Restriction Map of LYS20/YDL182W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

LYS20/YDL182W on chromosome IV from coordinates 133437 to 134723.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.11327

NdeI BssKI TseI | TseI |HpaII |BisI | |BisI ||ScrFI ||BlsI BbvI | ||BlsI ||CauII* \\\ \ \ \\\ \\\ ATGACTGCTGCTAAACCAAATCCATATGCTGCCAAACCGGGCGACTATCTTTCTAATGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGACGACGATTTGGTTTAGGTATACGACGGTTTGGCCCGCTGATAGAAAGATTACAT /// / / /// / / ||TseI BbvI | ||TseI | BssKI |BisI | |BisI CauII* BlsI | BlsI HpaII NdeI ScrFI M T A A K P N P Y A A K P G D Y L S N V * L L L N Q I H M L P N R A T I F L M * D C C * T K S I C C Q T G R L S F * C K ----:----|----:----|----:----|----:----|----:----|----:----| X V A A L G F G Y A A L G P S * R E L T X S Q Q * V L D M H Q W V P R S D K * H H S S S F W I W I S G F R A V I K R I Y BsrI | MseI | | TaqI | | ClaI | | | TfiI | | | HinfI Hpy99I SetI | | | BseMII |DdeI |Hpy166II HphI | | | |BspCNI |Hin4II* || AjuI | MboII TspEI | | | || TaqI || HgaI || TspEI | | BsmI \ \ \ \ \\ \ \\ \ \\ \ \ \ \ AATAATTTCCAGTTAATCGATTCGACGCTGAGAGAAGGTGAACAATTTGCCAACGCATTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTAAAGGTCAATTAGCTAAGCTGCGACTCTCTTCCACTTGTTAAACGGTTGCGTAAG / / /// / / / / / / / // / / TspEI | ||| | | | | | | | || | BsmI BsrI | ||| | | | | | | | || MboII | ||| | | | | | | | |HphI | ||| | | | | | | | TspEI | ||| | | | | | | Hpy166II | ||| | | | | | HgaI | ||| | | | | | AjuI | ||| | | | | SetI | ||| | | | DdeI | ||| | | Hin4II* | ||| | TaqI | ||| Hpy99I | ||| HinfI | ||| TfiI | ||ClaI | ||TaqI | |BspCNI | BseMII MseI N N F Q L I D S T L R E G E Q F A N A F I I S S * S I R R * E K V N N L P T H S * F P V N R F D A E R R * T I C Q R I L ----:----|----:----|----:----|----:----|----:----|----:----| F L K W N I S E V S L S P S C N A L A N L Y N G T L R N S A S L L H V I Q W R M I I E L * D I R R Q S F T F L K G V C E AjuI | MboI | | DpnI | | |TaqI CviJI Hpy166II | | |BstKTI |StyI |BplI TaqI | | || TspEI MaeI |SecI* |BplI \ \ \ \\ \ \ \\ \\ TTCGATACTGAAAAAAAGATCGAAATTGCTAGAGCCTTGGACGATTTCGGTGTGGACTAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTATGACTTTTTTTCTAGCTTTAACGATCTCGGAACCTGCTAAAGCCACACCTGATG / / // // / / / / / / TaqI AjuI || |TaqI | | | SecI* | Hpy166II || MboI | | | StyI BplI |DpnI | | CviJI BplI BstKTI | MaeI TspEI F D T E K K I E I A R A L D D F G V D Y S I L K K R S K L L E P W T I S V W T T R Y * K K D R N C * S L G R F R C G L H ----:----|----:----|----:----|----:----|----:----|----:----| K S V S F F I S I A L A K S S K P T S * R R Y Q F F S R F Q * L R P R N R H P S E I S F F L D F N S S G Q V I E T H V V TaqI | HphI | | MseI | | |HpaI BplI | | |HindII BplI Tsp4CI* | | |Hpy166II Hpy188I | AluI | | || SetI | SfaNI | CviJI | | || | BsrI MnlI | | Hpy178III* | | SetI \ \ \\ \ \ \ \ \ \ \ \ \ ATCGAGTTAACCTCACCAGTAGCATCTGAACAATCAAGAAAGGACTGTGAAGCTATATGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTCAATTGGAGTGGTCATCGTAGACTTGTTAGTTCTTTCCTGACACTTCGATATACA / // / / / / / / / / / | |MseI BsrI | | Hpy188I | | | | CviJI | |SetI | BplI | | | | AluI | Hpy166II | BplI | | | SetI | HindII MnlI | | Tsp4CI* | HpaI | Hpy178III* TaqI SfaNI HphI I E L T S P V A S E Q S R K D C E A I C S S * P H Q * H L N N Q E R T V K L Y V R V N L T S S I * T I K K G L * S Y M * ----:----|----:----|----:----|----:----|----:----|----:----| M S N V E G T A D S C D L F S Q S A I H C R T L R V L L M Q V I L F P S H L * I D L * G * W Y C R F L * S L V T F S Y T Hpy166II | SetI | |MseI | ||AhaIII* | ||| BinI* | ||| |CviJI NdeI | ||| |HaeIII | MslI | ||| || MboI | | BceAI | ||| || XhoII | | | AcyI | ||| || | DpnI | | | |BseGI | MaeI ||| || | |BstKTI | | | || DrdI \ \ \\\ \\ \ \\ \ \ \ \\ \ AAACTAGGTTTAAAGGCCAAGATCCTTACACACATTCGTTGTCATATGGATGACGCCAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGATCCAAATTTCCGGTTCTAGGAATGTGTGTAAGCAACAGTATACCTACTGCGGTTT / // // / // / // // // / | |MaeI || | || XhoII || || || MwoI | SetI || | || MboI || || |DrdI Hpy166II || | |DpnI || || AcyI || | BstKTI || |BseGI || HaeIII || BceAI || CviJI |MslI || BinI* NdeI |MseI AhaIII* K L G L K A K I L T H I R C H M D D A K N * V * R P R S L H T F V V I W M T P K T R F K G Q D P Y T H S L S Y G * R Q S ----:----|----:----|----:----|----:----|----:----|----:----| L S P K F A L I R V C M R Q * I S S A L Y V L N L P W S G * V C E N D Y P H R W F * T * L G L D K C V N T T M H I V G F PshAI | BsrI | |SalI | ||TaqI | ||AccI HgiCI* | |||HindII | NlaIV | |||Hpy166II | | SetI MwoI | |||| Hpy99I | | | ApoI HgaI | |||| Tsp4CI* | | | TspEI FokI | |||| Tth111I | | | | MnlI | BsmAI | |||| | TaqI | | | | |MseI \ \ \ \\\\ \ \ \ \ \ \ \\ GTCGCCGTAGAGACTGGTGTCGACGGTGTCGATGTCGTTATCGGCACCTCCAAATTTTTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCGGCATCTCTGACCACAGCTGCCACAGCTACAGCAATAGCCGTGGAGGTTTAAAAAT // / / ///// / / / / / / || BsmAI | ||||| | TaqI | HgiCI* | MseI |HgaI | ||||| Tth111I NlaIV TspEI FokI | ||||Tsp4CI* SetI MnlI | |||SalI ApoI | ||AccI | ||TaqI | |Hpy166II | |HindII | Hpy99I PshAI BsrI V A V E T G V D G V D V V I G T S K F L S P * R L V S T V S M S L S A P P N F * R R R D W C R R C R C R Y R H L Q I F K ----:----|----:----|----:----|----:----|----:----|----:----| T A T S V P T S P T S T T I P V E L N K L R R L S Q H R R H R H R * R C R W I K D G Y L S T D V T D I D N D A G G F K * SecI* DsaI* | Tsp4CI* | | BtgZI TspDTI SspI | | BsiYI* | MwoI \ \ \ \ \ \ AGACAATATTCCCACGGTAAGGATATGAACTACATCGCCAAGAGTGCTGTTGAAGTCATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTATAAGGGTGCCATTCCTATACTTGATGTAGCGGTTCTCACGACAACTTCAGTAA / // / / / SspI |DsaI* BtgZI | MwoI |SecI* TspDTI Tsp4CI* BsiYI* R Q Y S H G K D M N Y I A K S A V E V I D N I P T V R I * T T S P R V L L K S L T I F P R * G Y E L H R Q E C C * S H * ----:----|----:----|----:----|----:----|----:----|----:----| L C Y E W P L S I F * M A L L A T S T M L V I N G R Y P Y S S C R W S H Q Q L * S L I G V T L I H V V D G L T S N F D N Hpy188I | Eco57I | Eco57MI | | Hpy188I MboII | | | TfiI Hpy188I ApoI | | | HinfI | MboI TspEI SetI | | | | MnlI | Hin4II* \ \ \ \ \ \ \ \ \ GAATTTGTCAAATCCAAAGGTATTGAAATCAGATTTTCCTCTGAAGATTCCTTCAGAAGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAACAGTTTAGGTTTCCATAACTTTAGTCTAAAAGGAGACTTCTAAGGAAGTCTTCA / / / / / / / / // TspEI SetI | | | | | | |Eco57MI ApoI | | | | | | |Eco57I | | | | | | Hin4II* | | | | | Hpy188I | | | | | MboII | | | | HinfI | | | | TfiI | | | MnlI | | Hpy188I | Eco57MI | Eco57I Hpy188I E F V K S K G I E I R F S S E D S F R S N L S N P K V L K S D F P L K I P S E V I C Q I Q R Y * N Q I F L * R F L Q K * ----:----|----:----|----:----|----:----|----:----|----:----| S N T L D L P I S I L N E E S S E K L L Q I Q * I W L Y Q F * I K R Q L N R * F F K D F G F T N F D S K G R F I G E S T DpnI Eco57I Tsp4CI* Eco57MI | HindII |BstKTI | Hpy166II || MboI | | MboI || | DpnI | | | DpnI HinfI || | |BstKTI PsiI | | | |BstKTI |MmeI \\ \ \\ \ \ \ \ \\ \\ GATCTCGTTGATCTTTTGAACATTTATAAAACCGTTGACAAGATCGGTGTAAATAGAGTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAGCAACTAGAAAACTTGTAAATATTTTGGCAACTGTTCTAGCCACATTTATCTCAG // / // / / / / // / / / || MboI || MboI PsiI | | || MboI | HinfI |DpnI |DpnI | | |DpnI MmeI BstKTI BstKTI | | BstKTI | Hpy166II | HindII Tsp4CI* D L V D L L N I Y K T V D K I G V N R V I S L I F * T F I K P L T R S V * I E S S R * S F E H L * N R * Q D R C K * S R ----:----|----:----|----:----|----:----|----:----|----:----| S R T S R K F M * L V T S L I P T F L T H D R Q D K S C K Y F R Q C S R H L Y L I E N I K Q V N I F G N V L D T Y I S D MboI BclI | DpnI | |BstKTI | || Hpy188I PleI | || | Ksp632I* |MlyI Tsp4CI* BseGI FokI | || | |TspDTI \\ \ \ \ \ \\ \ \\ GGTATTGCCGACACAGTTGGATGTGCCAACCCAAGACAAGTATATGAACTGATCAGAACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACGGCTGTGTCAACCTACACGGTTGGGTTCTGTTCATATACTTGACTAGTCTTGA / / / / // / / PleI Tsp4CI* BseGI FokI || | TspDTI MlyI || Hpy188I || BclI || MboI |DpnI BstKTI G I A D T V G C A N P R Q V Y E L I R T V L P T Q L D V P T Q D K Y M N * S E L Y C R H S W M C Q P K T S I * T D Q N F ----:----|----:----|----:----|----:----|----:----|----:----| P I A S V T P H A L G L C T Y S S I L V R Y Q R C L Q I H W G L V L I H V S * F T N G V C N S T G V W S L Y I F Q D S S MboII |FatI ||CviAII ||| MaeIII ||| Tsp45I ||| |NlaIII TspDTI ||| || TaqI BsmI XcmI BsrI BsrDI \ \\\ \\ \ \ \ \ \ TTGAAGAGTGTTGTTTCATGTGACATCGAATGCCATTTCCACAACGATACTGGTTGTGCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTCACAACAAAGTACACTGTAGCTTACGGTAAAGGTGTTGCTATGACCAACACGG / / / / // / / / / / / | TspDTI | | || | | BsmI XcmI BsrI BsrDI Ksp632I* | | || | TaqI | | || Tsp45I | | || MaeIII | | |FatI | | CviAII | NlaIII MboII L K S V V S C D I E C H F H N D T G C A * R V L F H V T S N A I S T T I L V V P E E C C F M * H R M P F P Q R Y W L C H ----:----|----:----|----:----|----:----|----:----|----:----| K F L T T E H S M S H W K W L S V P Q A K S S H Q K M H C R I G N G C R Y Q N H Q L T N N * T V D F A M E V V I S T T G AcyI MaeII |ZraI || SetI || TaiI || AatII BdaI || | TatI BtsI BdaI || | |Csp6I | MwoI SetI || | |Hpy166II | | Hin4II* |HgiCI* || | ||RsaI CviRI* | | | TspRI || NlaIV || | |||TspRI \ \ \ \ \ \\ \ \\ \ \\\\ ATTGCAAACGCCTACACTGCTTTGGAAGGTGGTGCCAGATTGATTGACGTCAGTGTACTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGTTTGCGGATGTGACGAAACCTTCCACCACGGTCTAACTAACTGCAGTCACATGAC / // / / / / / / // //// / CviRI* |MwoI Hin4II* | BdaI | HgiCI* | |MaeII |||| BsrI TspRI | BdaI NlaIV | |AcyI |||TatI BtsI SetI | TspRI ||Csp6I | ZraI |RsaI AatII Hpy166II TaiI SetI I A N A Y T A L E G G A R L I D V S V L L Q T P T L L W K V V P D * L T S V Y W C K R L H C F G R W C Q I D * R Q C T G ----:----|----:----|----:----|----:----|----:----|----:----| M A F A * V A K S P P A L N I S T L T S W Q L R R C Q K P L H H W I S Q R * H V N C V G V S S Q F T T G S Q N V D T Y Q MaeI | BsiYI* | | SetI | | | MnlI | | | |CviJI | | | || FatI BsrI | | | || SduI | BdaI BseRI | | | || HgiJII* | BdaI | HphI | | | || |CviAII | | BfiI | Tsp4CI* | | | || || NlaIII \ \ \ \ \ \ \ \ \\ \\ \ GGTATTGGTGAAAGAAACGGTATCACTCCTCTAGGTGGGCTCATGGCAAGAATGATTGTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACCACTTTCTTTGCCATAGTGAGGAGATCCACCCGAGTACCGTTCTTACTAACAA / / / / /// / / / // | BfiI | Tsp4CI* ||| | | | |FatI BdaI | HphI ||| | | | CviAII BdaI BseRI ||| | | NlaIII ||| | CviJI ||| HgiJII* ||| MnlI ||| SduI ||MaeI |SetI BsiYI* G I G E R N G I T P L G G L M A R M I V V L V K E T V S L L * V G S W Q E * L L Y W * K K R Y H S S R W A H G K N D C C ----:----|----:----|----:----|----:----|----:----|----:----| P I P S L F P I V G R P P S M A L I I T P Y Q H F F R Y * E E L H A * P L F S Q T N T F S V T D S R * T P E H C S H N N CviRI* | MboI AciI | BsmAI BssKI BisI | | DpnI SexAI |BlsI | | |BstKTI EcoRII ||TauI Tth111I | | || Hpy188I |SfaNI \\\ \ \ \ \\ \ \\ GCCGCACCAGACTATGTCAAGTCCAAATACAAGTTGCACAAGATCAGAGACATTGAAAAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGTGGTCTGATACAGTTCAGGTTTATGTTCAACGTGTTCTAGTCTCTGTAACTTTTG //// / / // / / |||AciI Tth111I | || Hpy188I SetI ||BisI | || BsmAI |BlsI | || MboI TauI | |DpnI | BstKTI CviRI* A A P D Y V K S K Y K L H K I R D I E N P H Q T M S S P N T S C T R S E T L K T R T R L C Q V Q I Q V A Q D Q R H * K P ----:----|----:----|----:----|----:----|----:----|----:----| A A G S * T L D L Y L N C L I L S M S F Q R V L S H * T W I C T A C S * L C Q F G C W V I D L G F V L Q V L D S V N F V BssKI MseI BsiYI* ScrFI |HpaI |HpaII BseBI |HindII ||ScrFI |SetI |Hpy166II HphI ||CauII* \\ \\ \ \\\ CTGGTCGCTGATGCTGTGGAAGTTAACATTCCATTCAACAACCCTATCACCGGGTTCTGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GACCAGCGACTACGACACCTTCAATTGTAAGGTAAGTTGTTGGGATAGTGGCCCAAGACA / / // / / / / / | EcoRII |MseI HphI | | | BsmI | SexAI Hpy166II | | BssKI | BssKI HindII | CauII* | SfaNI HpaI | HpaII BseBI | ScrFI ScrFI BsiYI* L V A D A V E V N I P F N N P I T G F C W S L M L W K L T F H S T T L S P G S V G R * C C G S * H S I Q Q P Y H R V L C ----:----|----:----|----:----|----:----|----:----|----:----| R T A S A T S T L M G N L L G I V P N Q G P R Q H Q P L * C E M * C G * * R T R Q D S I S H F N V N W E V V R D G P E T SetI | FatI | |CviAII | || NlaIII | || |StyI | || |SecI* | || ||BsiYI* | || |||TsoI | || |||BciVI | || |||| CviJI | || |||| HaeIII | || |||| | XcmI BsmI | || |||| | | BglI CviRI* | || |||| | | MwoI BccI | BspMI | || |||| | | | CviJI |SetI \ \ \ \\ \\\\ \ \ \ \ \\ GCATTCACACATAAAGCAGGTATCCATGCCAAGGCCATTTTGGCTAACCCATCTACCTAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAGTGTGTATTTCGTCCATAGGTACGGTTCCGGTAAAACCGATTGGGTAGATGGATG / / / / //// /// / / / / CviRI* BspMI SetI | |||| ||| MwoI CviJI | BccI | |||| ||| BglI SetI | |||| ||XcmI | |||| |HaeIII | |||| |CviJI | |||| SecI* | |||| StyI | |||BciVI | ||TsoI | |FatI | BsiYI* | CviAII NlaIII A F T H K A G I H A K A I L A N P S T Y H S H I K Q V S M P R P F W L T H L P T I H T * S R Y P C Q G H F G * P I Y L R ----:----|----:----|----:----|----:----|----:----|----:----| A N V C L A P I W A L A M K A L G D V * H M * V Y L L Y G H W P W K P * G M * R C E C M F C T D M G L G N Q S V W R G V AsuI* AvaII |BmgT120I ||NlaIV ||| Hpy178III* ||| | MnlI ||| | | Ksp632I* ||| | | |MnlI MboII ||| | | || BarI SetI |TspDTI BarI \\\ \ \ \\ \ \ \\ \ GAAATCTTGGACCCTCACGATTTCGGTATGAAGAGGTATATCCACTTCGCCAACAGACTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAGAACCTGGGAGTGCTAAAGCCATACTTCTCCATATAGGTGAAGCGGTTGTCTGAT // / // / / / / / |AvaII | || | | SetI TspDTI BarI |AsuI* | || | Ksp632I* MboII | | || MnlI | | |BarI | | MnlI | Hpy178III* BmgT120I NlaIV E I L D P H D F G M K R Y I H F A N R L K S W T L T I S V * R G I S T S P T D * N L G P S R F R Y E E V Y P L R Q Q T N ----:----|----:----|----:----|----:----|----:----|----:----| S I K S G * S K P I F L Y I W K A L L S R F R P G E R N R Y S S T Y G S R W C V F D Q V R V I E T H L P I D V E G V S * MwoI | BccI | CviJI | | HinfI | | | SalI | | | |TaqI | | | |AccI | | | ||HindII | | | ||Hpy166II | | | ||| BsrI CviJI | | | ||| |PleI |BsrI | | | ||| ||MlyI BseGI \\ \ \ \ \\\ \\\ \ ACTGGCTGGAACGCCATCAAAGCCAGAGTCGACCAGTTGAACTTGAACTTGACGGATGAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCGACCTTGCGGTAGTTTCGGTCTCAGCTGGTCAACTTGAACTTGAACTGCCTACTG // / // //// / / |CviJI MwoI |BccI |||| PleI BseGI BsrI CviJI |||| MlyI |||SalI ||AccI ||TaqI ||BsrI |Hpy166II |HindII HinfI T G W N A I K A R V D Q L N L N L T D D L A G T P S K P E S T S * T * T * R M T W L E R H Q S Q S R P V E L E L D G * P ----:----|----:----|----:----|----:----|----:----|----:----| V P Q F A M L A L T S W N F K F K V S S L Q S S R W * L W L R G T S S S S S P H S A P V G D F G S D V L Q V Q V Q R I V MboI Hin4I Hpy188I Hin4I | DpnI | AluI | |HphI BsiYI* | BseYI | |BstKTI |FokI | CviJI | || Hin4I |TspGWI TaqII | | SetI | || | TaqI || MaeIII DdeI |MseI | | | GsaI | || | ClaI \\ \ \ \\ \ \ \ \ \ \\ \ \ CAAATCAAGGAAGTTACTGCTAAGATTAAGAAGCTGGGTGATGTCAGATCGCTGAATATC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGTTCCTTCAATGACGATTCTAATTCTTCGACCCACTACAGTCTAGCGACTTATAG / / / / / / / / / / / // / / | | FokI | | | | | | BseYI | || Hin4I Hin4I | TspGWI | | | | | CviJI | || MboI Hin4I BsiYI* | | | | | AluI | |HphI | | | | | GsaI | |DpnI | | | | SetI | BstKTI | | | MseI Hpy188I | | Hin4I | | Hin4I | TaqII | DdeI MaeIII Q I K E V T A K I K K L G D V R S L N I K S R K L L L R L R S W V M S D R * I S N Q G S Y C * D * E A G * C Q I A E Y R ----:----|----:----|----:----|----:----|----:----|----:----| W I L S T V A L I L F S P S T L D S F I G F * P L * Q * S * S A P H H * I A S Y L D L F N S S L N L L Q T I D S R Q I D SmlI | TatI Hin4I Bce83I* | |Csp6I Hin4I HindII Hpy178III* |BsiYI* | ||RsaI |MlyI Hpy166II | Hin4I || BseRI | ||ScaI |PleI |HinfI | | MnlI || | SetI | ||| MnlI \\ \\ \ \ \ \\ \ \ \ \\\ \ GATGATGTTGACTCTATCATCAAGAACTTCCACGCAGAGGTCAGCACTCCTCAAGTACTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACAACTGAGATAGTAGTTCTTGAAGGTGCGTCTCCAGTCGTGAGGAGTTCATGAT / // / / // / / // / /// | || | HinfI || | | |SetI | ||MnlI | || Hpy166II || | | BseRI | ||TatI | || HindII || | Bce83I* | |Csp6I | |PleI || | BsiYI* | ScaI | MlyI || MnlI | RsaI ClaI |Hpy178III* SmlI TaqI Hin4I D D V D S I I K N F H A E V S T P Q V L M M L T L S S R T S T Q R S A L L K Y Y * C * L Y H Q E L P R R G Q H S S S T I ----:----|----:----|----:----|----:----|----:----|----:----| S S T S E I M L F K W A S T L V G * T S R H H Q S * * * S S G R L P * C E E L V I I N V R D D L V E V C L D A S R L Y * CfrI MboII BtgZI | Csp6I | BalI AciI | |RsaI | CviJI | BccI | ||BetI* | HaeIII | |AciI | |||FokI | |BsrI | |BisI CviRI* | |||HpaII | || BseGI | ||BlsI \ \ \\\\ \ \\ \ \ \\\ TCTGCAAAAAAGAACAAGAAGAATGACAGCGATGTACCGGAACTGGCCACCATCCCCGCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGTTTTTTCTTGTTCTTCTTACTGTCGCTACATGGCCTTGACCGGTGGTAGGGGCGG / / // /// // / /// CviRI* MboII || ||| || BtgZI ||BisI || ||| || BseGI |BccI || ||| || CfrI |BlsI || ||| |HaeIII AciI || ||| |CviJI TauI || ||| |BalI || ||| BsrI || ||FokI || |BetI* || HpaII |Csp6I RsaI S A K K N K K N D S D V P E L A T I P A L Q K R T R R M T A M Y R N W P P S P P C K K E Q E E * Q R C T G T G H H P R R ----:----|----:----|----:----|----:----|----:----|----:----| D A F F F L F F S L S T G S S A V M G A I Q L F S C S S H C R H V P V P W W G R R C F L V L L I V A I Y R F Q G G D G G TauI | FokI | FauI | | BsiYI* | | |AciI | | || EciI | | || | DdeI | | || | |MwoI | | || | || CviJI | | || | || |BseGI | | || | || || AciI | | || | || || | BccI \ \ \\ \ \\ \\ \ \ GCCAAGCGGACTAAGCCATCCGCCTAA 1270 1280 ----:----|----:----|----:-- CGGTTCGCCTGATTCGGTAGGCGGATT // / /// // / / || | ||MwoI |CviJI | BccI || | |AciI BseGI AciI || | FokI DdeI || | EciI || FauI |BsiYI* AciI A K R T K P S A * P S G L S H P P X Q A D * A I R L X ----:----|----:----|----:-- A L R V L G D A * R W A S * A M R R G L P S L W G G L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 2 FblI,XmiI AciI 5 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AjuI 1 AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BceAI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 1 BseRI 2 BseYI 1 BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 8 BtgZI 2 BtsI 1 CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 11 CviKI-1 CviRI* 4 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 8 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 Eco57I 2 AcuI Eco57MI 2 EcoRII 1 AjnI,Psp6I,PspGI FatI 3 FauI 1 SmuI FokI 5 GsaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 3 Hin4II* 3 HpyAV HindII 6 HincII HinfI 5 HpaI 2 KspAI HpaII 3 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 7 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 3 SchI MmeI 1 MnlI 8 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PleI 3 PpsI PshAI 1 BstPAI,BoxI PsiI 1 AanI RsaI 3 AfaI SalI 2 ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 15 SexAI 1 MabI SfaNI 2 LweI SmlI 1 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 10 TaqII 1 TatI 2 TauI 2 TfiI 2 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI Tth111I 2 PflFI,PsyI,AspI XcmI 2 XhoII 1 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BbvCI BbvII* BcgI BglII BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI Cac8I Cfr10I Cfr9I CspCI DinI DraII DraIII Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FnuDII* FseI FspAI GlaI GsuI HaeII HgiAI* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769