y K V V P F E E T N * V T L A V L Y R I N * * Q F L TaqI | Hpy99I | | BinI* MboI | | | MboI BslFI TspGWI | | | BamHI |AciI | DpnI | | | XhoII || Cac8I | |TaqI | | | | DpnI || | CviJI | |BstKTI | | | | NlaIV || | |BssKI | || ApoI | | | | |BstKTI || | |SecI* | || TspEI | | | | || BinI* || | |EcoRII \ \\ \ \ \ \ \ \\ \ \\ \ \\ CCTGATCGAATTTCCGTCGAAGTTGAAAGGATCCTGTGGGACAATGACAAGACCGCCAGC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTAGCTTAAAGGCAGCTTCAACTTTCCTAGGACACCCTGTTACTGTTCTGGCGGTCG / // // / / / / // / / /// / | || || | | TaqI | || | BinI* ||| CviJI | || || | Hpy99I | || XhoII ||Cac8I | || || TspEI | || BamHI |BslFI | || || ApoI | || MboI AciI | || |TaqI | |NlaIV | || MboI | |DpnI | |DpnI | BstKTI | BstKTI BinI* TspGWI P D R I S V E V E R I L W D N D K T A S L I E F P S K L K G S C G T M T R P P A * S N F R R S * K D P V G Q * Q D R Q P ----:----|----:----|----:----|----:----|----:----|----:----| G S R I E T S T S L I R H S L S L V A L A Q D F K R R L Q F S G T P C H C S R W R I S N G D F N F P D Q P V I V L G G A Cac8I |AarI |BspMI ||Hin6I |||GlaI ||||HhaI |||||AlfI |||||AlfI ||||||Cac8I ScrFI |||||||AarI BseBI |||||||BspMI |XcmI ||||||||Hin6I || SetI |||||||||GlaI || BsiYI* MboII ||||||||||HhaI \\ \ \ \\\\\\\\\\\ CCAGGTATGGCAGTATGGAGTTTGAAGAACATTAGCACCGACACGCAGGCGCAGGCGCAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCATACCGTCATACCTCAAACTTCTTGTAATCGTGGCTGTGCGTCCGCGTCCGCGTC //// / / ///// //// |||EcoRII MboII | ||||| |||BspMI |||BssKI | ||||| |||SetI ||SecI* | ||||| |||AarI |BsiYI* | ||||| ||Hin6I |BseBI | ||||| |GlaI |ScrFI | ||||| HhaI XcmI | ||||Cac8I SetI | |||BspMI | |||AarI | ||Hin6I | |GlaI | |AlfI | |AlfI | HhaI Cac8I P G M A V W S L K N I S T D T Q A Q A Q Q V W Q Y G V * R T L A P T R R R R R R R Y G S M E F E E H * H R H A G A G A G ----:----|----:----|----:----|----:----|----:----|----:----| G P I A T H L K F F M L V S V C A C A C G L Y P L I S N S S C * C R C A P A P A W T H C Y P T Q L V N A G V R L R L R L BsgI SetI | Hpy99I |CviRI* | |AcyI || HgiCI* | ||AlfI || | SetI | ||AlfI || | NlaIV | ||TspGWI || | | Cac8I | ||| BinI* || | | | Hin6I | ||| | TaqI || | | | |HgaI | ||| | ClaI || | | | |GlaI | ||| | |MboI BsmAI || | | | |MstI* | ||| | || DpnI Esp3I || | | | ||HhaI | ||| | || |BstKTI | MslI BseGI \\ \ \ \ \\\ \ \\\ \ \\ \\ \ \ \ GTGCAGGTGCCTGCGCAATCGTCGGCGTCAATCGATCCGTCTCGCACAAGGATGAGCAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTCCACGGACGCGTTAGCAGCCGCAGTTAGCTAGGCAGAGCGTGTTCCTACTCGTTT // / // /// // / / / // / // / || | || ||| || | | | || MboI |MslI BseGI || | || ||| || | | | |DpnI Esp3I || | || ||| || | | | BstKTI BsmAI || | || ||| || | | | ClaI || | || ||| || | | | TaqI || | || ||| || | | BinI* || | || ||| || | AcyI || | || ||| || TspGWI || | || ||| || AlfI || | || ||| || AlfI || | || ||| |BsgI || | || ||| Hpy99I || | || ||| HgaI || | || ||Hin6I || | || |MstI* || | || |GlaI || | || HhaI || | |Cac8I || | HgiCI* || NlaIV |SetI CviRI* V Q V P A Q S S A S I D P S R T R M S K C R C L R N R R R Q S I R L A Q G * A K A G A C A I V G V N R S V S H K D E Q N ----:----|----:----|----:----|----:----|----:----|----:----| T C T G A C D D A D I S G D R V L I L L P A P A Q A I T P T L R D T E C L S S C H L H R R L R R R * D I R R A C P H A F TaqI | ApoI | TspEI BsmAI | EcoRI MlyI HinfI Eco31I FokI | | BccI PleI | TaqI | BslFI \ \ \ \ \ \ \ \ \ ATGGCAAGGAAAGACCCCACCATCGAATTCTGTCAGTTGGGACTCGACACTTTTGAGACC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTTCCTTTCTGGGGTGGTAGCTTAAGACAGTCAACCCTGAGCTGTGAAAACTCTGG / / / // / / / / FokI | EcoRI |PleI | TaqI | BslFI | TspEI MlyI HinfI Eco31I | BccI BsmAI | ApoI TaqI M A R K D P T I E F C Q L G L D T F E T W Q G K T P P S N S V S W D S T L L R P G K E R P H H R I L S V G T R H F * D Q ----:----|----:----|----:----|----:----|----:----|----:----| I A L F S G V M S N Q * N P S S V K S V F P L S L G W W R I R D T P V R C K Q S H C P F V G G D F E T L Q S E V S K L G FatI |CviAII ||Cac8I ||| SphI ||| NspI ||| NlaIII MslI ||| |MaeI BsmAI SetI BspMI \ \\\ \\ \ \ \ AAATACATAACAATGTTTGGCATGCTAGTCTCCTGCTCGTTTGATAAACCTGCCTTTATA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGTATTGTTACAAACCGTACGATCAGAGGACGAGCAAACTATTTGGACGGAAATAT / / /// / / / MslI | ||| MaeI BsmAI SetI | ||FatI | |CviAII | Cac8I NlaIII NspI SphI K Y I T M F G M L V S C S F D K P A F I N T * Q C L A C * S P A R L I N L P L Y I H N N V W H A S L L L V * * T C L Y I ----:----|----:----|----:----|----:----|----:----|----:----| L Y M V I N P M S T E Q E N S L G A K I W I C L L T Q C A L R R S T Q Y V Q R * F V Y C H K A H * D G A R K I F R G K Y EcoRV \ TCTTTTGTCTTTAGCGATTTTACCAAGAACGATATCGTCCAAAACTATCTTTACGACAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAAACAGAAATCGCTAAAATGGTTCTTGCTATAGCAGGTTTTGATAGAAATGCTGTCT / / BspMI EcoRV S F V F S D F T K N D I V Q N Y L Y D R L L S L A I L P R T I S S K T I F T T D F C L * R F Y Q E R Y R P K L S L R Q I ----:----|----:----|----:----|----:----|----:----|----:----| D K T K L S K V L F S I T W F * R * S L I K Q R * R N * W S R Y R G F S D K R C R K D K A I K G L V I D D L V I K V V S CviJI | FatI | |CviAII | || TatI | || Bsp1407I MnlI | || |Csp6I AluI | || |NlaIII CviJI | || ||RsaI EcoRV | SetI CviJI | || ||BccI \ \ \ \ \ \\ \\\ TATCTAATAGATTACGAGAACAAGTTAGAGCTGAACGAGGGCTTCAAAGCCATCATGTAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGATTATCTAATGCTCTTGTTCAATCTCGACTTGCTCCCGAAGTTTCGGTAGTACATG / /// / / / ///// EcoRV ||CviJI CviJI | | ||||Bsp1407I ||AluI | | ||||TatI |MnlI | | |||Csp6I SetI | | |||BccI | | ||RsaI | | |FatI | | CviAII | NlaIII CviJI Y L I D Y E N K L E L N E G F K A I M Y I * * I T R T S * S * T R A S K P S C T S N R L R E Q V R A E R G L Q S H H V Q ----:----|----:----|----:----|----:----|----:----|----:----| Y R I S * S F L N S S F S P K L A M M Y I D L L N R S C T L A S R P S * L W * T I * Y I V L V L * L Q V L A E F G D H V TspEI | TaqI | AsuII | | MlyI | | PleI | | AclI | | MaeII | | | SetI | | | TaiI | | | | HinfI | | | | | DdeI | | | | | | AluI | | | | | | CviJI | | | | | | |DdeI | | | | | | ||SetI | | | | | | ||| Hpy188I | | | | | | ||| | SspI MboI | | | | | | ||| | | BspCNI CviJI BglII | | | | | | ||| | | |BseMII |DdeI XhoII \ \ \ \ \ \ \\\ \ \ \\ \\ \ AAAAACCAATTCGAAACGTTTGACTCTAAGCTCAGAAAAATATTCAACAACGGGCTAAGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGGTTAAGCTTTGCAAACTGAGATTCGAGTCTTTTTATAAGTTGTTGCCCGATTCT / / //// / /// // /// / / | | |||MaeII | ||| |DdeI ||BseMII | DdeI | | |||AclI | ||| Hpy188I |BspCNI CviJI | | ||PleI | ||CviJI SspI | | |MlyI | ||AluI | | TaiI | |DdeI | | SetI | SetI | AsuII HinfI | TaqI TspEI K N Q F E T F D S K L R K I F N N G L R K T N S K R L T L S S E K Y S T T G * E K P I R N V * L * A Q K N I Q Q R A K R ----:----|----:----|----:----|----:----|----:----|----:----| L F W N S V N S E L S L F I N L L P S L C F G I R F T Q S * A * F F I * C R A L F V L E F R K V R L E S F Y E V V P * S CfrI XmaIII* | CviJI | HaeIII | |AciI | |BisI | |McrI* BceAI DpnI | ||BlsI | SetI |BstKTI | |||TauI | | BtgZI ||SfeI* | |||FnuDII* | | | TspDTI BceAI \\\ \ \\\\ \ \ \ \ \ GATCTACAGAACGGCCGCGATGAAAACCTTTCGCAATACGGCATAGTTTGTAAGATGAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGATGTCTTGCCGGCGCTACTTTTGGAAAGCGTTATGCCGTATCAAACATTCTACTTA // / / ///// / / / / / || | | ||||FnuDII* | | | BtgZI BceAI || | | ||||AciI | | TspDTI || | | |||XmaIII* | BceAI || | | |||CfrI SetI || | | |||BisI || | | ||BlsI || | | |HaeIII || | | |CviJI || | | |TauI || | | McrI* || | SfeI* || XhoII || BglII || MboI |DpnI BstKTI D L Q N G R D E N L S Q Y G I V C K M N I Y R T A A M K T F R N T A * F V R * I S T E R P R * K P F A I R H S L * D E Y ----:----|----:----|----:----|----:----|----:----|----:----| S R C F P R S S F R E C Y P M T Q L I F L D V S R G R H F G K A I R C L K Y S S I * L V A A I F V K R L V A Y N T L H I CviJI Cfr10I |HpaII TspDTI Hin6I || AsuI* | TatI |GlaI || AvaII | Bsp1407I |BslFI || |BmgT120I | |Csp6I BsmI ||HhaI || ||NlaIV | ||RsaI TspEI BceAI ||FnuDII* || |||MwoI \ \\\ \ \ \\\ \\ \\\\ ATAAAAGTGAAAATGTACAACGGCAAATTGAATGCCATTGTGCGCGAATGTGAGCCGGTC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTCACTTTTACATGTTGCCGTTTAACTTACGGTAACACGCGCTTACACTCGGCCAG / /// / / / /// / / //// TspDTI ||Bsp1407I | | | ||| BslFI | |||AvaII ||TatI | | | ||FnuDII* | |||AsuI* |Csp6I | | | ||Hin6I | ||BmgT120I RsaI | | | |GlaI | ||NlaIV | | | HhaI | |Cfr10I | | BceAI | HpaII | BsmI | MwoI TspEI CviJI I K V K M Y N G K L N A I V R E C E P V * K * K C T T A N * M P L C A N V S R S K S E N V Q R Q I E C H C A R M * A G P ----:----|----:----|----:----|----:----|----:----|----:----| I F T F I Y L P L N F A M T R S H S G T Y L L S F T C R C I S H W Q A R I H A P Y F H F H V V A F Q I G N H A F T L R D AciI MnlI | BsmI TseI | Tsp4CI* | | BtgZI |BisI BbvI | | Hin4II* | | | FauI ||BlsI SfaNI | | | TspRI MseI \ \ \ \ \\\ \ \ \ \ \ \ CCGCATTCCCAAATAAGCAGCATCGCCTCGCCTTCACAGTGCGAACATTTAAGATTGTTC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGTAAGGGTTTATTCGTCGTAGCGGAGCGGAAGTGTCACGCTTGTAAATTCTAACAAG / / / /// /// / / / | AciI BtgZI ||TseI ||| | Hin4II* MseI BsmI FauI |BisI ||| Tsp4CI* BlsI ||MnlI |TspRI SfaNI BbvI P H S Q I S S I A S P S Q C E H L R L F R I P K * A A S P R L H S A N I * D C S A F P N K Q H R L A F T V R T F K I V L ----:----|----:----|----:----|----:----|----:----|----:----| G C E W I L L M A E G E C H S C K L N N G A N G F L C C R R A K V T R V N L I T R M G L Y A A D G R R * L A F M * S Q E MnlI TfiI |Csp6I HinfI Ksp632I* ||RsaI Hpy178III* | AciI | TaqI |||BetI* | TspEI | | TspEI | AsuII ||||HpaII \ \ \ \ \ \ \ \\\\\ TACCAACGAGCGTTCAAGAGAATTGGCGAATCCGCAATTTCACGCTATTTCGAAGAGTAC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTGCTCGCAAGTTCTCTTAACCGCTTAGGCGTTAAAGTGCGATAAAGCTTCTCATG / / / / / / / / // | TspEI | AciI TspEI | | | |Csp6I Hpy178III* HinfI | | | RsaI TfiI | | MnlI | AsuII | TaqI Ksp632I* Y Q R A F K R I G E S A I S R Y F E E Y T N E R S R E L A N P Q F H A I S K S T P T S V Q E N W R I R N F T L F R R V P ----:----|----:----|----:----|----:----|----:----|----:----| * W R A N L L I P S D A I E R * K S S Y R G V L T * S F Q R I R L K V S N R L T V L S R E L S N A F G C N * A I E F L V BseMII |BspCNI ||Hpy178III* |||NruI MboII XmnI |||FnuDII* SetI | SetI |Tsp4CI* ||||MnlI DdeI |TaqI \ \ \\ \\\\\ \ \\ CGGAGGTTTTTCCCCATACATAGAAACGGTTCTCATCTCGCGAAACTGAGGTTCGATGAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GCCTCCAAAAAGGGGTATGTATCTTTGCCAAGAGTAGAGCGCTTTGACTCCAAGCTACTT // / // // // / |MboII Tsp4CI* || || |DdeI TaqI |BetI* XmnI || || SetI |SetI || |Hpy178III* HpaII || FnuDII* || NruI || MnlI |BspCNI BseMII R R F F P I H R N G S H L A K L R F D E G G F S P Y I E T V L I S R N * G S M K E V F P H T * K R F S S R E T E V R * S ----:----|----:----|----:----|----:----|----:----|----:----| R L N K G M C L F P E * R A F S L N S S G S T K G W V Y F R N E D R S V S T R H P P K E G Y M S V T R M E R F Q P E I F FatI |CviAII AluI || NlaIII CviJI || |TspDTI | SetI || || HphI TspDTI | TaqII BcgI \\ \\ \ \ \ \ \ GTAAAGCATGAACCAAAAAAATCACCCACTACACCAGCTCTCGCAGAACACATACCCGAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTCGTACTTGGTTTTTTTAGTGGGTGATGTGGTCGAGAGCGTCTTGTGTATGGGCTG / // / / / / / / / | || HphI TspDTI | TaqII BcgI | BsaXI | |FatI | CviJI | SetI | TspDTI | AluI Hin4I | CviAII SetI NlaIII V K H E P K K S P T T P A L A E H I P D * S M N Q K N H P L H Q L S Q N T Y P T K A * T K K I T H Y T S S R R T H T R P ----:----|----:----|----:----|----:----|----:----|----:----| T F C S G F F D G V V G A R A S C M G S L L A H V L F I V W * V L E R L V C V R Y L M F W F F * G S C W S E C F V Y G V BcgI | TaqI CviRI* | | MnlI | BsmI | | | Hin4II* | | MaeII | | | |BsaXI | | AflIII | | | || Hin4I BsaXI | | |BtrI | | | || | Hpy166II BseRI Hin4I | | || SetI | | | || | | MboII |MlyI |SetI | | || TaiI | | | || | | | NmeAIII |PleI HinfI \\ \ \ \\ \ \ \ \ \\ \ \ \ \ \\ \ CTGAATGCAGACGTGTCCTCCTTCGATGTAAAGTTCACAGATATATCTTCTCTCTTGGAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTACGTCTGCACAGGAGGAAGCTACATTTCAAGTGTCTATATAGAAGAGAGAACCTG / / // / / // // / / / / // | | || | BcgI || || | | NmeAIII | |PleI | | || AflIII || || | MboII | MlyI | | |MaeII || || Hpy166II BseRI | | BtrI || |Hin4II* | TaiI || Hin4I | SetI || BsaXI CviRI* |MnlI BsmI TaqI L N A D V S S F D V K F T D I S S L L D * M Q T C P P S M * S S Q I Y L L S W T E C R R V L L R C K V H R Y I F S L G L ----:----|----:----|----:----|----:----|----:----|----:----| R F A S T D E K S T F N V S I D E R K S G S H L R T R R R H L T * L Y I K E R P Q I C V H G G E I Y L E C I Y R R E Q V SecI* | CviJI | | Cac8I | | | MnlI | | | | AciI | | | | |MwoI | | | | ||Hin6I | | | | ||FnuDII* | | | | |||GlaI | | | | ||||HhaI BceAI | | | | ||||| MnlI | MnlI | | | | ||||| |FauI | |Tsp4CI* | | | | ||||| ||MwoI | || BtgZI \ \ \ \ \\\\\ \\\ \ \\ \ TCCTCGGCTCGCCTCCCGCGCCCACAGCAAACACACAAGAGCAACACATTATACAGTTGC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGCCGAGCGGAGGGCGCGGGTGTCGTTTGTGTGTTCTCGTTGTGTAATATGTCAACG / // / / / //// / /// | || | | | |||| FauI ||Tsp4CI* | || | | | |||MnlI |MnlI | || | | | |||MwoI BceAI | || | | | ||Hin6I | || | | | |GlaI | || | | | FnuDII* | || | | | AciI | || | | | HhaI | || | | MwoI | || | MnlI | || Cac8I | |CviJI | SecI* HinfI S S A R L P R P Q Q T H K S N T L Y S C P R L A S R A H S K H T R A T H Y T V A L G S P P A P T A N T Q E Q H I I Q L R ----:----|----:----|----:----|----:----|----:----|----:----| E E A R R G R G C C V C L L L V N Y L Q S R P E G G A G V A F V C S C C M I C N G R S A E R A W L L C V L A V C * V T A MboI AsuI* TaqI Hpy188I |BmgT120I | Csp6I | DpnI ||CviJI | |RsaI | |BstKTI ||HaeIII | |BccI | ||SfaNI Hpy178III* \\\ \ \\ \ \\\ \ GAGGGCCGTATCATCGCCATCGAGTACCACGCATCTGATCTCTGCTTCCATATCACGAAT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCCGGCATAGTAGCGGTAGCTCATGGTGCGTAGACTAGAGACGAAGGTATAGTGCTTA / // / // / // / / / | |AsuI* | |Csp6I | || | SfaNI Hpy178III* | BmgT120I | |BccI | || MboI | HaeIII | RsaI | |DpnI | CviJI TaqI | BstKTI BtgZI Hpy188I E G R I I A I E Y H A S D L C F H I T N R A V S S P S S T T H L I S A S I S R M G P Y H R H R V P R I * S L L P Y H E * ----:----|----:----|----:----|----:----|----:----|----:----| S P R I M A M S Y W A D S R Q K W I V F R P G Y * R W R T G R M Q D R S G Y * S L A T D D G D L V V C R I E A E M D R I AciI SecI* DsaI* | AciI | FnuDII* | NspBII* | |BisI | |SacII | ||BlsI | |||TauI | |||CviJI | ||||BsiYI* | |||||FauI | |||||BsaXI | |||||| AsuI* | |||||| |CviJI AluI | |||||| |HaeIII CviJI | |||||| |BmgT120I Ecl136II | |||||| ||BssKI | SetI | |||||| ||SecI* | SduI | |||||| ||NlaIV | SacI | |||||| ||| HpaII | HgiAI* | |||||| ||| ScrFI MwoI | HgiJII* | |||||| ||| CauII* | CviRI* BsaXI \ \ \ \\\\\\ \\\ \ \ \ \ GAGCTCCCACTTTTACAAACCCGCGGCTTGGCCCCGGAGCGAGTGTTGCAACTACACATC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAGGGTGAAAATGTTTGGGCGCCGAACCGGGGCCTCGCTCACAACGTTGATGTGTAG / / ///// //// /// / / / | Ecl136II ||||| |||| ||| MwoI CviRI* BsaXI | CviJI ||||| |||| ||BssKI | AluI ||||| |||| |SecI* HgiJII* ||||| |||| |HpaII HgiAI* ||||| |||| CauII* SacI ||||| |||| ScrFI SduI ||||| |||AsuI* SetI ||||| ||BmgT120I ||||| ||NlaIV ||||| |HaeIII ||||| |CviJI ||||| FauI ||||CviJI |||DsaI* |||SecI* |||BsaXI |||BisI |||AciI ||BsiYI* ||BlsI |NspBII* |FnuDII* |AciI |TauI SacII E L P L L Q T R G L A P E R V L Q L H I S S H F Y K P A A W P R S E C C N Y T S A P T F T N P R L G P G A S V A T T H H ----:----|----:----|----:----|----:----|----:----|----:----| S S G S K C V R P K A G S R T N C S C M H A G V K V F G R S P G P A L T A V V C L E W K * L G A A Q G R L S H Q L * V D Hin6I |GlaI AciI ||HgaI | BsrBI ||HhaI MnlI SetI MnlI Bce83I* | |SmlI |||HaeII CviJI \ \ \ \ \\ \\\\ \ ATTACCTCCAAGAACTTTGCTTATTTTTTCAACCGCTCAAGCGCCTACTTACAGCGTCAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGGAGGTTCTTGAAACGAATAAAAAAGTTGGCGAGTTCGCGGATGAATGTCGCAGTC / / / / //// / // SetI MnlI Bce83I* | |||| HgaI |CviJI | |||Hin6I MnlI | ||GlaI | |HhaI | HaeII | SmlI BsrBI AciI I T S K N F A Y F F N R S S A Y L Q R Q L P P R T L L I F S T A Q A P T Y S V S Y L Q E L C L F F Q P L K R L L T A S A ----:----|----:----|----:----|----:----|----:----|----:----| M V E L F K A * K K L R E L A * K C R * * * R W S S Q K N K * G S L R R S V A D N G G L V K S I K E V A * A G V * L T L NmeAIII | MfeI | TspEI | | Bce83I* MseI | | | TspEI |SwaI | | | | TspDTI |AhaIII* SmlI | | | | | CfrI ||ApoI Hpy178III* | | | | | | CviJI ||TspEI | MnlI | | | | | | HaeIII ||| BseRI \ \ \ \ \ \ \ \ \ \\\ \ CCTCTTGAGGAAAAATATACGCAATTGGCACAATTTCTCGGCCATTCATTTAAATTCAAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGAACTCCTTTTTATATGCGTTAACCGTGTTAAAGAGCCGGTAAGTAAATTTAAGTTA / / / / / / / / / / // // | | MnlI NmeAIII | TspEI | TspEI | CfrI || |TspEI | SmlI | MfeI TspDTI HaeIII || |ApoI Hpy178III* Bce83I* CviJI || BseRI |MseI AhaIII* SwaI P L E E K Y T Q L A Q F L G H S F K F N L L R K N I R N W H N F S A I H L N S I S * G K I Y A I G T I S R P F I * I Q Y ----:----|----:----|----:----|----:----|----:----|----:----| G R S S F Y V C N A C N R P W E N L N L A E Q P F I Y A I P V I E R G N M * I * R K L F F I R L Q C L K E A M * K F E I Hpy178III* | MboI | BglII | XhoII | | DpnI GsuI | | |BstKTI Eco57MI | | || HgiCI* | OliI | | || | NlaIV | MslI | | || | | SduI | |SecI* | | || | | BseSI MnlI | |DsaI* | | || | | |MfeI SetI | MnlI | ||Tsp4CI* | | || | | |TspEI \ \ \ \ \\\ \ \ \\ \ \ \\ ATAACCTCCTCGCTCACGCTGTTCCCTGACACTACCGTGGCACTCCAGATCTGGTGCCCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGGAGGAGCGAGTGCGACAAGGGACTGTGATGGCACCGTGAGGTCTAGACCACGGGT / / / / // / /// / // / SetI | MnlI Eco57MI || DsaI* ||| | || HgiCI* MnlI GsuI || SecI* ||| | |NlaIV |Tsp4CI* ||| | BseSI MslI ||| | SduI OliI ||| XhoII ||| BglII ||| MboI ||DpnI |BstKTI Hpy178III* I T S S L T L F P D T T V A L Q I W C P * P P R S R C S L T L P W H S R S G A Q N L L A H A V P * H Y R G T P D L V P N ----:----|----:----|----:----|----:----|----:----|----:----| I V E E S V S N G S V V T A S W I Q H G Y L R R A * A T G Q C * R P V G S R T G Y G G R E R Q E R V S G H C E L D P A W CviRI* | BsmI | | SetI | | | Hpy178III* | | | | TspEI | | | | | CviRI* | | | | | | FokI | | | | | | | MwoI | | | | | | | | AluI | | | | | | | | CviJI | | | | | | | | PvuII | | | | | | | | NspBII* | | | | | | | | | SetI | | | | | | | | | Cac8I | | | | | | | | | |AsuI* | | | | | | | | | ||CviJI | | | | | | | | | ||HaeIII | | | | | | | | | ||BmgT120I | | | | | | | | | ||| BseGI | | | | | | | | | ||| Hin4II* | | | | | | | | | ||| | Hpy188I | | | | | | | | | ||| | |BsiYI* | | | | | | | | | ||| | || BccI | | | | | | | | | ||| | || | SetI | | | | | | | | | ||| | || | | TseI | | | | | | | | | ||| | || | | CviRI* | | | | | | | | | ||| | || | | |BisI | | | | | | | | | ||| | || | | ||BlsI | | | | | | | | | ||| | || | | |||AciI | | | | | | | | | ||| | || | | |||NspBII* | | | | | | | | | ||| | || | | ||||BisI | | | | | | | | | ||| | || | | |||||BlsI | | | | | | | | | ||| | || | | ||||||TauI | | | | | | | | | ||| | || | | ||||||CviJI | | | | | | | | | ||| | || | | |||||||NlaIV \ \ \ \ \ \ \ \ \ \\\ \ \\ \ \ \\\\\\\\ ATTGAATGCACCTTTCGGGAATTGCAACAACAGCTGGCCCATCCGAAGGTTGCAGCGGCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTACGTGGAAAGCCCTTAACGTTGTTGTCGACCGGGTAGGCTTCCAACGTCGCCGA / // / // / // / / /// // / / //////// | |SetI | || | || | | ||| || | | |||||||NlaIV | CviRI* | || | || | | ||| || | | ||||||CviJI | BsmI | || | || | | ||| || | | |||||BisI TspEI | || | || | | ||| || | | |||||AciI MfeI | || | || | | ||| || | | ||||BlsI | || | || | | ||| || | | |||NspBII* | || | || | | ||| || | | |||TseI | || | || | | ||| || | | |||TauI | || | || | | ||| || | | ||BisI | || | || | | ||| || | | |BlsI | || | || | | ||| || | | CviRI* | || | || | | ||| || | BccI | || | || | | ||| || SetI | || | || | | ||| |Hpy188I | || | || | | ||| BsiYI* | || | || | | ||AsuI* | || | || | | |BmgT120I | || | || | | |Hin4II* | || | || | | HaeIII | || | || | | CviJI | || | || | | BseGI | || | || | Cac8I | || | || NspBII* | || | || PvuII | || | || CviJI | || | || AluI | || | |SetI | || | FokI | || MwoI | |CviRI* | TspEI Hpy178III* I E C T F R E L Q Q Q L A H P K V A A A L N A P F G N C N N S W P I R R L Q R L * M H L S G I A T T A G P S E G C S G S ----:----|----:----|----:----|----:----|----:----|----:----| I S H V K R S N C C C S A W G F T A A A L Q I C R E P I A V V A P G D S P Q L P N F A G K P F Q L L L Q G M R L N C R S Hpy178III* | TfiI | BbvI | HinfI | |EcoNI | || BsiYI* | || | HinfI | || | | Hpy178III* | || | | | PleI | || | | | |MlyI | || | | | || Hin6I | || | | | || |GlaI | || | | | || |MstI* | || | | | || ||HhaI | || | | | || |||TspEI | || | | | || |||| MseI | || | | | || |||| VspI | || | | | || |||| | MwoI | || | | | || |||| | BstAPI Tsp4CI* MnlI \ \\ \ \ \ \\ \\\\ \ \ \ \ CCTGATTCAGGGAGTCTTGATTGCGCAATTAATGCTACCGTCAATCCTCTGCGACTTCTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTAAGTCCCTCAGAACTAACGCGTTAATTACGATGGCAGTTAGGAGACGCTGAAGAA // /// / / / /// / // / / || ||BbvI | | | ||| | |VspI Tsp4CI* MnlI || |HinfI | | | ||| | |MseI || |TfiI | | | ||| | TspEI || EcoNI | | | ||| BstAPI |BsiYI* | | | ||| MwoI Hpy178III* | | | ||Hin6I | | | |MstI* | | | |GlaI | | | HhaI | | PleI | | MlyI | Hpy178III* HinfI P D S G S L D C A I N A T V N P L R L L L I Q G V L I A Q L M L P S I L C D F L * F R E S * L R N * C Y R Q S S A T S C ----:----|----:----|----:----|----:----|----:----|----:----| G S E P L R S Q A I L A V T L G R R S R E Q N L S D Q N R L * H * R * D E A V E R I * P T K I A C N I S G D I R Q S K K AciI BisI |HgaI |BlsI BceAI ||TauI AcyI | BseRI ||Hin6I |MaeIII | | AcyI ||FnuDII* |Tsp45I | | | HpaII |||GlaI || Tsp4CI* | | | | NlaIV ||||HhaI || | MnlI | | | | |HgaI ||||| HphI || | | MnlI | | | | |CviJI \\\\\ \ \\ \ \ \ \ \ \ \ \\ GCCGCGCAAAATGGCGTCACCGTGAAAAAGGAGGAGGATAATGACGATGACGCCGGAGCC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGCGTTTTACCGCAGTGGCACTTTTTCCTCCTCCTATTACTGCTACTGCGGCCTCGG ////// / / / / / // / / // |||||| HgaI | | | MnlI |BceAI | | |CviJI |||||| HphI | | MnlI BseRI | | NlaIV |||||Hin6I | Tsp4CI* | HpaII ||||GlaI | Tsp45I AcyI |||FnuDII* | MaeIII |||AciI AcyI |||HhaI ||BisI |BlsI TauI A A Q N G V T V K K E E D N D D D A G A P R K M A S P * K R R R I M T M T P E P R A K W R H R E K G G G * * R * R R S R ----:----|----:----|----:----|----:----|----:----|----:----| A A C F P T V T F F S S S L S S S A P A Q R A F H R * R S F P P P Y H R H R R L G R L I A D G H F L L L I I V I V G S G SetI \ GTTCCCACCTCGTAA 2770 ----:----|----: CAAGGGTGGAGCATT / / | SetI HgaI V P T S * F P P R X S H L V X ----:----|----: T G V E Y R E W R T N G G R L # Enzymes that cut Frequency Isoschizomers AarI 2 AciI 12 BspACI,SsiI AclI 1 Psp1406I AcyI 4 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 3 DraI AlfI 2 AluI 13 AluBI ApoI 5 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BccI 5 Bce83I* 2 BpuEI BceAI 5 BcgI 2 BciVI 1 BfuI BetI* 2 BsaWI BglII 2 BinI* 5 AlwI,BspPI,AclWI BisI 11 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 11 BmeT110I 1 BmgT120I 5 BsaBI 1 Bse8I,BseJI BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 6 BseRI 5 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 5 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 6 BspMI 3 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrI 3 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstAPI 1 BstKTI 11 BstXI 1 BtgZI 3 BtrI 1 BmgBI,AjiI Cac8I 8 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CviAII 6 CviJI 37 CviKI-1 CviRI* 10 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 11 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Ecl136II 3 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI FatI 6 FauI 3 SmuI FnuDII* 7 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 11 GsaI 1 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 7 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HgiJII* 4 Eco24I,EcoT38I,FriOI,BanII HhaI 11 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 4 HpyAV Hin6I 11 HinP1I,HspAI HindIII 2 HinfI 15 HpaII 7 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 10 Hpy99I 3 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MluI 1 MlyI 5 SchI MmeI 1 MnlI 31 MseI 10 Tru1I,Tru9I MslI 4 RseI,SmiMI MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 9 HpyF10VI,BstMWI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NmeAIII 2 NruI 1 BtuMI,Bsp68I NspBII* 3 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PleI 5 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI PspXI 1 PvuII 1 RsaI 5 AfaI SacI 3 Psp124BI,SstI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SapI 2 LguI,PciSI,BspQI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 42 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 3 SmoI SphI 1 PaeI,BbuI SspI 4 SwaI 1 SmiI TaiI 2 TaqI 12 TaqII 1 TatI 2 TauI 5 TfiI 10 PfeI TseI 6 ApeKI Tsp45I 2 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 2 PshBI,AseI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 4 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AflII AgeI AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BalI BarI BbvCI BbvII* BclI BdaI BfiI BglI BmtI BplI Bpu10I BsaAI BsePI BsiI* Bsp120I BspHI BspLU11I* BspOI BsrDI BssNAI Bst1107I BstEII BstZ17I BtsI Cfr9I CspCI DinI DraIII DrdI Eam1105I EciI Eco47III EcoP15I EgeI EheI EspI* FalI FseI FspAI HindII HpaI KasI KpnI MauBI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NotI PacI PasI PflMI PfoI PmaCI PmeI PshAI PsiI PspOMI PsrI PstI PvuI RsrII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI StyI TsoI TspMI TstI XbaI XmaCI XmaI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769