Restriction Map of HEM3/YDL205C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HEM3/YDL205C on chromosome IV from coordinates 93745 to 92762.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.10830

EMBOSS_001 AsuI* Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I ||| ApaI ||| SduI ||| BseSI TaqI ||| HgiJII* MslI | TspEI AciI \\\ \ \ \ \ \ ATGGGCCCTGAAACTCTACATATTGGTGGGAGAAAATCGAAATTGGCGGTAATACAATCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGGGACTTTGAGATGTATAACCACCCTCTTTTAGCTTTAACCGCCATTATGTTAGG / /// / / / / | ||Bsp120I MslI TaqI | AciI | ||DraII TspEI | ||AsuI* | |BmgT120I | |AsuI* | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI M G P E T L H I G G R K S K L A V I Q S W A L K L Y I L V G E N R N W R * Y N P G P * N S T Y W W E K I E I G G N T I Q ----:----|----:----|----:----|----:----|----:----|----:----| X P G S V R C I P P L F D F N A T I C D X P G Q F E V Y Q H S F I S I P P L V I H A R F S * M N T P S F R F Q R Y Y L G FatI |CviAII || NlaIII || | MseI || | |AhaIII* BetI* || | || MboI BspMII* || | || | DpnI |HpaII || | || | |TaqI |MboII || | || | |BstKTI |Hpy178III* CviRI* || | || | || MmeI || BciVI | SetI \\ \ \\ \ \\ \ \\ \ \ \ AACCATGTTTTAAAACTGATCGAAGAAAAGTATCCGGACTACGACTGCAAGGTTTTCACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTACAAAATTTTGACTAGCTTCTTTTCATAGGCCTGATGCTGACGTTCCAAAAGTGA / // // // // / // / / / | || |MseI || |TaqI | || BciVI | SetI | || | || MmeI | |BspMII* CviRI* | || | || MboI | |BetI* | || | |DpnI | Hpy178III* | || | BstKTI | HpaII | || AhaIII* MboII | |FatI | CviAII NlaIII N H V L K L I E E K Y P D Y D C K V F T T M F * N * S K K S I R T T T A R F S L P C F K T D R R K V S G L R L Q G F H F ----:----|----:----|----:----|----:----|----:----|----:----| L W T K F S I S S F Y G S * S Q L T K V W G H K L V S R L F T D P S R S C P K * V M N * F Q D F F L I R V V V A L N E S SetI | TatI MmeI TfiI | BdaI HindIII CviRI* MaeIII HinfI | BdaI | AluI |BdaI Tsp45I | HphI | |Csp6I | CviJI |BdaI BstEII | TspEI | ||RsaI AciI | | SetI \\ \ \ \ \ \\\ \ \ \ \ TTGCAAACTCTTGGTGACCAGATTCAATTCAAACCTTTGTACTCATTTGGCGGTAAAGCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTGAGAACCACTGGTCTAAGTTAAGTTTGGAAACATGAGTAAACCGCCATTTCGA // / / / / / /// / / / / / |CviRI* | | | | | ||TatI | | | | HindIII BdaI | | | | | |Csp6I | | | CviJI BdaI | | | | | RsaI | | | AluI | | | | BdaI | | SetI | | | | BdaI | MmeI | | | SetI AciI | | TspEI | HinfI | HphI | TfiI BstEII Tsp45I MaeIII L Q T L G D Q I Q F K P L Y S F G G K A C K L L V T R F N S N L C T H L A V K L A N S W * P D S I Q T F V L I W R * S F ----:----|----:----|----:----|----:----|----:----|----:----| K C V R P S W I * N L G K Y E N P P L A K A F E Q H G S E I * V K T S M Q R Y L Q L S K T V L N L E F R Q V * K A T F S BbvII* | Hin4I | | MboII | | |BccI | | ||FatI | | |||BinI* | | |||CviAII | | |||| NlaIII HindIII | | |||| | MboI | AluI | | |||| | | DpnI | MnlI | | |||| | | |BstKTI | CviJI | | |||| | | ||FalI | | SetI | | |||| | | ||FalI | | | TspDTI FalI | | |||| | | ||FalI | | | | Hin4I \ \ \ \\\\ \ \ \\\ \ \ \ \ \ TTATGGACAAAGGAGTTGGAAGACCATCTTTACCATGACGATCCCTCAAAGAAGCTTGAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATACCTGTTTCCTCAACCTTCTGGTAGAAATGGTACTGCTAGGGAGTTTCTTCGAACTG / / / / //// // / ///// FalI Hin4I | | |||| || MboI ||||HindIII | | |||| |DpnI ||||TspDTI | | |||| BstKTI |||Hin4I | | |||FalI ||CviJI | | |||FalI ||AluI | | |||FalI |MnlI | | ||FatI SetI | | |CviAII | | BinI* | NlaIII | BccI BbvII* MboII L W T K E L E D H L Y H D D P S K K L D Y G Q R S W K T I F T M T I P Q R S L T M D K G V G R P S L P * R S L K E A * L ----:----|----:----|----:----|----:----|----:----|----:----| K H V F S N S S W R * W S S G E F F S S K I S L P T P L G D K G H R D R L S A Q * P C L L Q F V M K V M V I G * L L K V Hin4II* | FalI | FalI TaqI | | Hpy188I | AluI | | | FatI | BseYI MboI | | | |CviAII MnlI | CviJI | DpnI | | | || NspI |Eco57I | | SetI | |BstKTI | | | || NlaIII |Eco57MI | | | GsaI \ \\ \ \ \ \\ \ \\ \ \ \ \ TTGATCGTTCATTCTCTGAAGGACATGCCCACTTTACTACCAGAGGGTTTCGAGCTGGGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGCAAGTAAGAGACTTCCTGTACGGGTGAAATGATGGTCTCCCAAAGCTCGACCCC // / // / / // / / / / || | || | | |FatI Eco57MI | | BseYI || | || | | CviAII Eco57I | CviJI || | || | NlaIII MnlI | AluI || | || | NspI | GsaI || | || Hpy188I TaqI || | |Hin4II* SetI || | FalI || | FalI || MboI |DpnI BstKTI L I V H S L K D M P T L L P E G F E L G * S F I L * R T C P L Y Y Q R V S S W G D R S F S E G H A H F T T R G F R A G G ----:----|----:----|----:----|----:----|----:----|----:----| K I T * E R F S M G V K S G S P K S S P S S R E N E S P C A W K V V L P N R A P Q D N M R Q L V H G S * * W L T E L Q P FauI | DdeI | | AciI | | |BinI* | | || TaqI FatI | | || |MboI |CviAII | | || || DpnI || NlaIII | | || || |BstKTI || | MmeI PsiI \ \ \\ \\ \\ \\ \ \ \ GGTATCACTAAGCGGGTCGATCCAACAGATTGTCTTGTCATGCCCTTTTACTCTGCTTAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGTGATTCGCCCAGCTAGGTTGTCTAACAGAACAGTACGGGAAAATGAGACGAATA / / / // / / // / / | | | || MboI | || MmeI PsiI | | | |DpnI | |FatI | | | BstKTI | CviAII | | | TaqI NlaIII | | BinI* | | AciI | DdeI FauI G I T K R V D P T D C L V M P F Y S A Y V S L S G S I Q Q I V L S C P F T L L I Y H * A G R S N R L S C H A L L L C L * ----:----|----:----|----:----|----:----|----:----|----:----| P I V L R T S G V S Q R T M G K * E A * P Y * * A P R D L L N D Q * A R K S Q K T D S L P D I W C I T K D H G K V R S I Hpy178III* | BseGI | | SetI MnlI | | | Hpy178III* | MboI | | | | FokI TspGWI | BglII | | | | | BsiYI* | NlaIV | XhoII | | | | | Hin4II* | | SetI | | DpnI |BsmAI | | | | | FokI | | BseGI | | |BstKTI \\ \ \ \ \ \ \ \ \ \ \ \ \\ AAGTCTCTGGATGACCTTCCAGACGGGGGGATTGTGGGAACCTCATCCGTGAGAAGATCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAGACCTACTGGAAGGTCTGCCCCCCTAACACCCTTGGAGTAGGCACTCTTCTAGA / // // / / / / / / // / | |BseGI || | FokI | | BseGI MnlI || XhoII | |SetI || Hin4II* | NlaIV || BglII | BsmAI |BsiYI* | SetI || MboI Hpy178III* Hpy178III* TspGWI |DpnI FokI BstKTI K S L D D L P D G G I V G T S S V R R S S L W M T F Q T G G L W E P H P * E D L V S G * P S R R G D C G N L I R E K I C ----:----|----:----|----:----|----:----|----:----|----:----| L D R S S R G S P P I T P V E D T L L D Y T E P H G E L R P S Q P F R M R S F I L R Q I V K W V P P N H S G * G H S S R DdeI EspI* | MboII | |AluI | |CviJI BspCNI ApoI | || SetI |BseMII TspEI MnlI Hpy188I \ \\ \ \\ \ \ \ GCTCAGCTAAAAAGAAAATACCCACATTTGAAATTTGAAAGTGTCAGAGGAAATATACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTCGATTTTTCTTTTATGGGTGTAAACTTTAAACTTTCACAGTCTCCTTTATATGTT /// // / / / ||CviJI |BseMII | MnlI Hpy188I ||AluI BspCNI TspEI |EspI* ApoI |DdeI MboII SetI A Q L K R K Y P H L K F E S V R G N I Q L S * K E N T H I * N L K V S E E I Y K S A K K K I P T F E I * K C Q R K Y T N ----:----|----:----|----:----|----:----|----:----|----:----| A * S F L F Y G C K F N S L T L P F I C Q E A L F F I G V N S I Q F H * L F Y V S L * F S F V W M Q F K F T D S S I Y L HgaI CviRI* |Hin4I |Hin4I ||EcoT22I Hin4I EcoP15I ||| SfaNI Hin4I | Csp6I ||| | AcyI MaeI | MaeI TspGWI | |RsaI ||| | | SfaNI \ \ \ \ \ \\ \\\ \ \ \ ACTAGATTACAAAAACTAGACGACCCAAAATCTCCGTACCAATGCATCATCTTGGCGTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTAATGTTTTTGATCTGCTGGGTTTTAGAGGCATGGTTACGTAGTAGAACCGCAGA / / / / / // / / / / / / | Hin4I | TspGWI | || | | | HgaI | MmeI | Hin4I MaeI | || | | CviRI* SfaNI MaeI | || | EcoT22I AcyI | || Hin4I | || Hin4I | |Csp6I | RsaI EcoP15I T R L Q K L D D P K S P Y Q C I I L A S L D Y K N * T T Q N L R T N A S S W R L * I T K T R R P K I S V P M H H L G V C ----:----|----:----|----:----|----:----|----:----|----:----| V L N C F S S S G F D G Y W H M M K A D F * I V F V L R G L I E T G I C * R P T S S * L F * V V W F R R V L A D D Q R R TseI |BisI ||BlsI ||| TfiI ||| HinfI ||| | BciVI BseYI ||| | | BbvI |MmeI ||| | | | MmeI || GsaI TspEI ||| | | | Hpy188I \\ \ \ \\\ \ \ \ \ GCTGGGTTGATGCGTATGGGGTTGGAAAACAGAATTACGCAGCGATTCCATTCGGATACA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCCAACTACGCATACCCCAACCTTTTGTCTTAATGCGTCGCTAAGGTAAGCCTATGT / / / / /// / // / | | BseYI | ||TseI | || BbvI | SfaNI | |BisI | |Hpy188I GsaI | BlsI | MmeI TspEI HinfI BciVI TfiI A G L M R M G L E N R I T Q R F H S D T L G * C V W G W K T E L R S D S I R I Q W V D A Y G V G K Q N Y A A I P F G Y N ----:----|----:----|----:----|----:----|----:----|----:----| A P N I R I P N S F L I V C R N W E S V Q Q T S A Y P T P F C F * A A I G N P Y S P Q H T H P Q F V S N R L S E M R I C KasI HgiCI* |AcyI |NarI |Hin6I ||GlaI ||DinI ||NlaIV |||HhaI ||||BssKI Csp6I ||||SecI* |RsaI ||||HaeII || FatI ||||EcoRII || |CviAII |||||PasI || || CviRI* |||||SecI* || || NlaIII ||||||ScrFI MaeIII || || | BstXI ||||||BseBI TspEI Tsp45I MslI \\ \\ \ \ \\\\\\\ \ \ \ ATGTACCATGCAGTTGGACAAGGCGCCCTGGGTATAGAAATTAGAAAGGGTGACACCAAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TACATGGTACGTCAACCTGTTCCGCGGGACCCATATCTTTAATCTTTCCCACTGTGGTTC /// // ///// /// / / / / ||| |CviRI* ||||| ||EcoRII TspEI | | HphI ||| |FatI ||||| ||BssKI | MslI ||| CviAII ||||| ||SecI* Tsp45I ||| BstXI ||||| |SecI* MaeIII ||NlaIII ||||| |PasI |Csp6I ||||| BseBI RsaI ||||| ScrFI ||||HgiCI* ||||KasI |||Hin6I |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII M Y H A V G Q G A L G I E I R K G D T K C T M Q L D K A P W V * K L E R V T P R V P C S W T R R P G Y R N * K G * H Q D ----:----|----:----|----:----|----:----|----:----|----:----| I Y W A T P C P A R P I S I L F P S V L L T G H L Q V L R G P Y L F * F P H C W H V M C N S L A G Q T Y F N S L T V G L TfiI HinfI | Hpy178III* | | BcgI | | | MboII | | | |TspDTI MboI | | | ||ApoI | DpnI HphI | | | ||TspEI | |BstKTI CviRI* BcgI Hpy188I \ \ \ \ \\\ \ \\ \ \ \ ATGATGAAGATTCTTGACGAAATTTGCGATCTAAATGCAACTATATGTTGCCTTTCGGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTTCTAAGAACTGCTTTAAACGCTAGATTTACGTTGATATACAACGGAAAGCCTC / // / / // / / / / | || TspDTI | || MboI CviRI* BcgI Hpy188I | || MboII | |DpnI | || | BstKTI | || TspEI | || ApoI | |Hpy178III* | BcgI HinfI TfiI M M K I L D E I C D L N A T I C C L S E * * R F L T K F A I * M Q L Y V A F R S D E D S * R N L R S K C N Y M L P F G A ----:----|----:----|----:----|----:----|----:----|----:----| I I F I R S S I Q S R F A V I H Q R E S S S S S E Q R F K R D L H L * I N G K P H H L N K V F N A I * I C S Y T A K R L TfiI Cac8I MnlI TspGWI HinfI \ \ \ \ CGTGCTTTGATGAGAACTTTAGAGGGGGGTTGTTCCGTTCCTATTGGTGTGGAATCTAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGAAACTACTCTTGAAATCTCCCCCCAACAAGGCAAGGATAACCACACCTTAGATTT / / / / Cac8I MnlI TspGWI HinfI TfiI R A L M R T L E G G C S V P I G V E S K V L * * E L * R G V V P F L L V W N L N C F D E N F R G G L F R S Y W C G I * I ----:----|----:----|----:----|----:----|----:----|----:----| R A K I L V K S P P Q E T G I P T S D L A H K S S F K L P P N N R E * Q H P I * T S Q H S S * L P T T G N R N T H F R F HindII Hpy166II |Hin4II* TspEI ||MaeII Ksp632I* MboII CviJI ||| SetI | BsmAI |TspDTI MseI HaeIII ||| TaiI \ \ \\ \ \ \\\ \ TACAATGAAGAGACTAAAAAATTACTATTAAAGGCCATTGTAGTTGACGTTGAAGGCACA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTACTTCTCTGATTTTTTAATGATAATTTCCGGTAACATCAACTGCAACTTCCGTGT / / / / / / // / | BsmAI | TspEI | HaeIII || MaeII Ksp632I* TspDTI | CviJI |TaiI MboII MseI |SetI Hpy166II Hin4II* HindII Y N E E T K K L L L K A I V V D V E G T T M K R L K N Y Y * R P L * L T L K A Q Q * R D * K I T I K G H C S * R * R H R ----:----|----:----|----:----|----:----|----:----|----:----| Y L S S V L F N S N F A M T T S T S P V I C H L S * F I V I L P W Q L Q R Q L C V I F L S F F * * * L G N Y N V N F A C TfiI HinfI | FatI | NcoI | StyI | SecI* | DsaI* TspEI | |CviAII BbvII* | || NlaIII | MboII MseI | || |MboII \ \ \ \ \\ \\ GAAGCAGTAGAAGACGAAATTGAAATGCTAATAGAAAATGTTAAAGAAGATTCCATGGCG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTCATCTTCTGCTTTAACTTTACGATTATCTTTTACAATTTCTTCTAAGGTACCGC / / // // BbvII* MseI || |MboII MboII || |DsaI* TspEI || |SecI* || |StyI || |NcoI || |FatI || CviAII |NlaIII HinfI TfiI E A V E D E I E M L I E N V K E D S M A K Q * K T K L K C * * K M L K K I P W R S S R R R N * N A N R K C * R R F H G V ----:----|----:----|----:----|----:----|----:----|----:----| S A T S S S I S I S I S F T L S S E M A L L L L L R F Q F A L L F H * L L N W P F C Y F V F N F H * Y F I N F F I G H R ApoI MaeI MwoI TspEI | AluI |Hin6I | Hpy178III* | CviJI ||GlaI | | TspEI | | SetI BccI |||HhaI | | |BseGI \ \ \ \ \\\\ \ \ \\ TGTGGTAAGATACTAGCTGAAAGAATGATTGCCGATGGCGCAAAGAAAATTCTGGATGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATTCTATGATCGACTTTCTTACTAACGGCTACCGCGTTTCTTTTAAGACCTACTT /// / / /// / / / ||CviJI BccI | ||Hin6I | | BseGI ||AluI | |GlaI | Hpy178III* |MaeI | HhaI TspEI SetI MwoI ApoI C G K I L A E R M I A D G A K K I L D E V V R Y * L K E * L P M A Q R K F W M K W * D T S * K N D C R W R K E N S G * N ----:----|----:----|----:----|----:----|----:----|----:----| H P L I S A S L I I A S P A F F I R S S T H Y S V L Q F F S Q R H R L S F E P H T T L Y * S F S H N G I A C L F N Q I F MseI VspI |TspEI || FokI || | TspDTI || | | TfiI || | | HinfI \\ \ \ \ ATTAATTTAGACAGAATCAAATGA 970 980 ----:----|----:----|---- TAATTAAATCTGTCTTAGTTTACT // / / / / || | | FokI HinfI || | TspDTI TfiI || TspEI |VspI |MseI TspEI I N L D R I K * L I * T E S N X * F R Q N Q M X ----:----|----:----|---- I L K S L I L H F * N L C F * I N I * V S D F S # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 5 AluBI ApaI 1 ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 2 BcgI 1 BciVI 2 BfuI BdaI 2 BetI* 1 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BseYI 2 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 1 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BstXI 1 Cac8I 1 BstC8I Csp6I 3 CviQI,RsaNI CviAII 6 CviJI 7 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 6 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 3 FatI 6 FauI 1 SmuI FokI 3 GlaI 2 GsaI 2 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 6 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 KasI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MmeI 5 MnlI 5 MseI 4 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PasI 1 PsiI 1 AanI RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 10 SfaNI 2 LweI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 4 TatI 1 TfiI 6 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 3 VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BclI BfiI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BsgI BsiI* BslFI BsmFI BsmI Bsp1407I BspHI BspLU11I* BspMI BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV Esp3I FaqI FnuDII* FseI FspAI GsuI HgiAI* HpaI Hpy99I KpnI MauBI McrI* MfeI MluI MlyI MroNI MstI* NaeI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI TsoI Tsp4CI* TspMI TspRI TstI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769