Restriction Map of NUS1/YDL193W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

NUS1/YDL193W on chromosome IV from coordinates 114672 to 115799.


FokI | NlaIV MboI | BsrDI BclI | |CviJI | DpnI | || SduI | |BstKTI BseGI | || HgiJII* AciI \ \\ \ \ \\ \ \ ATGCCCACGATGATCAAAAAGGATGATAAAGCAATGGAGCCCCCTAATGAAAAACCGCAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGGTGCTACTAGTTTTTCCTACTATTTCGTTACCTCGGGGGATTACTTTTTGGCGTA // / / //// / / || BclI BseGI |||CviJI | TspDTI || MboI ||NlaIV | PpiI |DpnI ||FokI AciI BstKTI |HgiJII* |SduI BsrDI M P T M I K K D D K A M E P P N E K P H C P R * S K R M I K Q W S P L M K N R I A H D D Q K G * * S N G A P * * K T A * ----:----|----:----|----:----|----:----|----:----|----:----| X G V I I L F S S L A I S G G L S F G C X A W S S * F P H Y L L P A G * H F V A H G R H D F L I I F C H L G R I F F R M SetI |Hpy178III* TspDTI MboII || TfiI | PpiI | Hpy178III* || HinfI | MboI | | GsuI || | AlwNI | | DpnI | | FokI Eco57MI || | PflMI | | |TaqI | | TfiI | PpiI || | BsiYI* | | |BstKTI | | HinfI | | BseGI || | |MnlI \ \ \\ \ \ \ \ \ \ \\ \ \\ AGAAAGATCGAAAGAGATGATGTTCCAGAATCTTCCAATCACATCCCACCTCCAGAATCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCTAGCTTTCTCTACTACAAGGTCTTAGAAGGTTAGTGTAGGGTGGAGGTCTTAGA // // / / /// / / // / || |TaqI | | ||| BseGI SetI || HinfI || MboI | | ||Eco57MI || MnlI |DpnI | | ||GsuI || TfiI BstKTI | | |PpiI |BsiYI* | | |FokI |PflMI | | HinfI |AlwNI | | TfiI Hpy178III* | Hpy178III* MboII R K I E R D D V P E S S N H I P P P E S E R S K E M M F Q N L P I T S H L Q N L K D R K R * C S R I F Q S H P T S R I W ----:----|----:----|----:----|----:----|----:----|----:----| L F I S L S S T G S D E L * M G G G S D Y F S R F L H H E L I K W D C G V E L I S L D F S I I N W F R G I V D W R W F R AluI CviJI | SetI | |MseI | ||AhaIII* | ||| MwoI MseI | ||| | CviJI |AhaIII* MseI | ||| | HaeIII || AciI |TspEI BceAI | ||| | | MaeIII \\ \ \\ \ \ \\\ \ \ \ GGTGTTTTAAAGGGCGGTAAAGTTAATTCAAAAACCAGAGCTTTAAAGGCCGTTACAAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAAAATTTCCCGCCATTTCAATTAAGTTTTTGGTCTCGAAATTTCCGGCAATGTTCA // / / / / / / /// / / / |MseI AciI | TspEI | | | ||| HaeIII | BsrDI AhaIII* MseI | | | ||| CviJI MaeIII | | | ||MseI | | | |AhaIII* | | | MwoI | | CviJI | | AluI | SetI BceAI G V L K G G K V N S K T R A L K A V T S V F * R A V K L I Q K P E L * R P L Q V C F K G R * S * F K N Q S F K G R Y K Y ----:----|----:----|----:----|----:----|----:----|----:----| P T K F P P L T L E F V L A K F A T V L Q H K L P R Y L * N L F W L K L P R * L T N * L A T F N I * F G S S * L G N C T DdeI | Hpy188I | | MnlI | | | BspCNI | | | Hpy166II | | | |Esp3I BsrDI | | | |BsmAI | BdaI | | | |BseMII | BdaI | | | ||BdaI | CviRI* | | | ||BdaI | | AcyI HgaI | | | |||MboII HinfI \ \ \ \ \ \ \ \\\\ \ ATCATTGCAGACGCCGATGAGAACCCTCAGAAGAAAGTGAACAATGAGACGAATGGAGTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAACGTCTGCGGCTACTCTTGGGAGTCTTCTTTCACTTGTTACTCTGCTTACCTCAG / / / / // / /// / / / | | AcyI | |DdeI | ||| | BsmAI HinfI | CviRI* | | | ||| | Esp3I BdaI | | | ||| MboII BdaI | | | ||Hpy166II | | | ||BdaI | | | ||BdaI | | | |BseMII | | | BspCNI | | MnlI | Hpy188I HgaI I I A D A D E N P Q K K V N N E T N G V S L Q T P M R T L R R K * T M R R M E S H C R R R * E P S E E S E Q * D E W S P ----:----|----:----|----:----|----:----|----:----|----:----| I M A S A S S F G * F F T F L S V F P T Y * Q L R R H S G E S S L S C H S S H L D N C V G I L V R L L F H V I L R I S D SetI PleI |ApoI |MlyI MboII |TspEI SetI \\ \ \\ \ CAAAAGCAAAAGACAGAAGATTTGAGTAAAAGAATAGGTAAATTTGAATACCTTTTTTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCGTTTTCTGTCTTCTAAACTCATTTTCTTATCCATTTAAACTTATGGAAAAAATG / / / / / PleI MboII SetI | SetI MlyI TspEI ApoI Q K Q K T E D L S K R I G K F E Y L F Y K S K R Q K I * V K E * V N L N T F F T K A K D R R F E * K N R * I * I P F L Q ----:----|----:----|----:----|----:----|----:----|----:----| W F C F V S S K L L L I P L N S Y R K * G F A F S L L N S Y F F L Y I Q I G K K L L L L C F I Q T F S Y T F K F V K K V Csp6I |RsaI || Tsp4CI* \\ \ AAGTTTTTACTTGTGTTGTTATACATCTGCTTCGGGTTGTTTCGGTACGGTCAATACCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAAAATGAACACAACAATATGTAGACGAAGCCCAACAAAGCCATGCCAGTTATGGTT /// ||Tsp4CI* |Csp6I RsaI K F L L V L L Y I C F G L F R Y G Q Y Q S F Y L C C Y T S A S G C F G T V N T N V F T C V V I H L L R V V S V R S I P I ----:----|----:----|----:----|----:----|----:----|----:----| L N K S T N N Y M Q K P N N R Y P * Y W C T K V Q T T I C R S R T T E T R D I G L K * K H Q * V D A E P Q K P V T L V L FatI |CviAII || CviRI* SspI || NlaIII DdeI | TspDTI || | EcoT22I Tsp4CI* \ \ \ \\ \ \ \ TATAATAAAATGAAACTAAGAATATTCAGTATCATCTACAACCATGCATATACACCACAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTATTTTACTTTGATTCTTATAAGTCATAGTAGATGTTGGTACGTATATGTGGTGTC / / / /// / | TspDTI | ||CviRI* Tsp4CI* | SspI | ||FatI DdeI | |CviAII | EcoT22I NlaIII Y N K M K L R I F S I I Y N H A Y T P Q I I K * N * E Y S V S S T T M H I H H S * * N E T K N I Q Y H L Q P C I Y T T V ----:----|----:----|----:----|----:----|----:----|----:----| Y L L I F S L I N L I M * L W A Y V G C I Y Y F S V L F I * Y * R C G H M Y V V I I F H F * S Y E T D D V V M C I C W L SetI |CfrI || CviJI || HaeIII Hpy188I || |AciI MaeII | ApoI || |BisI | SetI | MnlI || ||BlsI | TaiI | TspEI || |||TauI \ \ \ \ \\ \\\\ TTGATTAGACAGGACGTTATTCCTCTGAAAAAAATTCCTAAAAGGTTGGCCGCTATCTTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAATCTGTCCTGCAATAAGGAGACTTTTTTTAAGGATTTTCCAACCGGCGATAGAAC / / / / / / //// | MaeII | MnlI TspEI SetI |||AciI TaiI Hpy188I ApoI ||CfrI SetI ||BisI |BlsI HaeIII CviJI TauI L I R Q D V I P L K K I P K R L A A I L * L D R T L F L * K K F L K G W P L S W D * T G R Y S S E K N S * K V G R Y L G ----:----|----:----|----:----|----:----|----:----|----:----| N I L C S T I G R F F I G L L N A A I K T S * V P R * E E S F F E * F T P R * R Q N S L V N N R Q F F N R F P Q G S D Q MaeII | Hpy99I | |SetI | |TaiI | |MwoI | || AciI | || |BisI | || ||BlsI | || |||AciI | || |||TauI CviJI | || |||| MaeIII SetI |BsrI | || |||| Tsp45I | MseI FnuDII* \\ \ \\ \\\\ \ \ \ \ GAAGTCAAGCCAGTTGGCGACGTTGGCGGCGGTGTGACAGGTTTATTAAATGACGCGAGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAGTTCGGTCAACCGCTGCAACCGCCGCCACACTGTCCAAATAATTTACTGCGCTCA // / // / /// / / / / |CviJI | || | ||| AciI Tsp45I MseI FnuDII* BsrI | || | ||BisI MaeIII | || | ||AciI SetI | || | |BlsI | || | TauI | || MaeII | |MwoI | TaiI | SetI Hpy99I E V K P V G D V G G G V T G L L N D A S K S S Q L A T L A A V * Q V Y * M T R V S Q A S W R R W R R C D R F I K * R E * ----:----|----:----|----:----|----:----|----:----|----:----| S T L G T P S T P P P T V P K N F S A L P L * A L Q R R Q R R H S L N I L H R S F D L W N A V N A A T H C T * * I V R T Tsp4CI* | AluI | CviJI | PvuII Csp6I HgaI | NspBII* |RsaI |TspEI | | SetI || BccI \\ \ \ \ \\ \ GAAATTGTTTGCTGGACTGTTTCAGCTGGTATAAAACATTTGATGTTGTACGATTACGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAACAAACGACCTGACAAAGTCGACCATATTTTGTAAACTACAACATGCTAATGCTA / / / / // / TspEI | | NspBII* || BccI HgaI | | PvuII |Csp6I | | CviJI RsaI | | AluI | SetI Tsp4CI* E I V C W T V S A G I K H L M L Y D Y D K L F A G L F Q L V * N I * C C T I T M N C L L D C F S W Y K T F D V V R L R W ----:----|----:----|----:----|----:----|----:----|----:----| S I T Q Q V T E A P I F C K I N Y S * S H F Q K S S Q K L Q Y L V N S T T R N R F N N A P S N * S T Y F M Q H Q V I V I BseMII |BspCNI || Hpy178III* BssKI || | AluI EcoRII || | CviJI | ScrFI || | |DdeI ApoI | BseBI || | ||SetI TspEI | |SetI SspI || | ||| TspDTI | TsoI | || CviJI \ \\ \ \\\ \ \ \ \ \\ \ GGAATATTACAAAGAAATGTTCCAGAGCTGAGAATGGAAATTCATTCCAACCTGGCTAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTATAATGTTTCTTTACAAGGTCTCGACTCTTACCTTTAAGTAAGGTTGGACCGATTT / // // / / / // / / / SspI || || | | DdeI |TspEI | | EcoRII || || | TspDTI |ApoI | | BssKI || || CviJI TsoI | | CviJI || || AluI | BseBI || |SetI | ScrFI || Hpy178III* SetI |BspCNI BseMII G I L Q R N V P E L R M E I H S N L A K E Y Y K E M F Q S * E W K F I P T W L N N I T K K C S R A E N G N S F Q P G * I ----:----|----:----|----:----|----:----|----:----|----:----| P I N C L F T G S S L I S I * E L R A L H F I V F F H E L A S F P F E N W G P * S Y * L S I N W L Q S H F N M G V Q S F AsuI* |BmgT120I ||CviJI ||HaeIII ||| MmeI ||| Cac8I ||| | AluI ||| | CviJI ||| | | FatI ||| | | SetI ||| | | |CviAII SspI ||| | | || NlaIII MseI SetI MnlI \ \\\ \ \ \\ \ \ \ \ TATTTTGGGCCAGCTCATGTTCCAAACTACGCTGTTAAAATACCTCATTCTAACAAGATA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAACCCGGTCGAGTACAAGGTTTGATGCGACAATTTTATGGAGTAAGATTGTTCTAT / /// / / // / / / SspI ||| | | |FatI | SetI MnlI ||| | | CviAII MseI ||| | NlaIII ||| CviJI ||| AluI ||Cac8I ||SetI |AsuI* BmgT120I HaeIII CviJI MmeI Y F G P A H V P N Y A V K I P H S N K I I L G Q L M F Q T T L L K Y L I L T R Y F W A S S C S K L R C * N T S F * Q D I ----:----|----:----|----:----|----:----|----:----|----:----| Y K P G A * T G F * A T L I G * E L L I I N Q A L E H E L S R Q * F V E N * C S I K P W S M N W V V S N F Y R M R V L Y XbaI |MaeI |Hpy178III* AluI || TspEI CviJI || | BsmAI TspGWI BsrDI | SetI \\ \ \ \ \ \ \ TTCTACAATCTAGACGGAATTGAAACCGAGACTGATGTAGGCAATGAGATAGAAGCTAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATGTTAGATCTGCCTTAACTTTGGCTCTGACTACATCCGTTACTCTATCTTCGATTG // / // / / / |XbaI | |TspGWI BsrDI | CviJI | | BsmAI | AluI | TspEI SetI Hpy178III* MaeI F Y N L D G I E T E T D V G N E I E A N S T I * T E L K P R L M * A M R * K L T L Q S R R N * N R D * C R Q * D R S * P ----:----|----:----|----:----|----:----|----:----|----:----| N * L R S P I S V S V S T P L S I S A L I R C D L R F Q F R S Q H L C H S L L * E V I * V S N F G L S I Y A I L Y F S V TsoI ApoI Hin4I BsiYI* |TspEI TspEI BccI Hin4I \ \\ \ \ \ CAAGAAAAGGACAAAATTGCTATTGAAATTTCTTTATTGTCTAACAGAGATGGTAGAGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTTTCCTGTTTTAACGATAACTTTAAAGAAATAACAGATTGTCTCTACCATCTCTT / / / / / / BsiYI* TsoI TspEI TspEI BccI Hin4I ApoI Hin4I Q E K D K I A I E I S L L S N R D G R E K K R T K L L L K F L Y C L T E M V E K R K G Q N C Y * N F F I V * Q R W * R N ----:----|----:----|----:----|----:----|----:----|----:----| W S F S L I A I S I E K N D L L S P L S G L F P C F Q * Q F K K I T * C L H Y L L F L V F N S N F N R * Q R V S I T S F TaqI |MboI || DpnI || |BstKTI || || Hpy188I || || | BseMII || || | |BspCNI AciI || || | || BstXI | MseI || || | || | Hin4I | |HpaI || || | || | Hin4I | |HindII || || | || | | CviJI | |Hpy166II || || | || | | |DdeI | || TspEI \\ \\ \ \\ \ \ \\ \ \\ \ ACGATTGTCGATCTGACCAAAACTATGGCTGAGTTATGTGCGGTTAACGAATTGAGCGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTAACAGCTAGACTGGTTTTGATACCGACTCAATACACGCCAATTGCTTAACTCGCAA // / //// / / / // / || | |||Hin4I | DdeI | |MseI TspEI || | |||Hin4I CviJI | Hpy166II || | ||BstXI | HindII || | |BspCNI | HpaI || | BseMII AciI || Hpy188I || MboI |DpnI BstKTI TaqI T I V D L T K T M A E L C A V N E L S V R L S I * P K L W L S Y V R L T N * A F D C R S D Q N Y G * V M C G * R I E R F ----:----|----:----|----:----|----:----|----:----|----:----| V I T S R V L V I A S N H A T L S N L T F S Q R D S W F * P Q T I H P * R I S R R N D I Q G F S H S L * T R N V F Q A N SpeI |MaeI || PsrI TfiI || | AsuI* HinfI || | AvaII Hpy188I | MmeI || | |BmgT120I | MslI | | Hpy188I || | ||NlaIV \ \ \ \ \ \\ \ \\\ TCTGACATCACAATGGATTTAGTTGATTCAGAACTGAAACAACTAGTTGGACCCGAACCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTGTAGTGTTACCTAAATCAACTAAGTCTTGACTTTGTTGATCAACCTGGGCTTGGT / / / // / // // Hpy188I MslI | |Hpy188I | |SpeI |AvaII | HinfI | MaeI |AsuI* | TfiI PsrI BmgT120I MmeI NlaIV S D I T M D L V D S E L K Q L V G P E P L T S Q W I * L I Q N * N N * L D P N Q * H H N G F S * F R T E T T S W T R T R ----:----|----:----|----:----|----:----|----:----|----:----| E S M V I S K T S E S S F C S T P G S G K Q C * L P N L Q N L V S V V L Q V R V R V D C H I * N I * F Q F L * N S G F W PsrI AsuI* |BmgT120I StyI MmeI ||CviJI SecI* Tsp4CI* ||HaeIII Hin4II* NlaIV | SetI \ \\\ \ \ \ \ GATTTACTGTTATACTTCGGGCCTTCGTTGGATTTACAAGGGTTCCCACCTTGGCATATT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATGACAATATGAAGCCCGGAAGCAACCTAAATGTTCCCAAGGGTGGAACCGTATAA // / // / / / / || PsrI |AsuI* Hin4II* | SetI SecI* |Tsp4CI* BmgT120I NlaIV StyI MmeI HaeIII CviJI D L L L Y F G P S L D L Q G F P P W H I I Y C Y T S G L R W I Y K G S H L G I L F T V I L R A F V G F T R V P T L A Y * ----:----|----:----|----:----|----:----|----:----|----:----| S K S N Y K P G E N S K C P N G G Q C I L N V T I S R A K T P N V L T G V K A Y I * Q * V E P R R Q I * L P E W R P M N BseGI | AciI ApoI FokI | SecI* MseI TspEI | TspDTI | DsaI* \ \ \ \ \ \ AGATTAACCGAATTTTATTGGGAAAAAGATAACAACGAAGTCATATATTCGGTTTTCATC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAATTGGCTTAAAATAACCCTTTTTCTATTGTTGCTTCAGTATATAAGCCAAAAGTAG / / / / / MseI TspEI | FokI BseGI ApoI TspDTI R L T E F Y W E K D N N E V I Y S V F I D * P N F I G K K I T T K S Y I R F S S I N R I L L G K R * Q R S H I F G F H P ----:----|----:----|----:----|----:----|----:----|----:----| L N V S N * Q S F S L L S T M Y E T K M * I L R I K N P F L Y C R L * I N P K * S * G F K I P F F I V V F D Y I R N E D AciI FnuDII* NspBII* |BisI |SacII ||BlsI |||TauI TstI |||CviJI Tsp4CI* |||HaeIII |Csp6I |||| DdeI ||RsaI BseGI FokI TstI \\\\ \ \\\ \ \ \ CGCGGCCTAAGACAGTACGCAGGATGTAAAGTGAATGTTGGTAAATGA 1090 1100 1110 1120 ----:----|----:----|----:----|----:----|----:--- GCGCCGGATTCTGTCATGCGTCCTACATTTCACTTACAACCATTTACT ///// // / // / / / ||||| || | |Csp6I BseGI | TstI ||||| || | RsaI FokI ||||| || Tsp4CI* ||||| |DdeI ||||| TstI ||||HaeIII ||||CviJI |||DsaI* |||SecI* |||BisI |||AciI ||BlsI |NspBII* |FnuDII* |AciI |TauI SacII R G L R Q Y A G C K V N V G K * A A * D S T Q D V K * M L V N X R P K T V R R M * S E C W * M X ----:----|----:----|----:----|----:----|----:--- R P R L C Y A P H L T F T P L H G R G L V T R L I Y L S H Q Y I A A * S L V C S T F H I N T F S # Enzymes that cut Frequency Isoschizomers AciI 8 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AluI 5 AluBI AlwNI 1 CaiI ApoI 5 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BccI 2 BceAI 1 BclI 1 FbaI,Ksp22I BdaI 2 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BspCNI 3 BsrDI 3 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 3 BstXI 1 Cac8I 1 BstC8I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 14 CviKI-1 CviRI* 2 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 3 MalI DsaI* 1 BtgI,BstDSI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 2 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GsuI 1 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 2 Hin4II* 1 HpyAV HindII 1 HincII HinfI 4 HpaI 1 KspAI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 5 Hpy99I 1 MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MlyI 1 SchI MmeI 3 MnlI 4 MseI 7 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PpiI 1 PsrI 1 PvuII 1 RsaI 3 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 15 SpeI 1 BcuI,AhlI SspI 3 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TauI 3 TfiI 3 PfeI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 XbaI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BcgI BciVI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI EspI* FalI FaqI FauI FseI FspAI GlaI GsaI HaeII HgiAI* HgiCI* HhaI Hin6I HindIII HinP1I HpaII HphI HspAI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI RsrII SacI SalI SanDI SapI SauI* ScaI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TatI TseI TspMI TspRI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769