Restriction Map of VMA1/YDL185W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

VMA1/YDL185W on chromosome IV from coordinates 126787 to 130002.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2580

CviRI* FatI |MfeI TfiI |CviAII CviJI |TspEI HinfI ||BbvII* \ \\ \ \\\ ATGGCTGGTGCAATTGAAAACGCTCGTAAGGAAATAAAAAGAATCTCATTAGAAGACCAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACCACGTTAACTTTTGCGAGCATTCCTTTATTTTTCTTAGAGTAATCTTCTGGTA / / / / / / CviJI | TspEI HinfI | CviAII | MfeI TfiI NlaIII CviRI* M A G A I E N A R K E I K R I S L E D H W L V Q L K T L V R K * K E S H * K T M G W C N * K R S * G N K K N L I R R P C ----:----|----:----|----:----|----:----|----:----|----:----| X A P A I S F A R L S I F L I E N S S W X P Q H L Q F R E Y P F L F F R M L L G H S T C N F V S T L F Y F S D * * F V M BsmAI |AsuI* NlaIII |AvaII | TfiI ||BmgT120I | HinfI |||BetI* | MboII ||||HpaII | | Hpy188I ||||| McrI* | | | HgiCI* ||||| | AjuI | | | | NlaIV BccI ||||| | BsrDI \ \ \ \ \ \ \\\\\ \ \ GCTGAATCTGAATATGGTGCCATCTATTCTGTCTCTGGTCCGGTCGTCATTGCTGAAAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTAGACTTATACCACGGTAGATAAGACAGAGACCAGGCCAGCAGTAACGACTTTTA / / // / / / // // / | | |Hpy188I | HgiCI* BccI || || BsrDI | | HinfI NlaIV || |BetI* | | TfiI || HpaII | BbvII* || McrI* | MboII || AjuI FatI |BsmAI |AvaII |AsuI* BmgT120I A E S E Y G A I Y S V S G P V V I A E N L N L N M V P S I L S L V R S S L L K I * I * I W C H L F C L W S G R H C * K Y ----:----|----:----|----:----|----:----|----:----|----:----| A S D S Y P A M * E T E P G T T M A S F H Q I Q I H H W R N Q R Q D P R * Q Q F S F R F I T G D I R D R T R D D N S F I SetI | MaeIII FatI | Tsp45I |CviAII | | Hpy178III* || Csp6I | | | TaqII || NlaIII | | | | BssKI || |RsaI | | | | SexAI || |AjuI | | | | EcoRII || || XcmI | | | | | ScrFI || || |TspEI | | | | | BseBI || || || TaqII | | | | | |SetI \\ \\ \\ \ \ \ \ \ \ \\ ATGATTGGTTGTGCCATGTACGAATTGGTCAAGGTCGGTCACGATAACCTGGTGGGTGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAACCAACACGGTACATGCTTAACCAGTTCCAGCCAGTGCTATTGGACCACCCACTT / //// / / / // / / / | |||| | | SetI || | | EcoRII | |||| | TspEI || | | SexAI | |||| TaqII || | | BssKI | |||Csp6I || | BseBI | |||XcmI || | ScrFI | ||RsaI || SetI | |FatI |Hpy178III* | CviAII |Tsp45I NlaIII |MaeIII AjuI TaqII M I G C A M Y E L V K V G H D N L V G E * L V V P C T N W S R S V T I T W W V K D W L C H V R I G Q G R S R * P G G * S ----:----|----:----|----:----|----:----|----:----|----:----| I I P Q A M Y S N T L T P * S L R T P S Y S Q N H W T R I P * P R D R Y G P P H H N T T G H V F Q D L D T V I V Q H T F SfeI* | CviRI* | | PstI CviJI | | Cac8I FokI HaeIII | | |MboII MaeIII | HphI | | ||StuI HphI Tsp45I | |BseGI BccI | | ||CviJI |TspEI Tsp4CI* | || BcgI | Hpy166II | | ||HaeIII \\ \ \ \\ \ \ \ \ \ \\\ GTCATTAGAATTGACGGTGACAAGGCCACCATCCAAGTTTACGAAGAAACTGCAGGCCTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAATCTTAACTGCCACTGTTCCGGTGGTAGGTTCAAATGCTTCTTTGACGTCCGGAA / / / // / / / // / / / / HphI | | || | | BcgI |Hpy166II | | | HaeIII | | || | BseGI BccI | | | CviJI | | || | HphI | | | StuI | | || HaeIII | | MboII | | || CviJI | | SfeI* | | |Tsp45I | | Cac8I | | |MaeIII | CviRI* | | FokI PstI | Tsp4CI* TspEI V I R I D G D K A T I Q V Y E E T A G L S L E L T V T R P P S K F T K K L Q A L H * N * R * Q G H H P S L R R N C R P Y ----:----|----:----|----:----|----:----|----:----|----:----| T M L I S P S L A V M W T * S S V A P R L * * F Q R H C P W W G L K R L F Q L G D N S N V T V L G G D L N V F F S C A K AsuI* AvaII DraII PpuMI |NlaIV Tsp4CI* |BmgT120I | BcgI ||BssKI | McrI* ||EcoRII | | MaeIII ||| ScrFI | | Tsp45I SetI MnlI ||| BseBI | | BstEII HphI | CviJI | TspEI ||| |BccI \ \ \ \ \ \ \ \ \\\ \\ ACGGTCGGTGACCCTGTTTTGAGAACAGGTAAGCCTCTGTCGGTAGAATTGGGTCCTGGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCAGCCACTGGGACAAAACTCTTGTCCATTCGGAGACAGCCATCTTAACCCAGGACCA // / / / / / / /// /// |McrI* | HphI SetI CviJI MnlI | ||| ||EcoRII |BcgI BstEII | ||| ||BssKI Tsp4CI* Tsp45I | ||| |BccI MaeIII | ||| BseBI | ||| ScrFI | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | NlaIV TspEI T V G D P V L R T G K P L S V E L G P G R S V T L F * E Q V S L C R * N W V L V G R * P C F E N R * A S V G R I G S W S ----:----|----:----|----:----|----:----|----:----|----:----| V T P S G T K L V P L G R D T S N P G P * P R H G Q K S F L Y A E T P L I P D Q R D T V R N Q S C T L R Q R Y F Q T R T CviJI TfiI Hpy188I BccI SetI | MseI HinfI \ \ \ \ \ \ CTGATGGAAACCATTTACGATGGTATTCAAAGACCTTTGAAAGCCATTAAGGAAGAATCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GACTACCTTTGGTAAATGCTACCATAAGTTTCTGGAAACTTTCGGTAATTCCTTCTTAGC / / / / / / Hpy188I BccI SetI CviJI MseI HinfI TfiI L M E T I Y D G I Q R P L K A I K E E S * W K P F T M V F K D L * K P L R K N R D G N H L R W Y S K T F E S H * G R I A ----:----|----:----|----:----|----:----|----:----|----:----| R I S V M * S P I * L G K F A M L S S D D S P F W K R H Y E F V K S L W * P L I Q H F G N V I T N L S R Q F G N L F F R BsaBI | MnlI TaqI | | GsuI AluI ClaI | | Eco57MI CviJI MboII | | | SetI | SetI \ \ \ \ \ \ \ CAATCGATTTATATCCCAAGAGGTATTGACACTCCAGCTTTGGATAGGACTATCAAGTGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGCTAAATATAGGGTTCTCCATAACTGTGAGGTCGAAACCTATCCTGATAGTTCACC / / / / / / / / | | | | | SetI | CviJI | | | | Eco57MI | AluI | | | | GsuI SetI | | | MnlI | | BsaBI | ClaI | TaqI MboII Q S I Y I P R G I D T P A L D R T I K W N R F I S Q E V L T L Q L W I G L S S G I D L Y P K R Y * H S S F G * D Y Q V A ----:----|----:----|----:----|----:----|----:----|----:----| C D I * I G L P I S V G A K S L V I L H A I S K Y G L L Y Q C E L K P Y S * * T L R N I D W S T N V S W S Q I P S D L P PfoI BssKI |HpaII MboI HphI ||ScrFI | DpnI BetI* Tsp4CI* TspEI ||CauII* | |BstKTI |HpaII TspGWI | NlaIV \ \\\ \ \\ \\ \ \ \ CAATTTACTCCGGGAAAGTTTCAAGTCGGCGATCATATTTCCGGTGGTGATATTTACGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAATGAGGCCCTTTCAAAGTTCAGCCGCTAGTATAAAGGCCACCACTATAAATGCCA / / / // / // / / / TspEI | BssKI || MboI || TspGWI | NlaIV | PfoI |DpnI |BetI* Tsp4CI* CauII* BstKTI HpaII HphI HpaII ScrFI Q F T P G K F Q V G D H I S G G D I Y G N L L R E S F K S A I I F P V V I F T V I Y S G K V S S R R S Y F R W * Y L R F ----:----|----:----|----:----|----:----|----:----|----:----| C N V G P F N * T P S * I E P P S I * P A I * E P F T E L R R D Y K R H H Y K R L K S R S L K L D A I M N G T T I N V T Hin4I | MnlI | MboI ApoI | | DpnI TspEI TfiI | | |BstKTI EcoRI TspEI CviJI HinfI | | ||Hpy178III* \ \ \ \ \ \ \\\ TCCGTTTTTGAGAATTCGCTAATTTCAAGCCATAAGATTCTTTTGCCACCAAGATCAAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAAAAACTCTTAAGCGATTAAAGTTCGGTATTCTAAGAAAACGGTGGTTCTAGTTCT / / / / / / // / // EcoRI | CviJI HinfI Hin4I | || | |SetI TspEI TspEI TfiI | || | Hpy178III* ApoI | || MboI | |DpnI | BstKTI MnlI S V F E N S L I S S H K I L L P P R S R P F L R I R * F Q A I R F F C H Q D Q E R F * E F A N F K P * D S F A T K I K R ----:----|----:----|----:----|----:----|----:----|----:----| E T K S F E S I E L W L I R K G G L D L N R K Q S N A L K L G Y S E K A V L I L G N K L I R * N * A M L N K Q W W S * S Hin4I | AluI | CviJI | PvuII | NspBII* Csp6I | | TatI |RsaI | | |Csp6I |SetI | | ||RsaI || GsuI | | |||Hpy166II || Eco57MI | | SetI |||| HphI BseGI FokI MboII \\ \ \ \ \ \\\\ \ \ \ \ GGTACAATCACTTGGATTGCTCCAGCTGGTGAGTACACTTTGGATGAGAAGATTTTGGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTTAGTGAACCTAACGAGGTCGACCACTCATGTGAAACCTACTCTTCTAAAACCTT // / / / /// / / / |Csp6I Hin4I | NspBII* ||| HphI BseGI MboII Eco57MI | PvuII ||TatI FokI RsaI | CviJI |Hpy166II GsuI | AluI |Csp6I SetI RsaI G T I T W I A P A G E Y T L D E K I L E V Q S L G L L Q L V S T L W M R R F W K Y N H L D C S S W * V H F G * E D F G S ----:----|----:----|----:----|----:----|----:----|----:----| P V I V Q I A G A P S Y V K S S F I K S L Y L * K S Q E L Q H T C K P H S S K P T C D S P N S W S T L V S Q I L L N Q F BccI ApoI CviJI TspEI Hpy188I HaeIII EcoP15I \ \ \ \ GTTGAATTTGATGGCAAGAAGTCTGATTTCACTCTTTACCATACTTGGCCTGTTCGTGTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTAAACTACCGTTCTTCAGACTAAAGTGAGAAATGGTATGAACCGGACAAGCACAA / / / / / | TspEI Hpy188I HaeIII EcoP15I | ApoI CviJI BccI V E F D G K K S D F T L Y H T W P V R V L N L M A R S L I S L F T I L G L F V F * I * W Q E V * F H S L P Y L A C S C S ----:----|----:----|----:----|----:----|----:----|----:----| T S N S P L F D S K V R * W V Q G T R T L Q I Q H C S T Q N * E K G Y K A Q E H N F K I A L L R I E S K V M S P R N T N MseI |HpaI |HindII BsrI |Hpy166II | MaeIII || SetI | | AlwNI || | SfaNI \ \ \ \\ \ \ CCAAGACCAGTTACTGAAAAGTTATCTGCTGACTATCCTTTGTTAACAGGTCAAAGAGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTGGTCAATGACTTTTCAATAGACGACTGATAGGAAACAATTGTCCAGTTTCTCAA / / / // / / BsrI | MaeIII || SetI SfaNI AlwNI |MseI Hpy166II HindII HpaI P R P V T E K L S A D Y P L L T G Q R V Q D Q L L K S Y L L T I L C * Q V K E F K T S Y * K V I C * L S F V N R S K S F ----:----|----:----|----:----|----:----|----:----|----:----| G L G T V S F N D A S * G K N V P * L T E L V L * Q F T I Q Q S D K T L L D F L W S W N S F L * R S V I R Q * C T L S N SetI | Csp6I | |RsaI | || FatI | || AflIII | || BspLU11I* | || |CviAII | || || NspI | || || NlaIII | || || | BssKI | || || | EcoRII | || || | | ScrFI | || || | | BseBI BseGI FokI | || || | | | SetI \ \ \ \\ \\ \ \ \ \ TTGGATGCTTTGTTTCCTTGTGTTCAAGGTGGTACGACATGTATTCCAGGTGCTTTTGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTACGAAACAAAGGAACACAAGTTCCACCATGCTGTACATAAGGTCCACGAAAACCA / / / // / // // / BseGI FokI SetI || | || || EcoRII || | || || BssKI || | || |BseBI || | || |ScrFI || | || SetI || | |BspLU11I* || | |AflIII || | |FatI || | CviAII || NlaIII || NspI |Csp6I RsaI L D A L F P C V Q G G T T C I P G A F G W M L C F L V F K V V R H V F Q V L L V G C F V S L C S R W Y D M Y S R C F W L ----:----|----:----|----:----|----:----|----:----|----:----| K S A K N G Q T * P P V V H I G P A K P K P H K T E K H E L H Y S M Y E L H K Q Q I S Q K R T N L T T R C T N W T S K T TatI |Csp6I ||RsaI Hpy188I Tsp4CI* ||ScaI TspEI | AcyI HgaI \ \\\ \ \ \ \ TGTGGTAAGACCGTTATCTCTCAATCTTTGTCCAAGTACTCCAATTCTGACGCCATTATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATTCTGGCAATAGAGAGTTAGAAACAGGTTCATGAGGTTAAGACTGCGGTAATAG / /// // / Tsp4CI* ||TatI || AcyI |Csp6I |Hpy188I ScaI TspEI RsaI C G K T V I S Q S L S K Y S N S D A I I V V R P L S L N L C P S T P I L T P L S W * D R Y L S I F V Q V L Q F * R H Y L ----:----|----:----|----:----|----:----|----:----|----:----| Q P L V T I E * D K D L Y E L E S A M I N H Y S R * R E I K T W T S W N Q R W * T T L G N D R L R Q G L V G I R V G N D BaeI | StyI | SecI* | | Acc65I | | HgiCI* | | |Csp6I XcmI | | ||RsaI |MseI | | ||NlaIV || BccI BaeI FokI | | ||| KpnI || | AciI |BseGI EciI \ \ \\\ \ \\ \ \ \\ \ TATGTCGGGTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGATGGGTCTATTGAATGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATACAGCCCACGAAACGGTTCCCATGGTTACAAAATTACCGCCTACCCAGATAACTTACA / / // /// / / / / / / / HgaI BaeI || ||| | | | | BseGI EciI FokI || ||| | | | BaeI || ||| | | | AciI || ||| | | BccI || ||| | MseI || ||| XcmI || ||HgiCI* || ||Acc65I || |Csp6I || NlaIV || RsaI |KpnI SecI* StyI Y V G C F A K G T N V L M A D G S I E C M S G A L P R V P M F * W R M G L L N V C R V L C Q G Y Q C F N G G W V Y * M Y ----:----|----:----|----:----|----:----|----:----|----:----| * T P H K A L P V L T K I A S P D I S H R H R T S Q W P Y W H K L P P H T * Q I I D P A K G L T G I N * H R I P R N F T MnlI | BsiI* FatI | |SetI SetI | ||Hpy178III* |CviAII | ||| SetI || NlaIII | ||| MnlI MnlI SetI || |BccI | ||| TspEI \ \ \\ \\ \ \\\ \ ATTGAAAACATTGAGGTTGGTAATAAGGTCATGGGTAAAGATGGCAGACCTCGTGAGGTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTTGTAACTCCAACCATTATTCCAGTACCCATTTCTACCGTCTGGAGCACTCCAT / / / / // / / // / MnlI SetI | | || BccI SetI || MnlI | | |FatI MnlI |SetI | | CviAII Hpy178III* | NlaIII BsiI* SetI I E N I E V G N K V M G K D G R P R E V L K T L R L V I R S W V K M A D L V R * * K H * G W * * G H G * R W Q T S * G N ----:----|----:----|----:----|----:----|----:----|----:----| I S F M S T P L L T M P L S P L G R S T Y Q F C Q P Q Y Y P * P Y L H C V E H P N F V N L N T I L D H T F I A S R T L Y TatI MboII MseI Bsp1407I | TspEI |Csp6I Hpy99I | | MnlI Ksp632I* HgaI ||RsaI | CviRI* Bce83I* \ \ \ \ \ \\\ \ \ \ ATTAAATTGCCCAGAGGAAGAGAAACTATGTACAGCGTCGTGCAGAAAAGTCAGCACAGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTTAACGGGTCTCCTTCTCTTTGATACATGTCGCAGCACGTCTTTTCAGTCGTGTCT // / / / // /// / / // || | TspEI Ksp632I* || ||| Hpy99I CviRI* |HgiJII* || MnlI || ||Bsp1407I |BsgI |MseI || ||TatI |SduI TspEI || |Csp6I Bce83I* || RsaI |HgaI MboII I K L P R G R E T M Y S V V Q K S Q H R L N C P E E E K L C T A S C R K V S T E * I A Q R K R N Y V Q R R A E K S A Q S ----:----|----:----|----:----|----:----|----:----|----:----| I L N G L P L S V I Y L T T C F L * C L L * I A W L F L F * T C R R A S F D A C N F Q G S S S F S H V A D H L F T L V S BsgI CviJI | SduI | HgiJII* | | MlyI | | PleI | | |OliI | | |MslI | | || MaeIII | | || Tsp45I Hpy166II | | || | HinfI | MaeII | | || | | SmlI | AflIII | | || | | | PshAI | |BsaAI | | || | | | | Hpy178III* | || SetI | | || | | | | | Bce83I* TspEI SmlI | || TaiI \ \ \\ \ \ \ \ \ \ \ \ \ \\ \ GCCCACAAAAGTGACTCAAGTCGTGAAGTGCCAGAATTACTCAAGTTTACGTGTAATGCG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGTGTTTTCACTGAGTTCAGCACTTCACGGTCTTAATGAGTTCAAATGCACATTACGC / // /// / // / / // // / CviJI |MslI ||| | |Hpy178III* TspEI | || || AflIII |OliI ||| | Bce83I* | || |MaeII |PleI ||| SmlI | || BsaAI MlyI ||PshAI | |TaiI |HinfI | |SetI Tsp45I | Hpy166II MaeIII SmlI A H K S D S S R E V P E L L K F T C N A P T K V T Q V V K C Q N Y S S L R V M R P Q K * L K S * S A R I T Q V Y V * C D ----:----|----:----|----:----|----:----|----:----|----:----| A W L L S E L R S T G S N S L N V H L A L G C F H S L D H L A L I V * T * T Y H G V F T V * T T F H W F * E L K R T I R FatI |CviAII || NlaIII BceAI Csp6I || | PflMI | EciI MnlI BsmAI || | BsiYI* | | SetI |AciI |RsaI MseI \\ \ \ \ \ \ \\ \\ \ ACCCATGAGTTGGTTGTTAGAACACCTCGTAGTGTCCGCCGTTTGTCTCGTACCATTAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTACTCAACCAACAATCTTGTGGAGCATCACAGGCGGCAAACAGAGCATGGTAATTC / // / / / / // / / | |FatI | BceAI | AciI || | MseI | BsiYI* SetI MnlI || BsmAI | CviAII EciI |Csp6I | PflMI RsaI NlaIII T H E L V V R T P R S V R R L S R T I K P M S W L L E H L V V S A V C L V P L R P * V G C * N T S * C P P F V S Y H * G ----:----|----:----|----:----|----:----|----:----|----:----| V W S N T T L V G R L T R R K D R V M L S G H T P Q * F V E Y H G G N T E Y W * G M L Q N N S C R T T D A T Q R T G N L AsuI* |BmgT120I ||CviJI Hpy99I TaqI SspI BccI ||HaeIII CviJI Tsp4CI* \ \ \ \\\ \ \ GGTGTCGAATATTTTGAAGTTATTACTTTTGAGATGGGCCAAAAGAAAGCCCCCGACGGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAGCTTATAAAACTTCAATAATGAAAACTCTACCCGGTTTTCTTTCGGGGGCTGCCA / / / // / / / | SspI BccI |AsuI* | | Tsp4CI* TaqI BmgT120I | Hpy99I HaeIII CviJI CviJI G V E Y F E V I T F E M G Q K K A P D G V S N I L K L L L L R W A K R K P P T V C R I F * S Y Y F * D G P K E S P R R * ----:----|----:----|----:----|----:----|----:----|----:----| P T S Y K S T I V K S I P W F F A G S P P H R I N Q L * * K Q S P G F S L G R R T D F I K F N N S K L H A L L F G G V T DdeI BseMII |BspCNI |Hpy188I || AsuI* AluI || DraII CviJI || |NlaIV | SetI || |BmgT120I AluI | |BseMII || ||CviJI CviJI | ||BspCNI || ||HaeIII TspEI | SetI | ||| MnlI || ||| DdeI \ \ \ \ \\\ \ \\ \\\ \ AGAATTGTTGAGCTTGTCAAGGAAGTTTCAAAGAGCTACCCAATATCTGAGGGGCCTGAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAACAACTCGAACAGTTCCTTCAAAGTTTCTCGATGGGTTATAGACTCCCCGGACTC / / / / /// / /// / /// / | | CviJI | ||| | ||| | ||| DdeI | | AluI | ||| | ||| | ||DraII | SetI | ||| | ||| | ||AsuI* TspEI | ||| | ||| | |BmgT120I | ||| | ||| | |HaeIII | ||| | ||| | |CviJI | ||| | ||| | NlaIV | ||| | ||| DdeI | ||| | ||Hpy188I | ||| | |BspCNI | ||| | BseMII | ||| MnlI | ||BspCNI | |BseMII | CviJI | AluI SetI R I V E L V K E V S K S Y P I S E G P E E L L S L S R K F Q R A T Q Y L R G L R N C * A C Q G S F K E L P N I * G A * E ----:----|----:----|----:----|----:----|----:----|----:----| L I T S S T L S T E F L * G I D S P G S Y F Q Q A Q * P L K L S S G L I Q P A Q S N N L K D L F N * L A V W Y R L P R L HindIII TfiI | AluI HinfI XmnI | CviJI Hpy166II CviJI TspEI | SfeI* |CviJI | | SetI |MnlI \ \ \ \ \\ \ \ \ \\ AGAGCCAACGAATTAGTAGAATCCTATAGAAAGGCTTCAAATAAAGCTTATTTTGAGTGG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGGTTGCTTAATCATCTTAGGATATCTTTCCGAAGTTTATTTCGAATAAAACTCACC / / / / // / / / / CviJI TspEI HinfI | |CviJI | | HindIII Hpy166II TfiI | XmnI | CviJI MnlI SfeI* | AluI SetI R A N E L V E S Y R K A S N K A Y F E W E P T N * * N P I E R L Q I K L I L S G S Q R I S R I L * K G F K * S L F * V D ----:----|----:----|----:----|----:----|----:----|----:----| L A L S N T S D * L F A E F L A * K S H S L W R I L L I R Y F P K L Y L K N Q T S G V F * Y F G I S L S * I F S I K L P CviJI HaeIII AluI | MboI CviJI | BglII NlaIV | SetI | XhoII | FatI | BsaXI | | DpnI | |CviAII | Hin4I | | |BstKTI | || NlaIII | | SetI \ \ \\ \ \\ \ \ \ \ ACTATTGAGGCCAGAGATCTTTCTCTGTTGGGTTCCCATGTTCGTAAAGCTACCTACCAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACTCCGGTCTCTAGAAAGAGACAACCCAAGGGTACAAGCATTTCGATGGATGGTC / // / / / // //// / | || XhoII | | |FatI |||| SetI | || BglII | | CviAII |||CviJI | || MboI | NlaIII |||AluI | |DpnI NlaIV ||BsaXI | BstKTI |SetI HaeIII Hin4I CviJI T I E A R D L S L L G S H V R K A T Y Q L L R P E I F L C W V P M F V K L P T R Y * G Q R S F S V G F P C S * S Y L P D ----:----|----:----|----:----|----:----|----:----|----:----| V I S A L S R E R N P E W T R L A V * W S * Q P W L D K E T P N G H E Y L * R G S N L G S I K R Q Q T G M N T F S G V L FatI |CviAII || NspI || CviRI* BsaXI || NlaIII TspEI | Hin4I TaqI || | TspDTI HphI \ \ \ \ \\ \ \ \ ACTTACGCTCCAATTCTTTATGAGAATGACCACTTTTTCGACTACATGCAAAAAAGTAAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATGCGAGGTTAAGAAATACTCTTACTGGTGAAAAAGCTGATGTACGTTTTTTCATTC / / / / // / / | Hin4I | | || TspDTI HphI | BsaXI | | |CviRI* TspEI | | |FatI | | CviAII | NlaIII | NspI TaqI T Y A P I L Y E N D H F F D Y M Q K S K L T L Q F F M R M T T F S T T C K K V S L R S N S L * E * P L F R L H A K K * V ----:----|----:----|----:----|----:----|----:----|----:----| V * A G I R * S F S W K K S * M C F L L S K R E L E K H S H G S K R S C A F F Y S V S W N K I L I V V K E V V H L F T L AsuI* AvaII |BmgT120I || TatI || |Csp6I Hin4I || ||RsaI Hin4I Hin4II* ||SetI ||ScaI | BccI \ \\\ \\\ \ \ TTTCATCTCACCATTGAAGGTCCAAAAGTACTTGCTTATTTACTTGGTTTATGGATTGGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTAGAGTGGTAACTTCCAGGTTTTCATGAACGAATAAATGAACCAAATACCTAACCA / / // /// / / Hin4II* | |AvaII ||TatI Hin4I BccI | |AsuI* |Csp6I Hin4I | | ScaI | | RsaI | BmgT120I SetI F H L T I E G P K V L A Y L L G L W I G F I S P L K V Q K Y L L I Y L V Y G L V S S H H * R S K S T C L F T W F M D W * ----:----|----:----|----:----|----:----|----:----|----:----| N * R V M S P G F T S A * K S P K H I P T E D * W Q L D L L V Q K N V Q N I S Q K M E G N F T W F Y K S I * K T * P N T TfiI BcgI HinfI | HphI Hin4I | Hpy178III* MaeII | | Hpy188I Hin4I | | BcgI BccI AflIII \ \ \ \ \ \ \ \ \ GATGGATTGTCTGACAGGGCAACTTTTTCGGTTGATTCCAGAGATACTTCTTTGATGGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCTAACAGACTGTCCCGTTGAAAAAGCCAACTAAGGTCTCTATGAAGAAACTACCTT / / / / / / / / | | Hpy188I Hin4I | | BccI TaiI | HphI Hin4I | Hpy178III* SetI BcgI | BcgI HinfI TfiI D G L S D R A T F S V D S R D T S L M E M D C L T G Q L F R L I P E I L L * W N W I V * Q G N F F G * F Q R Y F F D G T ----:----|----:----|----:----|----:----|----:----|----:----| S P N D S L A V K E T S E L S V E K I S H H I T Q C P L K K P Q N W L Y K K S P I S Q R V P C S K R N I G S I S R Q H F SetI Hin6I TaiI ApoI |GlaI MaeIII TspEI ||HhaI \ \ \\\ CGTGTTACTGAATATGCTGAAAAGTTGAATTTGTGCGCCGAGTATAAGGACAGAAAAGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAATGACTTATACGACTTTTCAACTTAAACACGCGGCTCATATTCCTGTCTTTTCTT / / / / /// | | MaeIII | ||Hin6I | AflIII | |GlaI MaeII | HhaI TspEI ApoI R V T E Y A E K L N L C A E Y K D R K E V L L N M L K S * I C A P S I R T E K N C Y * I C * K V E F V R R V * G Q K R T ----:----|----:----|----:----|----:----|----:----|----:----| R T V S Y A S F N F K H A S Y L S L F S V H * Q I H Q F T S N T R R T Y P C F L T N S F I S F L Q I Q A G L I L V S F F Tsp4CI* | MseI | |TspEI | || TatI | || |Csp6I Hpy188I NmeAIII | || ||RsaI MnlI | SetI \ \ \\ \\\ \ \ \ CCACAAGTTGCCAAAACTGTTAATTTGTACTCTAAAGTTGTCAGAGGTAATGGTATTCGC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTTCAACGGTTTTGACAATTAAACATGAGATTTCAACAGTCTCCATTACCATAAGCG / / / / /// / / / NmeAIII | | | ||TatI MnlI | SetI | | | |Csp6I Hpy188I | | | RsaI | | TspEI | MseI Tsp4CI* P Q V A K T V N L Y S K V V R G N G I R H K L P K L L I C T L K L S E V M V F A T S C Q N C * F V L * S C Q R * W Y S Q ----:----|----:----|----:----|----:----|----:----|----:----| G C T A L V T L K Y E L T T L P L P I R V V L Q W F Q * N T S * L Q * L Y H Y E W L N G F S N I Q V R F N D S T I T N A HgaI | BslFI | |CviJI | ||DdeI | ||Bpu10I | ||| TfiI BseMII DdeI | ||| HinfI |BspCNI | TfiI | ||| |Hin4II* || MseI | HinfI | ||| || Hpy178III* \\ \ \ \ \ \\\ \\ \ AATAATCTTAATACTGAGAATCCATTATGGGACGCTATTGTTGGCTTAGGATTCTTGAAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTAGAATTATGACTCTTAGGTAATACCCTGCGATAACAACCGAATCCTAAGAACTTC // / / / // // / / / || MseI | HinfI || || | | Hpy178III* |BspCNI | TfiI || || | HinfI BseMII DdeI || || | TfiI || || Hin4II* || |Bpu10I || |DdeI || BslFI |HgaI CviJI N N L N T E N P L W D A I V G L G F L K I I L I L R I H Y G T L L L A * D S * R * S * Y * E S I M G R Y C W L R I L E G ----:----|----:----|----:----|----:----|----:----|----:----| L L R L V S F G N H S A I T P K P N K F C Y D * Y Q S D M I P R * Q Q S L I R S I I K I S L I W * P V S N N A * S E Q L Csp6I |RsaI ||TspGWI Hin4II* |||BsiI* Tsp4CI* | AccI |||| Hpy178III* Tth111I SspI | |Hpy166II |||| | XmnI \ \ \ \\ \\\\ \ \ GACGGTGTCAAAAATATTCCTTCTTTCTTGTCTACGGACAATATCGGTACTCGTGAAACA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCACAGTTTTTATAAGGAAGAAAGAACAGATGCCTGTTATAGCCATGAGCACTTTGT / / / / // /// / / | Tth111I SspI | |AccI ||| | XmnI Tsp4CI* | Hpy166II ||| Hpy178III* Hin4II* ||| BsiI* ||Csp6I |RsaI TspGWI D G V K N I P S F L S T D N I G T R E T T V S K I F L L S C L R T I S V L V K H R C Q K Y S F F L V Y G Q Y R Y S * N I ----:----|----:----|----:----|----:----|----:----|----:----| S P T L F I G E K K D V S L I P V R S V P R H * F Y E K K R T * P C Y R Y E H F V T D F I N R R E Q R R V I D T S T F C TspEI | TsoI | | BccI | | TfiI | | HinfI FatI | | | Hpy188I |CviAII | | | | CviJI || NlaIII | | | | | MaeIII || | MseI \ \ \ \ \ \ \\ \ \ TTTCTTGCTGGTCTAATTGATTCTGATGGCTATGTTACTGATGAGCATGGTATTAAAGCA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGAACGACCAGATTAACTAAGACTACCGATACAATGACTACTCGTACCATAATTTCGT / / / // / / / // / | | | || CviJI MaeIII | |FatI MseI | | | |Hpy188I | CviAII | | | HinfI NlaIII | | | TfiI | | BccI | TspEI TsoI F L A G L I D S D G Y V T D E H G I K A F L L V * L I L M A M L L M S M V L K Q S C W S N * F * W L C Y * * A W Y * S N ----:----|----:----|----:----|----:----|----:----|----:----| N R A P R I S E S P * T V S S C P I L A M E Q Q D L Q N Q H S H * Q H A H Y * L K K S T * N I R I A I N S I L M T N F C BccI TspDTI TspEI | Hpy188I \ \ \ \ ACAATAAAGACAATTCATACTTCTGTCAGAGATGGTTTGGTTTCCCTTGCTCGTTCTTTA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTATTTCTGTTAAGTATGAAGACAGTCTCTACCAAACCAAAGGGAACGAGCAAGAAAT / / // TspDTI TspEI |Hpy188I BccI T I K T I H T S V R D G L V S L A R S L Q * R Q F I L L S E M V W F P L L V L * N K D N S Y F C Q R W F G F P C S F F R ----:----|----:----|----:----|----:----|----:----|----:----| V I F V I * V E T L S P K T E R A R E K L L L S L E Y K Q * L H N P K G Q E N K C Y L C N M S R D S I T Q N G K S T R * MwoI AlwNI BstAPI | SetI | | DdeI | | Bpu10I | | | BspMI | | | | SetI | | | | |HindII | | | | |Hpy166II BsmAI | | | | || FatI | MseI | | | | || |CviAII | |HpaI | | | | || || NlaIII CviJI | |HindII | | | | || || | HgiCI* |DdeI | |Hpy166II | | | | || || | | NlaIV TspDTI \\ \ \\ \ \ \ \ \\ \\ \ \ \ \ GGCTTAGTAGTCTCGGTTAACGCAGAACCTGCTAAGGTTGACATGAATGGCACCAAACAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAATCATCAGAGCCAATTGCGTCTTGGACGATTCCAACTGTACTTACCGTGGTTTGTA / / // // // /// // / / / | DdeI |BsmAI |SetI || ||| |FatI | | TspDTI CviJI |MseI BstAPI || ||| CviAII | HgiCI* | AlwNI || ||NlaIII NlaIV | MwoI || |BspMI Hpy166II || Hpy166II HindII || HindII HpaI |Bpu10I |DdeI SetI G L V V S V N A E P A K V D M N G T K H A * * S R L T Q N L L R L T * M A P N I L S S L G * R R T C * G * H E W H Q T * ----:----|----:----|----:----|----:----|----:----|----:----| P K T T E T L A S G A L T S M F P V L C L S L L R P * R L V Q * P Q C S H C W V A * Y D R N V C F R S L N V H I A G F M MseI | AclI | MaeII | | SetI TaqI TspEI | | TaiI AsuII \ \ \ \ \ AAAATTAGTTATGCTATTTATATGTCTGGTGGAGATGTTTTGCTTAACGTTCTTTCGAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAATCAATACGATAAATATACAGACCACCTCTACAAAACGAATTGCAAGAAAGCTTC / / / / TspEI | MaeII AsuII | AclI TaqI MseI TaiI SetI K I S Y A I Y M S G G D V L L N V L S K K L V M L F I C L V E M F C L T F F R S N * L C Y L Y V W W R C F A * R S F E V ----:----|----:----|----:----|----:----|----:----|----:----| L I L * A I * I D P P S T K S L T R E F Y F * N H * K Y T Q H L H K A * R E K S F N T I S N I H R T S I N Q K V N K R L AciI | MwoI | |AlfI | |AlfI | |AciI | |BisI | ||BlsI | |||TseI | |||TauI | |||NspBII* | ||||BisI | |||||BlsI | |||||FauI AciI | |||||| MwoI BisI | |||||| | CviRI* SecI* | |||||| | | MaeII DsaI* MroNI | |||||| | | |PmaCI |BlsI Cfr10I BbvI | |||||| | | |BsaAI ||AciI |HpaII StuI | |||||| | | || SetI ||TauI ||NaeI CviJI | |||||| | | || TaiI ||FnuDII* ||Cac8I ApoI HaeIII | |||||| | | || OliI ||NspBII* ||| CviJI TspEI | Cac8I | |||||| | | || MslI |||SacII \\\ \ \ \ \ \ \\\\\\ \ \ \\ \ \\\\ TGTGCCGGCTCTAAAAAATTCAGGCCTGCTCCCGCCGCTGCTTTTGCACGTGAGTGCCGC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGGCCGAGATTTTTTAAGTCCGGACGAGGGCGGCGACGAAAACGTGCACTCACGGCG /// / / / / / ///////// // /// //// ||Cfr10I | | | | | ||||||||FauI || ||MslI |||NspBII* ||MroNI | | | | | |||||||MwoI || ||OliI |||FnuDII* ||CviJI | | | | | |||||||TseI || |MaeII |||AciI |HpaII | | | | | ||||||BisI || BsaAI ||SacII Cac8I | | | | | |||||BlsI || PmaCI ||BisI NaeI | | | | | ||||NspBII* |TaiI |BlsI | | | | | ||||AciI |SetI TauI | | | | | |||BisI CviRI* | | | | | ||BlsI | | | | | |AciI | | | | | |TauI | | | | | AlfI | | | | | AlfI | | | | MwoI | | | BbvI | | Cac8I | HaeIII | CviJI | StuI TspEI ApoI C A G S K K F R P A P A A A F A R E C R V P A L K N S G L L P P L L L H V S A A C R L * K I Q A C S R R C F C T * V P R ----:----|----:----|----:----|----:----|----:----|----:----| H A P E L F N L G A G A A A K A R S H R T H R S * F I * A Q E R R Q K Q V H T G T G A R F F E P R S G G S S K C T L A A AlfI AlfI | TaqI Hin4II* BbvII* BdaI | | MaeIII |TspEI | MboII BdaI Hpy188I \ \ \ \\ \ \ \ \ GGATTTTATTTCGAGTTACAAGAATTGAAGGAAGACGATTATTATGGGATTACTTTATCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAAATAAAGCTCAATGTTCTTAACTTCCTTCTGCTAATAATACCCTAATGAAATAGA / / / // / / / / DsaI* AlfI TaqI || TspEI BbvII* BdaI Hpy188I SecI* AlfI |Hin4II* MboII BdaI AciI MaeIII G F Y F E L Q E L K E D D Y Y G I T L S D F I S S Y K N * R K T I I M G L L Y L I L F R V T R I E G R R L L W D Y F I * ----:----|----:----|----:----|----:----|----:----|----:----| P N * K S N C S N F S S S * * P I V K D R I K N R T V L I S P L R N N H S * K I S K I E L * L F Q L F V I I I P N S * R TfiI HinfI | BsaBI BssKI | |MboI SexAI | |BclI EcoRII | |Hpy188I BdaI | ScrFI TspEI | || DpnI BdaI | BseBI | AciI | || |BstKTI Cac8I | | SetI | | MnlI \ \\ \\ \ \ \ \ \ \ \ GATGATTCTGATCATCAGTTTTTGCTTGCCAACCAGGTTGTCGTCCATAATTGCGGAGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAAGACTAGTAGTCAAAAACGAACGGTTGGTCCAACAGCAGGTATTAACGCCTCTT // // / / / // / / // || || BclI | Cac8I || EcoRII | |AciI || || MboI BdaI || SexAI | MnlI || |DpnI BdaI || BssKI TspEI || BstKTI |BseBI |Hpy188I |ScrFI |BsaBI SetI HinfI TfiI D D S D H Q F L L A N Q V V V H N C G E M I L I I S F C L P T R L S S I I A E K * F * S S V F A C Q P G C R P * L R R K ----:----|----:----|----:----|----:----|----:----|----:----| S S E S * * N K S A L W T T T W L Q P S Q H N Q D D T K A Q W G P Q R G Y N R L I I R I M L K Q K G V L N D D M I A S F BccI | TspDTI | |Hpy178III* | || ApoI | || TspEI AciI SetI | || EcoRI BsrBI \ \ \\ \ \ AGAGGTAATGAAATGGCAGAAGTCTTGATGGAATTCCCAGAGTTATATACTGAAATGAGC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCATTACTTTACCGTCTTCAGAACTACCTTAAGGGTCTCAATATATGACTTTACTCG / // / / / SetI || | EcoRI BsrBI || | TspEI || | ApoI || Hpy178III* |BccI TspDTI R G N E M A E V L M E F P E L Y T E M S E V M K W Q K S * W N S Q S Y I L K * A R * * N G R S L D G I P R V I Y * N E R ----:----|----:----|----:----|----:----|----:----|----:----| L P L S I A S T K I S N G S N Y V S I L F L Y H F P L L R S P I G L T I Y Q F S S T I F H C F D Q H F E W L * I S F H A FatI |CviAII || NspI || Cfr10I Csp6I Csp6I || NlaIII |RsaI TspEI |RsaI TspDTI || |HpaII \\ \ \\ \ \\ \\ GGTACTAAAGAACCAATTATGAAGCGTACTACTTTGGTCGCTAATACATCTAACATGCCG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGATTTCTTGGTTAATACTTCGCATGATGAAACCAGCGATTATGTAGATTGTACGGC / // / // / / // / | |Csp6I TspEI || TspDTI | || HpaII | RsaI |Csp6I | |FatI AciI RsaI | CviAII NlaIII NspI G T K E P I M K R T T L V A N T S N M P V L K N Q L * S V L L W S L I H L T C R Y * R T N Y E A Y Y F G R * Y I * H A G ----:----|----:----|----:----|----:----|----:----|----:----| P V L S G I I F R V V K T A L V D L M G R Y * L V L * S A Y * K P R * Y M * C A T S F F W N H L T S S Q D S I C R V H R MwoI |HindIII BsrI TseI ||BaeI TspRI CviRI* |||AluI | Eco57I Hpy188I |BisI |||BbvI | Eco57MI | MboI ||BlsI |||CviJI | | CviRI* | | DpnI |||CviJI |||| SetI | | | BaeI | | |BstKTI \\\\ \\\\ \ \ \ \ \ \ \ \\ GTTGCAGCCAGAGAAGCTTCTATTTACACTGGTATCACTCTTGCAGAATACTTCAGAGAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGTCGGTCTCTTCGAAGATAAATGTGACCATAGTGAGAACGTCTTATGAAGTCTCTA / //// / / / / / / / / / / // | |||| | | | | | TspRI | Eco57MI CviRI* | |DpnI | |||| | | | | BbvI | Eco57I BaeI | BstKTI | |||| | | | HindIII BsrI Hpy188I | |||| | | CviJI | |||| | | AluI | |||| | SetI | |||| MwoI | |||| BaeI | |||CviJI | |||TseI | ||BisI | |BlsI | CviRI* Cfr10I V A A R E A S I Y T G I T L A E Y F R D L Q P E K L L F T L V S L L Q N T S E I C S Q R S F Y L H W Y H S C R I L Q R S ----:----|----:----|----:----|----:----|----:----|----:----| T A A L S A E I * V P I V R A S Y K L S P Q L W L L K * K C Q Y * E Q L I S * L N C G S F S R N V S T D S K C F V E S I BccI |Ksp632I* MlyI || Hpy178III* PleI || | CviJI |MboII || | | HindIII || CviRI* || | | | AluI || |MboII || | | | CviJI SetI || || HinfI || | | | | SetI \ \\ \\ \ \\ \ \ \ \ \ CAAGGTAAAAATGTTTCTATGATTGCAGACTCTTCTTCAAGATGGGCTGAAGCTTTGAGA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCATTTTTACAAAGATACTAACGTCTGAGAAGAAGTTCTACCCGACTTCGAAACTCT // // / / / // / / / / |SetI || | | | || | | | HindIII MboI || | | | || | | CviJI || | | | || | | AluI || | | | || | SetI || | | | || CviJI || | | | |Hpy178III* || | | | Ksp632I* || | | BccI || | HinfI || CviRI* || MboII |PleI MboII MlyI Q G K N V S M I A D S S S R W A E A L R K V K M F L * L Q T L L Q D G L K L * E R * K C F Y D C R L F F K M G * S F E R ----:----|----:----|----:----|----:----|----:----|----:----| * P L F T E I I A S E E E L H A S A K L D L Y F H K * S Q L S K K L I P Q L K S L T F I N R H N C V R R * S P S F S Q S Cac8I | HphI | | MboI | | BclI | | | DpnI | | | |BstKTI EcoP15I | | | || SetI |ApoI | | | || | BseYI |TspEI | | | || | |TaqII || TaqII | | | || | || AluI || |Eco57I | | | || | || GsaI || |Eco57MI | | | || | || CviJI || || SfaNI | | | || | || | SetI \\ \\ \ \ \ \ \\ \ \\ \ \ GAAATTTCTGGTCGTTTGGGTGAGATGCCTGCTGATCAAGGTTTCCCAGCTTATTTGGGT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAAGACCAGCAAACCCACTCTACGGACGACTAGTTCCAAAGGGTCGAATAAACCCA / // / // // // // / / | |Eco57MI SfaNI || || |SetI || | BseYI | |Eco57I || || BclI || | CviJI | |TspEI || || MboI || | AluI | |ApoI || |DpnI || SetI | TaqII || BstKTI |GsaI EcoP15I |HphI TaqII Cac8I E I S G R L G E M P A D Q G F P A Y L G K F L V V W V R C L L I K V S Q L I W V N F W S F G * D A C * S R F P S L F G C ----:----|----:----|----:----|----:----|----:----|----:----| S I E P R K P S I G A S * P K G A * K P L F K Q D N P H S A Q Q D L N G L K N P F N R T T Q T L H R S I L T E W S I Q T CviJI Cfr10I |HpaII || MwoI MboI MwoI || | AluI | DpnI | CviJI || | CviJI SetI | |TspGWI DdeI | HaeIII MnlI || | | SetI NlaIV | |BstKTI \ \ \ \ \\ \ \ \ \ \ \\ GCTAAGTTGGCCTCCTTTTACGAAAGAGCCGGTAAAGCTGTTGCTTTAGGTTCCCCAGAT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTCAACCGGAGGAAAATGCTTTCTCGGCCATTTCGACAACGAAATCCAAGGGGTCTA // / / / // / / / / // |DdeI HaeIII MnlI | || | CviJI | NlaIV |DpnI MwoI CviJI | || | AluI SetI BstKTI | || SetI TspGWI | |Cfr10I | HpaII | MwoI CviJI A K L A S F Y E R A G K A V A L G S P D L S W P P F T K E P V K L L L * V P Q I * V G L L L R K S R * S C C F R F P R S ----:----|----:----|----:----|----:----|----:----|----:----| A L N A E K * S L A P L A T A K P E G S H * T P R R K R F L R Y L Q Q K L N G L S L Q G G K V F S G T F S N S * T G W I BinI* | DdeI Cac8I | | MboI | CviJI | | XhoII BsrI TseI | Cfr10I | | Hpy188I NlaIV BccI | |HpaII | | |HphI Csp6I | BbvI |BisI | || PflMI | | ||DpnI |RsaI | |BceAI ||BlsI | || BsiYI* | | |||BstKTI \\ \ \\ \\\ \ \\ \ \ \ \\\\ CGTACTGGTTCCGTTTCCATCGTTGCTGCCGTTTCGCCAGCCGGTGGTGATTTCTCAGAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GCATGACCAAGGCAAAGGTAGCAACGACGGCAAAGCGGTCGGCCACCACTAAAGAGTCTA / // / / // /// / / // / //// | || | NlaIV |BbvI ||TseI | | |Cfr10I | |||DpnI | || BsrI BceAI |BisI | | HpaII | ||BstKTI | |Csp6I BccI | BsiYI* | ||AlwNI | RsaI BlsI | PflMI | |HphI MboI | CviJI | |DdeI Cac8I | Hpy188I BinI* R T G S V S I V A A V S P A G G D F S D V L V P F P S L L P F R Q P V V I S Q I Y W F R F H R C C R F A S R W * F L R S ----:----|----:----|----:----|----:----|----:----|----:----| R V P E T E M T A A T E G A P P S K E S D Y Q N R K W R Q Q R K A L R H H N R L T S T G N G D N S G N R W G T T I E * I AlwNI | MaeIII | | BspCNI | | |BseMII | | || Bce83I* SmlI TspEI \ \ \\ \ \ \ CCTGTTACTACTGCTACATTGGGTATCACTCAAGTCTTTTGGGGTTTAGACAAGAAATTG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAATGATGACGATGTAACCCATAGTGAGTTCAGAAAACCCCAAATCTGTTCTTTAAC / // / / / / | || | Bce83I* SmlI TspEI | || MaeIII | |BseMII | BspCNI XhoII MboI P V T T A T L G I T Q V F W G L D K K L L L L L L H W V S L K S F G V * T R N W C Y Y C Y I G Y H S S L L G F R Q E I G ----:----|----:----|----:----|----:----|----:----|----:----| G T V V A V N P I V * T K Q P K S L F N D Q * * Q * M P Y * E L R K P N L C S I R N S S S C Q T D S L D K P T * V L F Q CviJI BccI \ \ GCTCAAAGAAAGCATTTCCCATCTATCAACACATCTGTTTCTTACTCCAAATACACTAAT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTTTCTTTCGTAAAGGGTAGATAGTTGTGTAGACAAAGAATGAGGTTTATGTGATTA / / CviJI BccI A Q R K H F P S I N T S V S Y S K Y T N L K E S I S H L S T H L F L T P N T L M S K K A F P I Y Q H I C F L L Q I H * C ----:----|----:----|----:----|----:----|----:----|----:----| A * L F C K G D I L V D T E * E L Y V L P E F F A N G M * * C M Q K K S W I C * S L S L M E W R D V C R N R V G F V S I MboI TfiI | DpnI HinfI ApoI | |BstKTI Hpy178III* | TspEI TspEI MseI | |Hin4II* \ \ \ \ \ \ \\ GTCTTGAACAAGTTTTATGATTCCAATTACCCTGAATTTCCTGTTTTAAGAGATCGTATG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAACTTGTTCAAAATACTAAGGTTAATGGGACTTAAAGGACAAAATTCTCTAGCATAC / / / / / // / Hpy178III* HinfI TspEI TspEI | || MboI TfiI ApoI | |Hin4II* | |DpnI | BstKTI MseI V L N K F Y D S N Y P E F P V L R D R M S * T S F M I P I T L N F L F * E I V * L E Q V L * F Q L P * I S C F K R S Y E ----:----|----:----|----:----|----:----|----:----|----:----| T K F L N * S E L * G S N G T K L S R I H R S C T K H N W N G Q I E Q K L L D Y D Q V L K I I G I V R F K R N * S I T H Eco57I ApoI Eco57MI TspEI TspDTI TspEI MboII | TspEI \ \ \ \ \ \ AAGGAAATTCTATCAAACGCTGAAGAATTAGAACAAGTTGTTCAATTAGTTGGTAAATCG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTTAAGATAGTTTGCGACTTCTTAATCTTGTTCAACAAGTTAATCAACCATTTAGC / / / / / / | TspDTI | MboII Eco57MI TspEI TspEI TspEI Eco57I ApoI K E I L S N A E E L E Q V V Q L V G K S R K F Y Q T L K N * N K L F N * L V N R G N S I K R * R I R T S C S I S W * I G ----:----|----:----|----:----|----:----|----:----|----:----| F S I R D F A S S N S C T T * N T P L D S P F E I L R Q L I L V L Q E I L Q Y I L F N * * V S F F * F L N N L * N T F R CviJI MseI HaeIII Hpy188I BseGI FokI \ \ \ \ GCCTTGTCTGATAGTGATAAGATTACTTTGGATGTTGCCACTTTAATCAAGGAAGATTTC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAACAGACTATCACTATTCTAATGAAACCTACAACGGTGAAATTAGTTCCTTCTAAAG / / / / / / HaeIII Hpy188I BseGI | FokI TsoI CviJI MseI A L S D S D K I T L D V A T L I K E D F P C L I V I R L L W M L P L * S R K I S L V * * * * D Y F G C C H F N Q G R F L ----:----|----:----|----:----|----:----|----:----|----:----| A K D S L S L I V K S T A V K I L S S K P R T Q Y H Y S * K P H Q W K L * P L N G Q R I T I L N S Q I N G S * D L F I E BdaI BdaI TsoI |BbvII* |CviRI* MaeIII || Hin4I ||MboII | SfaNI TspEI || |MboII \\\ \ \ \ \\ \\ TTGCAACAAAATGGTTACTCCACTTATGATGCTTTCTGTCCAATTTGGAAGACATTTGAT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTGTTTTACCAATGAGGTGAATACTACGAAAGACAGGTTAAACCTTCTGTAAACTA / / / / / / / CviRI* | SfaNI TspEI | | BbvII* MboII MaeIII | | MboII | Hin4I BdaI BdaI L Q Q N G Y S T Y D A F C P I W K T F D C N K M V T P L M M L S V Q F G R H L I A T K W L L H L * C F L S N L E D I * Y ----:----|----:----|----:----|----:----|----:----|----:----| K C C F P * E V * S A K Q G I Q F V N S R A V F H N S W K H H K R D L K S S M Q Q L L I T V G S I I S E T W N P L C K I Hin4II* | FatI | BspHI | |CviAII | |Hpy178III* | || BdaI | || BdaI | || NlaIII | || | Hin4I | || | | AluI | || | | CviJI | || | | | SetI | || | | | | MwoI | || | | | | | AluI MwoI BdaI | || | | | | | CviJI BdaI HgiCI* TspDTI CviJI BdaI | || | | | | | | SetI BdaI | NlaIV \ \ \ \ \\ \ \ \ \ \ \ \ \ \ \ ATGATGAGAGCCTTCATCTCGTATCATGACGAAGCTCAAAAAGCTGTTGCTAATGGTGCC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTCTCGGAAGTAGAGCATAGTACTGCTTCGAGTTTTTCGACAACGATTACCACGG / / / / / /// / / / / / / / / / TspDTI | BdaI | | ||| | | | | | | MwoI | HgiCI* | BdaI | | ||| | | | | | BdaI NlaIV CviJI | | ||| | | | | | BdaI | | ||| | | | | CviJI | | ||| | | | | AluI | | ||| | | | SetI | | ||| | | MwoI | | ||| | CviJI | | ||| | AluI | | ||| SetI | | ||BspHI | | ||FatI | | |Hpy178III* | | |CviAII | | Hin4I | | BdaI | | BdaI | NlaIII Hin4II* M M R A F I S Y H D E A Q K A V A N G A * * E P S S R I M T K L K K L L L M V P D E S L H L V S * R S S K S C C * W C Q ----:----|----:----|----:----|----:----|----:----|----:----| I I L A K M E Y * S S A * F A T A L P A Y S S L R * R T D H R L E F L Q Q * H H H H S G E D R I M V F S L F S N S I T G BceAI MaeIII Tsp45I | BsrI | | MaeII | | | MseI | | | SetI | | | TaiI | | | | FatI | | | | |HphI MlyI | | | | |CviAII PleI | | | | ||MboII MaeI | | | | ||Cac8I | AluI | | | | ||TspDTI | CviJI | | | | ||| SphI | | SetI | | | | ||| NspI ApoI BsrI | | |HinfI | | | | ||| NlaIII TspEI \ \ \ \\ \ \ \ \ \\\ \ \ AACTGGTCAAAACTAGCTGACTCTACTGGTGACGTTAAGCATGCCGTTTCTTCATCTAAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACCAGTTTTGATCGACTGAGATGACCACTGCAATTCGTACGGCAAAGAAGTAGATTT / //// / / // // / ///// BsrI |||CviJI HinfI | || || | ||||FatI |||AluI | || || | |||CviAII ||MaeI | || || | ||Cac8I |SetI | || || | |MboII |PleI | || || | NlaIII MlyI | || || | TspDTI | || || | HphI | || || | NspI | || || | SphI | || || MseI | || |MaeII | || Tsp45I | || MaeIII | |TaiI | |SetI | BceAI BsrI N W S K L A D S T G D V K H A V S S S K T G Q N * L T L L V T L S M P F L H L N L V K T S * L Y W * R * A C R F F I * I ----:----|----:----|----:----|----:----|----:----|----:----| L Q D F S A S E V P S T L C A T E E D L W S T L V L Q S * Q H R * A H R K K M * V P * F * S V R S T V N L M G N R * R F HphI | FatI | NcoI | StyI | SecI* | DsaI* | |CviAII | || NlaIII | || | ApoI | || | TspEI | || | EcoRI | || | | TaqI | || | | AsuII BsiYI* | || | | | TspEI \ \ \\ \ \ \ \ TTTTTTGAACCAAGCAGGGGTGAAAAGGAAGTCCATGGCGAATTCGAAAAATTGTTGAGC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAACTTGGTTCGTCCCCACTTTTCCTTCAGGTACCGCTTAAGCTTTTTAACAACTCG / / / / // / / / / TspEI BsiYI* | | |DsaI* | AsuII | HgiAI* ApoI | | |SecI* | TaqI | SduI | | |StyI EcoRI TspEI | | |NcoI TspEI | | |FatI ApoI | | CviAII | NlaIII HphI F F E P S R G E K E V H G E F E K L L S F L N Q A G V K R K S M A N S K N C * A F * T K Q G * K G S P W R I R K I V E H ----:----|----:----|----:----|----:----|----:----|----:----| N K S G L L P S F S T W P S N S F N N L I K Q V L C P H F P L G H R I R F I T S K K F W A P T F L F D M A F E F F Q Q A SduI HgiAI* TfiI | CviRI* HinfI MseI \ \ \ \ ACTATGCAAGAAAGATTTGCTGAATCTACCGATTAA 3190 3200 3210 ----:----|----:----|----:----|----:- TGATACGTTCTTTCTAAACGACTTAGATGGCTAATT / / / CviRI* HinfI MseI TfiI T M Q E R F A E S T D * L C K K D L L N L P I X Y A R K I C * I Y R L X ----:----|----:----|----:----|----:- V I C S L N A S D V S * C * A L F I Q Q I * R N S H L F S K S F R G I L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 8 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 3 AjuI 1 AlfI 2 AluI 13 AluBI AlwNI 3 CaiI ApoI 10 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 16 Bce83I* 3 BpuEI BceAI 3 BcgI 2 BclI 2 FbaI,Ksp22I BdaI 6 BetI* 2 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 5 Bpu10I 2 BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 4 BseYI 1 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 9 Cac8I 7 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 4 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 14 CviQI,RsaNI CviAII 13 CviJI 40 CviKI-1 CviRI* 10 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 9 MalI DraII 2 EcoO109I DsaI* 2 BtgI,BstDSI EciI 2 Eco57I 3 AcuI Eco57MI 5 EcoP15I 2 EcoRI 3 EcoRII 4 AjnI,Psp6I,PspGI FatI 13 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 1 GsaI 1 GsuI 2 BpmI HaeIII 9 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 3 HincII HindIII 3 HinfI 15 HpaI 2 KspAI HpaII 7 HapII,BsiSI,MspI HphI 11 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 14 Hpy99I 2 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 11 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 3 SchI MnlI 13 MroNI 1 NgoMIV MseI 14 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 8 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 1 Bsp19I NlaIII 13 Hin1II,Hsp92II,FaeI NlaIV 10 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 3 MspA1I NspI 4 BstNSI,XceI OliI 2 AleI PflMI 2 BasI,AccB7I,Van91I PfoI 1 PleI 3 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PstI 1 PvuII 1 RsaI 14 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII ScaI 2 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 42 SexAI 2 MabI SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SphI 1 PaeI,BbuI SspI 2 StuI 2 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 6 TaqII 4 TatI 5 TauI 2 TfiI 12 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 5 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 36 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AflII AgeI AhaIII* AloI ApaI ApaLI AscI AvaI AvrII BalI BamHI BarI BbvCI BciVI BfiI BglI BmeT110I BmtI BplI BsePI BseRI BseSI BsmI Bsp120I BspMII* BspOI BssNAI Bst1107I BstXI BstZ17I BtgZI BtrI BtsI Cfr9I CfrI CspCI DinI DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI HaeII KasI MauBI MluI MmeI Mph1103I MstI* NarI NdeI NheI NotI NruI NsiI PacI PasI PmeI PpiI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SalI SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769