Restriction Map of ENT1/YDL161W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ENT1/YDL161W on chromosome IV from coordinates 167714 to 169078.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.10569

Ksp632I* | BssKI | SecI* | EcoRII | | ScrFI MboI MboII | | BseBI BglII | MboII | | | AsuI* XhoII | | Csp6I | | | AvaII | DpnI ApoI | | |RsaI | | | DraII TaqI TspEI | |BstKTI TspEI | | || HphI | | | PpuMI \ \ \ \\ \ \ \ \\ \ \ \ \ \ ATGTCGAAACAATTTGTTAGATCTGCGAAGAATTTGGTGAAAGGGTACTCTTCTACCCAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCTTTGTTAAACAATCTAGACGCTTCTTAAACCACTTTCCCATGAGAAGATGGGTC / / // / / / / // //// TaqI TspEI || XhoII | | MboII |Csp6I |||BsiYI* || BglII | MboII |HphI |||SecI* || MboI TspEI RsaI |||PflMI |DpnI ApoI |||AlwNI BstKTI ||BseBI ||ScrFI |SetI Ksp632I* M S K Q F V R S A K N L V K G Y S S T Q C R N N L L D L R R I W * K G T L L P R V E T I C * I C E E F G E R V L F Y P G ----:----|----:----|----:----|----:----|----:----|----:----| X D F C N T L D A F F K T F P Y E E V W X T S V I Q * I Q S S N P S L T S K * G H R F L K N S R R L I Q H F P V R R G L BmgT120I |SetI |BssKI |EcoRII ||AlwNI MlyI ||PflMI CviRI* PleI ||BsiYI* | MaeII |StyI |||ScrFI | | SetI |SecI* MseI |||BseBI | | TaiI || HinfI |TspEI \\\\ \ \ \ \\ \ \\ GTCCTGGTAAGAAATGCAACGTCAAACGACAATCATCAAGTGTCCAAGGACTCGTTAATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGACCATTCTTTACGTTGCAGTTTGCTGTTAGTAGTTCACAGGTTCCTGAGCAATTAA /// / / / / / // / / / / ||| | EcoRII | | MaeII || | | | TspEI ||| | BssKI | TaiI || | | MseI ||| BseBI | SetI || | HinfI ||| ScrFI CviRI* || SecI* ||PpuMI || StyI ||DraII |PleI ||AvaII MlyI ||AsuI* |BmgT120I EcoRII BssKI V L V R N A T S N D N H Q V S K D S L I S W * E M Q R Q T T I I K C P R T R * L P G K K C N V K R Q S S S V Q G L V N * ----:----|----:----|----:----|----:----|----:----|----:----| T R T L F A V D F S L * * T D L S E N I P G P L F H L T L R C D D L T W P S T L D Q Y S I C R * V V I M L H G L V R * N AluI CviJI Hin6I FatI | SetI |GlaI |CviAII | Cac8I |MboII TaqI || NlaIII | | CviJI NdeI ||HhaI AsuII || |MslI \ \ \ \ \\\ \ \\ \\ GAGCTGGCTGAAAAATCATATGATAGCGCAGATTTCTTCGAAATCATGGATATGCTGGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGACCGACTTTTTAGTATACTATCGCGTCTAAAGAAGCTTTAGTACCTATACGACCTG / / / / / /// / / /// | | | CviJI NdeI ||Hin6I | | ||MslI | | Cac8I |GlaI | | |FatI | CviJI MboII | | CviAII | AluI HhaI | NlaIII SetI AsuII TaqI E L A E K S Y D S A D F F E I M D M L D S W L K N H M I A Q I S S K S W I C W T A G * K I I * * R R F L R N H G Y A G Q ----:----|----:----|----:----|----:----|----:----|----:----| S S A S F D Y S L A S K K S I M S I S S Q A P Q F I M H Y R L N R R F * P Y A P L Q S F F * I I A C I E E F D H I H Q V GsuI Eco57MI MseI MnlI BsrI | Tsp4CI* \ \ \ \ \ AAAAGACTTAACGACAAGGGCAAATACTGGAGGCATATCGCAAAGGCATTGACAGTAATA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTGAATTGCTGTTCCCGTTTATGACCTCCGTATAGCGTTTCCGTAACTGTCATTAT / / / / / MseI MnlI BsrI | Tsp4CI* Eco57MI GsuI K R L N D K G K Y W R H I A K A L T V I K D L T T R A N T G G I S Q R H * Q * * K T * R Q G Q I L E A Y R K G I D S N R ----:----|----:----|----:----|----:----|----:----|----:----| L L S L S L P L Y Q L C I A F A N V T I C F V * R C P C I S S A Y R L P M S L L F S K V V L A F V P P M D C L C Q C Y Y MboI BclI | DpnI | |BstKTI ApoI | || SetI TspEI TspEI \ \\ \ \ \ GATTACTTGATCAGGTTTGGTAGTGAGAATTGTGTTCTTTGGTGTAGAGAAAATTTATAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATGAACTAGTCCAAACCATCACTCTTAACACAAGAAACCACATCTCTTTTAAATATG // / / / || BclI TspEI TspEI || MboI ApoI || SetI |DpnI BstKTI D Y L I R F G S E N C V L W C R E N L Y I T * S G L V V R I V F F G V E K I Y T L L D Q V W * * E L C S L V * R K F I H ----:----|----:----|----:----|----:----|----:----|----:----| S * K I L N P L S F Q T R Q H L S F K Y L N S S * T Q Y H S N H E K T Y L F N I I V Q D P K T T L I T N K P T S F I * V MnlI BdaI | BsiI* MboI BdaI | | MnlI | DpnI | Hpy178III* | | | BdaI | |BstKTI | | Hin4II* XmnI | | | BdaI | || SetI \ \ \ \ \ \ \ \ \ \\ \ ATCATCAAGACATTGAAGGAGTTCAGGCACGAGGACGATGAGGGCATAGATCAAGGTCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAGTTCTGTAACTTCCTCAAGTCCGTGCTCCTGCTACTCCCGTATCTAGTTCCAGTT / / / / / / // // BdaI Hpy178III* | MnlI | BdaI || |SetI BdaI Hin4II* XmnI | BdaI || MboI BsiI* |DpnI MnlI BstKTI I I K T L K E F R H E D D E G I D Q G Q S S R H * R S S G T R T M R A * I K V K H Q D I E G V Q A R G R * G H R S R S N ----:----|----:----|----:----|----:----|----:----|----:----| M M L V N F S N L C S S S S P M S * P * C * * S M S P T * A R P R H P C L D L D D D L C Q L L E P V L V I L A Y I L T L TspEI CviRI* Hpy188I MnlI \ \ \ \ ATCGTTAGGGTCAAAGCAAAAGAATTGACTGCATTACTATCTGATGACGAAAGACTGAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCAATCCCAGTTTCGTTTTCTTAACTGACGTAATGATAGACTACTGCTTTCTGACTTG / / / / | CviRI* Hpy188I MnlI TspEI I V R V K A K E L T A L L S D D E R L N S L G S K Q K N * L H Y Y L M T K D * T R * G Q S K R I D C I T I * * R K T E R ----:----|----:----|----:----|----:----|----:----|----:----| I T L T L A F S N V A N S D S S S L S F F R * P * L L L I S Q M V I Q H R F V S D N P D F C F F Q S C * * R I V F S Q V FatI MboII |CviAII | MboII || NlaIII TspDTI MboII Hin4II* | | MboII \\ \ \ \ \ \ \ \ GAGGAAAGGAACATGAATATCAAGGGAAGAAACAGGAAAGGAAGAAGAAGAAGGGGAACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTTCCTTGTACTTATAGTTCCCTTCTTTGTCCTTTCCTTCTTCTTCTTCCCCTTGA / // / / / / / / | |FatI TspDTI MboII Hin4II* | | MboII | CviAII | MboII NlaIII MboII E E R N M N I K G R N R K G R R R R G T R K G T * I S R E E T G K E E E E G E L G K E H E Y Q G K K Q E R K K K K G N W ----:----|----:----|----:----|----:----|----:----|----:----| S S L F M F I L P L F L F P L L L L P V R P F S C S Y * P F F C S L F F F F P F L F P V H I D L S S V P F S S S S P S S BsrI CviJI Hin6I | BspMI |GlaI | | MwoI ||HhaI | | | NheI ||| BfiI | | | |MaeI SetI ||| | BtsI TspDTI | | | ||Cac8I |HindII ||| | TspRI | CviRI* | | | ||| BmtI |Hpy166II \\\ \ \ \ \ \ \ \ \\\ \ \\ GGGCGCAGTGATGAAAATGACGATGATTTGCAAAGAGCCATTAGTGCTAGCAGGTTGACG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGCGTCACTACTTTTACTGCTACTAAACGTTTCTCGGTAATCACGATCGTCCAACTGC / /// / / / / / / // //// / | ||| | BtsI | CviRI* | MwoI || |||SetI Hpy166II | ||| BfiI TspDTI CviJI || ||NheI HindII | ||Hin6I || |MaeI | |GlaI || Cac8I | TspRI |BmtI | HhaI BspMI BsrI G R S D E N D D D L Q R A I S A S R L T G A V M K M T M I C K E P L V L A G * R A Q * * K * R * F A K S H * C * Q V D G ----:----|----:----|----:----|----:----|----:----|----:----| P R L S S F S S S K C L A M L A L L N V Q A C H H F H R H N A F L W * H * C T S P A T I F I V I I Q L S G N T S A P Q R BceAI AluI BbvII* CviJI | EciI MnlI | SetI | MboII | MboII | | CviRI* AciI | | MboII | | MboII | | | TspDTI \ \ \ \ \ \ \ \ \ \ \ GCGGAAGAAGACGAAAGAAGAAGAAAACAGGACGAGGATTATGAAACAGCTTTGCAGTTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTCTTCTGCTTTCTTCTTCTTTTGTCCTGCTCCTAATACTTTGTCGAAACGTCAAC / /// / / / / / / / AciI ||| BbvII* | | MboII | | TspDTI ||| MboII | MboII | | CviRI* ||BceAI MnlI | CviJI |MboII | AluI EciI SetI A E E D E R R R K Q D E D Y E T A L Q L R K K T K E E E N R T R I M K Q L C S * G R R R K K K K T G R G L * N S F A V E ----:----|----:----|----:----|----:----|----:----|----:----| A S S S S L L L F C S S S * S V A K C N P P L L R F F F F V P R P N H F L K A T R F F V F S S S F L V L I I F C S Q L Q AluI CviJI |MboII CviRI* Ksp632I* ||SetI BseRI | BsmI |MnlI ||| MboII | CviRI* | | MwoI \\ \\\ \ \ \ \ \ \ AGCAAAGAAGAAGAGGAGCTAAAAAGATTGCAAGATTTACAAAGAATGCAACAACAGCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTTCTTCTTCTCCTCGATTTTTCTAACGTTCTAAATGTTTCTTACGTTGTTGTCGTT / / / / / / / / / | | | | | | CviRI* | MwoI | | | | | BseRI CviRI* | | | | MboII BsmI | | | MboII | | | CviJI | | | AluI | | SetI | Ksp632I* MnlI S K E E E E L K R L Q D L Q R M Q Q Q Q A K K K R S * K D C K I Y K E C N N S K Q R R R G A K K I A R F T K N A T T A R ----:----|----:----|----:----|----:----|----:----|----:----| L L S S S S S F L N C S K C L I C C C C S C L L L P A L F I A L N V F F A V V A A F F F L L * F S Q L I * L S H L L L L BseMII |BspCNI || MnlI MfeI || | Hpy178III* CviJI TspEI MaeIII || | |DdeI HaeIII | CviRI* SetI BstEII || | |SauI* \ \ \ \ \ \\ \ \\ GGCCAACAACAATTGCAACAACCTATGTATTATGATATTTTTGGTAACCCAATCACTCCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTGTTGTTAACGTTGTTGGATACATAATACTATAAAAACCATTGGGTTAGTGAGGA / // / // / / HaeIII || SetI || MnlI Hpy178III* CviJI |CviRI* |BspCNI TspEI BstEII MfeI MaeIII BseMII G Q Q Q L Q Q P M Y Y D I F G N P I T P A N N N C N N L C I M I F L V T Q S L L P T T I A T T Y V L * Y F W * P N H S * ----:----|----:----|----:----|----:----|----:----|----:----| P W C C N C C G I Y * S I K P L G I V G L G V V I A V V * T N H Y K Q Y G L * E A L L L Q L L R H I I I N K T V W D S R MfeI TspEI | CviRI* Tsp4CI* TspEI | | MwoI MwoI | CviRI* \ \ \ \ \ \ \ GAGGAATACGCACAATTTCAATTGCAACAACAGCAACAACAGCAACAACAACAGTTGCAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTATGCGTGTTAAAGTTAACGTTGTTGTCGTTGTTGTCGTTGTTGTTGTCAACGTT / / // / / / / SauI* TspEI || MwoI MwoI | CviRI* DdeI |CviRI* Tsp4CI* TspEI MfeI E E Y A Q F Q L Q Q Q Q Q Q Q Q Q Q L Q R N T H N F N C N N S N N S N N N S C N G I R T I S I A T T A T T A T T T V A T ----:----|----:----|----:----|----:----|----:----|----:----| S S Y A C N * N C C C C C C C C C C N C Q P I R V I E I A V V A V V A V V V T A L F V C L K L Q L L L L L L L L L L Q L TatI Hpy178III* |Csp6I | TfiI MboII ||RsaI | HinfI MaeI |Tsp4CI* \\\ \ \ \ \\ CAACAACCAATGTACTACGATGTATTCGGGAATCCTATAACACCCGAAGAACTAGCACAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTGGTTACATGATGCTACATAAGCCCTTAGGATATTGTGGGCTTCTTGATCGTGTC /// / / / // ||TatI | HinfI | |Tsp4CI* |Csp6I | TfiI | MboII RsaI Hpy178III* MaeI Q Q P M Y Y D V F G N P I T P E E L A Q N N Q C T T M Y S G I L * H P K N * H S T T N V L R C I R E S Y N T R R T S T V ----:----|----:----|----:----|----:----|----:----|----:----| C C G I Y * S T N P F G I V G S S S A C V V V L T S R H I R S D * L V R L V L V L L W H V V I Y E P I R Y C G F F * C L TatI Tsp4CI* |Csp6I ||RsaI ||ScaI CviRI* ||| DdeI | TseI ||| | AluI | MwoI ||| | CviJI | |BisI SfeI* ||| | | SetI | ||BlsI \ \\\ \ \ \ \ \\\ TTTCAACAACAACAACAACTACAGGAACAACAGTACTTAGCTTCTATGCAACAGCAGCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTTGTTGTTGTTGTTGATGTCCTTGTTGTCATGAATCGAAGATACGTTGTCGTCGTT / / /// /// / / /// SfeI* | ||| ||CviJI | | ||TseI | ||| ||AluI | | |BisI | ||| |DdeI | | BlsI | ||| SetI | MwoI | ||TatI CviRI* | |Csp6I | ScaI | RsaI Tsp4CI* F Q Q Q Q Q L Q E Q Q Y L A S M Q Q Q Q F N N N N N Y R N N S T * L L C N S S N S T T T T T T G T T V L S F Y A T A A T ----:----|----:----|----:----|----:----|----:----|----:----| N * C C C C S C S C C Y K A E I C C C C T E V V V V V V P V V T S L K * A V A A K L L L L L * L F L L V * S R H L L L L HphI AluI CviJI Ecl136II |SmlI ||SetI EcoP15I ||SduI | Bce83I* ||SacI | | PpiI ||HgiAI* | | | Hpy188I ||HgiJII* BbvI BsrDI | | | | MmeI ||| Hpy166II \ \ \ \ \ \ \ \\\ \ CAGGCAATGTCCAACAATCCATTTGCCAAATCAGAACAGAGCTCAAGTTCACCAAAACGG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCGTTACAGGTTGTTAGGTAAACGGTTTAGTCTTGTCTCGAGTTCAAGTGGTTTTGCC // // // /// / / / |BbvI || |MmeI ||| | | PpiI BsrDI || | ||| | Hpy166II || | ||| SmlI || | ||Ecl136II || | ||CviJI || | ||AluI || | |HphI || | HgiJII* || | HgiAI* || | SacI || | SduI || | SetI || Hpy188I |Bce83I* |PpiI EcoP15I Q A M S N N P F A K S E Q S S S S P K R R Q C P T I H L P N Q N R A Q V H Q N G G N V Q Q S I C Q I R T E L K F T K T E ----:----|----:----|----:----|----:----|----:----|----:----| C A I D L L G N A L D S C L E L E G F R V P L T W C D M Q W I L V S S L N V L V L C H G V I W K G F * F L A * T * W F P NlaIV |PpiI || SpeI || |MaeI || || MboII || || |TspGWI || || ||TseI || || |||BisI || || ||||BlsI || || |||||AluI || || |||||CviJI AlwNI || || |||||| SetI BbvI | CviRI* CviJI \\ \\ \\\\\\ \ \ \ \ \ AACCAACTAGTAGCAGCTTCTTCTCCACAGCAACTGCAACAACAAAAACAACAAGAGCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGTTGATCATCGTCGAAGAAGAGGTGTCGTTGACGTTGTTGTTTTTGTTGTTCTCGGT / // /// // / / NlaIV || ||CviJI |AlwNI CviRI* CviJI || ||TseI BbvI || ||AluI || |BisI || BlsI || SetI |TspGWI |MboII |SpeI MaeI N Q L V A A S S P Q Q L Q Q Q K Q Q E P T N * * Q L L L H S N C N N K N N K S H P T S S S F F S T A T A T T K T T R A I ----:----|----:----|----:----|----:----|----:----|----:----| F W S T A A E E G C C S C C C F C C S G S G V L L L K K E V A V A V V F V V L A V L * Y C S R R W L L Q L L L F L L L W TfiI HinfI | Hin4I Hin4I AluI | Hin4I Hin4I Hpy166II CviJI \ \ \ \ \ TTGATTCAAAACAGGACAGGCAATCAATCAATGACAGACAAGTATAGTAAACTAAACGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAAGTTTTGTCCTGTCCGTTAGTTAGTTACTGTCTGTTCATATCATTTGATTTGCTC / / / / / / | HinfI Hin4I Hpy166II | CviJI | TfiI Hin4I | AluI Hin4I SetI Hin4I L I Q N R T G N Q S M T D K Y S K L N E * F K T G Q A I N Q * Q T S I V N * T S D S K Q D R Q S I N D R Q V * * T K R A ----:----|----:----|----:----|----:----|----:----|----:----| N I * F L V P L * D I V S L Y L L S F S M S E F C S L C D I L S L C T Y Y V L R Q N L V P C A I L * H C V L I T F * V L SetI | MaeI SetI Hpy188I | | CviJI TsoI | MnlI CviJI \ \ \ \ \ \ \ CTACTAGCCACAGGAACAGGTATTGATACATTCGGAAATGTAGGGGAGGCTCGTATTCCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GATGATCGGTGTCCTTGTCCATAACTATGTAAGCCTTTACATCCCCTCCGAGCATAAGGA // / / / / / |CviJI | TsoI | MnlI CviJI MaeI SetI Hpy188I L L A T G T G I D T F G N V G E A R I P Y * P Q E Q V L I H S E M * G R L V F L T S H R N R Y * Y I R K C R G G S Y S C ----:----|----:----|----:----|----:----|----:----|----:----| S S A V P V P I S V N P F T P S A R I G A V L W L F L Y Q Y M R F H L P P E Y E * * G C S C T N I C E S I Y P L S T N R TspDTI | BbvII* | |Bce83I* TspEI | || MboII | SmlI \ \\ \ \ \ GCCCAACATACGAAGACAGGAACATTCATCAATTCTCAAGGAACAGGATATAGGCAAGTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGTTGTATGCTTCTGTCCTTGTAAGTAGTTAAGAGTTCCTTGTCCTATATCCGTTCAT / / / / / | | BbvII* | SmlI | | MboII TspEI | Bce83I* TspDTI A Q H T K T G T F I N S Q G T G Y R Q V P N I R R Q E H S S I L K E Q D I G K Y P T Y E D R N I H Q F S R N R I * A S I ----:----|----:----|----:----|----:----|----:----|----:----| A W C V F V P V N M L E * P V P Y L C T Q G V Y S S L F M * * N E L F L I Y A L G L M R L C S C E D I R L S C S I P L Y BinI* Tsp4CI* | Hpy188I | AccI | | MboI | |BssNAI | | | DpnI | |Hpy166II | | | |BseGI | || BcgI | | | |BstKTI | || | SetI | | | || TspGWI | || | |Hpy166II | | | || | FokI | || | || HgaI MaeI \ \ \ \\ \ \ \ \\ \ \\ \ \ TCGGATGATCCAAACCACAATCCGTTTTTGAACAGTCAGTATACAGGTTTACCAAGCACT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTACTAGGTTTGGTGTTAGGCAAAAACTTGTCAGTCATATGTCCAAATGGTTCGTGA / //// / / //// / / | |||MboI FokI Tsp4CI* |||SetI | HgaI | ||TspGWI ||BcgI Hpy166II | |DpnI |AccI | BstKTI Hpy166II | BseGI BssNAI Hpy188I BinI* S D D P N H N P F L N S Q Y T G L P S T R M I Q T T I R F * T V S I Q V Y Q A L G * S K P Q S V F E Q S V Y R F T K H * ----:----|----:----|----:----|----:----|----:----|----:----| D S S G F W L G N K F L * Y V P K G L V I P H D L G C D T K S C D T Y L N V L C R I I W V V I R K Q V T L I C T * W A S CviJI Csp6I | MaeIII Hpy99I BcgI | BstEII BsmAI |RsaI | CviJI | | BsrI | TsoI BsmAI \\ \ \ \ \ \ \ \ \ AGCGTCGTACCAACACAAACAGGCTATGGCTTTGGTAACCAGTCTCAACAGCAGTCTCAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCAGCATGGTTGTGTTTGTCCGATACCGAAACCATTGGTCAGAGTTGTCGTCAGAGTT // // / / / / / // || |Csp6I BcgI CviJI CviJI | BstEII |BsmAI || RsaI | MaeIII TsoI |Hpy99I BsrI MaeI S V V P T Q T G Y G F G N Q S Q Q Q S Q A S Y Q H K Q A M A L V T S L N S S L K R R T N T N R L W L W * P V S T A V S K ----:----|----:----|----:----|----:----|----:----|----:----| L T T G V C V P * P K P L W D * C C D * * R R V L V F L S H S Q Y G T E V A T E A D Y W C L C A I A K T V L R L L L R L BssKI |SecI* |HpaII ||ScrFI ||CauII* CviJI ||EcoP15I TspEI \ \\\ \ AATAATGGCTCAAATAACCGGGGATATACTCTAATTGATTTATGA 1330 1340 1350 1360 ----:----|----:----|----:----|----:----|----: TTATTACCGAGTTTATTGGCCCCTATATGAGATTAACTAAATACT / / /// / | CviJI ||BssKI TspEI BsmAI ||SecI* |EcoP15I CauII* HpaII ScrFI N N G S N N R G Y T L I D L * I M A Q I T G D I L * L I Y X * W L K * P G I Y S N * F M X ----:----|----:----|----:----|----:----|----: F L P E F L R P Y V R I S K H F Y H S L Y G P I Y E L Q N I I I A * I V P S I S * N I * S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AluI 7 AluBI AlwNI 2 CaiI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI Bce83I* 2 BpuEI BceAI 1 BcgI 1 BclI 1 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BmtI 1 BspOI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BseRI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 4 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 16 CviKI-1 CviRI* 11 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 4 MalI DraII 1 EcoO109I EciI 1 Ecl136II 1 EcoICRI Eco57MI 1 EcoP15I 2 EcoRII 2 AjnI,Psp6I,PspGI FatI 2 FokI 1 GlaI 2 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 4 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MfeI 2 MunI MlyI 1 SchI MmeI 1 MnlI 8 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI RsaI 4 AfaI SacI 1 Psp124BI,SstI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 15 SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 2 TatI 2 TfiI 2 PfeI TseI 2 ApeKI TsoI 2 Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BccI BciVI BetI* BglI BmeT110I BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BseYI BsgI BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BsrBI BstAPI BstXI BtgZI BtrI Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I Eco31I Eco47III Eco57I EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI HaeII HgiCI* HindIII HpaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SapI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769