Restriction Map of RPO21/YDL140C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

RPO21/YDL140C on chromosome IV from coordinates 210561 to 205360.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Csp6I |RsaI || MnlI || Tsp4CI* || | TaqII Tsp4CI* || | | AsuI* | MaeI || | | AvaII | | TspGWI || | | |BmgT120I | | | SduI || | | ||SetI | | | HgiAI* || | | ||| TspEI HphI \ \ \ \ \\ \ \ \\\ \ \ ATGGTAGGACAACAGTATTCTAGTGCTCCACTCCGTACAGTAAAAGAGGTCCAATTCGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATCCTGTTGTCATAAGATCACGAGGTGAGGCATGTCATTTTCTCCAGGTTAAGCCA / / // /// / / // / / | | |HgiAI* ||| | | || | HphI | | |SduI ||| | | || TspEI | | MaeI ||| | | |AvaII | TspGWI ||| | | |AsuI* Tsp4CI* ||| | | BmgT120I ||| | SetI ||| TaqII ||Tsp4CI* ||MnlI |Csp6I RsaI M V G Q Q Y S S A P L R T V K E V Q F G W * D N S I L V L H S V Q * K R S N S V G R T T V F * C S T P Y S K R G P I R S ----:----|----:----|----:----|----:----|----:----|----:----| X T P C C Y E L A G S R V T F S T W N P X P L V V T N * H E V G Y L L L P G I R H Y S L L I R T S W E T C Y F L D L E T Eco57I Eco57MI | CfrI | |TspRI | ||BalI | ||CviJI BsmAI SetI | ||HaeIII CspCI | CspCI MboII | ||| TspEI | Hpy178III* \ \ \ \ \\\ \ \ \ CTTTTCTCACCTGAAGAAGTTAGAGCAATCAGTGTGGCCAAAATTAGATTTCCAGAGACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAGAGTGGACTTCTTCAATCTCGTTAGTCACACCGGTTTTAATCTAAAGGTCTCTGT / / / / / / / / / // | CspCI | | | | CfrI | CspCI |Hpy178III* SetI | | | HaeIII TspEI BsmAI | | | CviJI | | | BalI | | Eco57MI | | Eco57I | TspRI MboII L F S P E E V R A I S V A K I R F P E T F S H L K K L E Q S V W P K L D F Q R Q F L T * R S * S N Q C G Q N * I S R D N ----:----|----:----|----:----|----:----|----:----|----:----| R K E G S S T L A I L T A L I L N G S V D K R V Q L L * L L * H P W F * I E L S K E * R F F N S C D T H G F N S K W L C StyI AvrII SecI* |MaeI || EcoNI FokI || | SetI | TspDTI || | BsiYI* BseGI | | TspEI || | | CviJI \ \ \ \ \\ \ \ \ ATGGATGAAACCCAGACGAGAGCGAAAATTGGTGGTCTAAACGACCCTAGGTTAGGCTCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTACTTTGGGTCTGCTCTCGCTTTTAACCACCAGATTTGCTGGGATCCAATCCGAGA / / / / //// / BseGI | FokI TspEI |||| CviJI TspDTI |||EcoNI ||SecI* ||AvrII ||StyI |BsiYI* |MaeI SetI M D E T Q T R A K I G G L N D P R L G S W M K P R R E R K L V V * T T L G * A L G * N P D E S E N W W S K R P * V R L Y ----:----|----:----|----:----|----:----|----:----|----:----| I S S V W V L A F I P P R F S G L N P E L P H F G S S L S F Q H D L R G * T L S H I F G L R S R F N T T * V V R P * A R BssKI MboI MnlI EcoRII | DpnI | Hpy178III* | ScrFI | |BstKTI | | Eco57I | BseBI | || BsaBI Hpy188I | | Eco57MI | | TspDTI \ \\ \ \ \ \ \ \ \ \ ATTGATCGTAATCTGAAGTGTCAAACTTGTCAAGAGGGTATGAACGAATGTCCTGGTCAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTAGCATTAGACTTCACAGTTTGAACAGTTCTCCCATACTTGCTTACAGGACCAGTA // // / / // // / || || Hpy188I MnlI |Hpy178III* || EcoRII || |BsaBI Eco57MI || BssKI || MboI Eco57I |BseBI |DpnI |ScrFI BstKTI TspDTI I D R N L K C Q T C Q E G M N E C P G H L I V I * S V K L V K R V * T N V L V I * S * S E V S N L S R G Y E R M S W S F ----:----|----:----|----:----|----:----|----:----|----:----| I S R L R F H * V Q * S P I F S H G P * * Q D Y D S T D F K D L P Y S R I D Q D N I T I Q L T L S T L L T H V F T R T M FatI MaeIII TspDTI |CviAII TspEI Tsp45I | SetI || NlaIII | MseI \ \ \ \\ \ \ \ TTTGGTCACATAGATTTAGCAAAACCTGTATTTCATGTTGGTTTTATTGCCAAAATTAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAGTGTATCTAAATCGTTTTGGACATAAAGTACAACCAAAATAACGGTTTTAATTC / / / / // // Tsp45I | SetI | |FatI |MseI MaeIII TspDTI | CviAII TspEI NlaIII F G H I D L A K P V F H V G F I A K I K L V T * I * Q N L Y F M L V L L P K L R W S H R F S K T C I S C W F Y C Q N * E ----:----|----:----|----:----|----:----|----:----|----:----| K P * M S K A F G T N * T P K I A L I L N Q D C L N L L V Q I E H Q N * Q W F * K T V Y I * C F R Y K M N T K N G F N L CviRI* | Tsp4CI* BplI | | TspRI BplI | | | AluI |FokI | | | CviJI BsrI |TspEI | | | | SetI | BseGI || BsmAI \ \ \ \ \ \ \ \\ \ AAAGTATGTGAGTGTGTCTGTATGCACTGTGGTAAGCTATTACTGGATGAACATAATGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCATACACTCACACAGACATACGTGACACCATTCGATAATGACCTACTTGTATTACTT / / / / / / / / / | | | | CviJI | | BplI TspDTI | | | | AluI | | BplI | | | SetI | BseGI | | Tsp4CI* BsrI | CviRI* TspRI K V C E C V C M H C G K L L L D E H N E K Y V S V S V C T V V S Y Y W M N I M N S M * V C L Y A L W * A I T G * T * * I ----:----|----:----|----:----|----:----|----:----|----:----| F T H S H T Q I C Q P L S N S S S C L S S L I H T H R Y A S H Y A I V P H V Y H F Y T L T D T H V T T L * * Q I F M I F SetI TspDTI | TseI | AluI BplI | |BisI MseI | CviJI BplI | ||BlsI VspI | | SetI | Tsp4CI* | |||CviRI* |TspDTI | | |MaeI | | BbvI | ||||TspEI \\ \ \ \\ \ \ \ \ \\\\\ TTAATGAGACAAGCTCTAGCAATCAAAGACAGTAAAAAAAGGTTTGCTGCAATTTGGACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AATTACTCTGTTCGAGATCGTTAGTTTCTGTCATTTTTTTCCAAACGACGTTAAACCTGA /// / / / / / / / / /// / ||| | | | MaeI BplI | | SetI ||| TspEI ||| | | CviJI BplI | BbvI ||CviRI* ||| | | AluI Tsp4CI* ||TseI ||| | SetI |BisI ||| TspDTI BlsI ||BsmAI |VspI |MseI TspEI FokI L M R Q A L A I K D S K K R F A A I W T * * D K L * Q S K T V K K G L L Q F G L N E T S S S N Q R Q * K K V C C N L D F ----:----|----:----|----:----|----:----|----:----|----:----| N I L C A R A I L S L L F L N A A I Q V I L S V L E L L * L C Y F F T Q Q L K S * H S L S * C D F V T F F P K S C N P S Hpy188I |BinI* || Hin4II* || |MboI || || DpnI || || |BstKTI || || || MboII || || || |DdeI BdaI || || || || AluI BslFI BdaI || || || || CviJI \ \ \\ \\ \\ \\ \ TTATGTAAAACAAAAATGGTCTGCGAAACAGATGTCCCTTCTGAAGATGATCCTACTCAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATACATTTTGTTTTTACCAGACGCTTTGTCTACAGGGAAGACTTCTACTAGGATGAGTC / / / / / // / / /// BslFI BdaI | | | || | | ||Eco57MI BdaI | | | || | | ||Eco57I | | | || | | ||CviJI | | | || | | ||AluI | | | || | | |DdeI | | | || | | SetI | | | || | MboII | | | || MboI | | | |DpnI | | | BstKTI | | Hin4II* | BinI* Hpy188I L C K T K M V C E T D V P S E D D P T Q Y V K Q K W S A K Q M S L L K M I L L S M * N K N G L R N R C P F * R * S Y S A ----:----|----:----|----:----|----:----|----:----|----:----| K H L V F I T Q S V S T G E S S S G V * K I Y F L F P R R F L H G K Q L H D * E * T F C F H D A F C I D R R F I I R S L SetI Eco57I Eco57MI | MnlI | | BspCNI | | |BseMII CviJI MmeI | | ||BdaI | TspEI | BseGI | | ||BdaI SetI | | BccI | | TspEI \ \ \\\ \ \ \ \ \ \ \ CTCGTATCAAGGGGAGGTTGTGGTAATACACAGCCTACAATTCGTAAGGATGGGTTGAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCATAGTTCCCCTCCAACACCATTATGTGTCGGATGTTAAGCATTCCTACCCAACTTT //// / / / / / / |||BdaI SetI CviJI | BccI | BseGI |||BdaI TspEI MmeI ||BseMII |BspCNI MnlI L V S R G G C G N T Q P T I R K D G L K S Y Q G E V V V I H S L Q F V R M G * N R I K G R L W * Y T A Y N S * G W V E I ----:----|----:----|----:----|----:----|----:----|----:----| S T D L P P Q P L V C G V I R L S P N F A R I L P L N H Y Y V A * L E Y P H T S E Y * P S T T T I C L R C N T L I P Q F SfaNI |CviJI DdeI ||SecI* AciI BseGI FokI FokI ||DsaI* | BseGI |FokI | TspDTI \ \\\ \ \ \\ \ \ TTAGTTGGTAGTTGGAAAAAAGATAGAGCCACGGGGGATGCGGATGAACCAGAACTAAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAACCATCAACCTTTTTTCTATCTCGGTGCCCCCTACGCCTACTTGGTCTTGATTCT / / / / / / / / / /// | FokI | | DsaI* | | BseGI | ||FokI TspEI | | SecI* | AciI | |DdeI | SfaNI BseGI | TspDTI CviJI FokI L V G S W K K D R A T G D A D E P E L R * L V V G K K I E P R G M R M N Q N * E S W * L E K R * S H G G C G * T R T K S ----:----|----:----|----:----|----:----|----:----|----:----| N T P L Q F F S L A V P S A S S G S S L I L Q Y N S F L Y L W P P H P H V L V L * N T T P F F I S G R P I R I F W F * S MseI BspCNI | MnlI Hpy178III* |BseMII | | Csp6I | TspGWI || SpeI | | |RsaI | | SspI MseI DdeI || |MaeI \ \ \\ \ \ \ \ \ \\ \\ GTTTTAAGTACGGAGGAAATCTTGAATATTTTTAAGCATATCTCAGTAAAAGACTTCACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATTCATGCCTCCTTTAGAACTTATAAAAATTCGTATAGAGTCATTTTCTGAAGTGA // // / / / / // || |Csp6I | SspI MseI DdeI |BseMII || RsaI Hpy178III* BspCNI |MseI TspGWI MnlI V L S T E E I L N I F K H I S V K D F T F * V R R K S * I F L S I S Q * K T S L F K Y G G N L E Y F * A Y L S K R L H * ----:----|----:----|----:----|----:----|----:----|----:----| T K L V S S I K F I K L C I E T F S K V L K L Y P P F R S Y K * A Y R L L L S * N * T R L F D Q I N K L M D * Y F V E S BseGI | MseI | BslFI | | FatI | | |CviAII | | ||FokI | | ||| NspI Hpy178III* | | ||| NlaIII \ \ \ \\\ \ AGTTTGGGTTTCAACGAAGTTTTTTCTCGTCCAGAATGGATGATTTTAACATGCCTTCCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAACCCAAAGTTGCTTCAAAAAAGAGCAGGTCTTACCTACTAAAATTGTACGGAAGGA // / / /// // / |SpeI | BseGI ||| || FokI MaeI Hpy178III* ||| |FatI ||| CviAII ||BslFI |NlaIII |NspI MseI S L G F N E V F S R P E W M I L T C L P V W V S T K F F L V Q N G * F * H A F L F G F Q R S F F S S R M D D F N M P S C ----:----|----:----|----:----|----:----|----:----|----:----| L K P K L S T K E R G S H I I K V H R G * N P N * R L K K E D L I S S K L M G E T Q T E V F N K R T W F P H N * C A K R Hin4II* | HgaI | | FokI | | | AgeI | | | BetI* TfiI | | | SgrAI HinfI | | | Cfr10I | Hin4II* TspDTI | | | |HpaII BseGI BccI | |MnlI MnlI |SetI \ \ \ \\ \ \ \ \\ \ \\ GTCCCACCACCACCGGTGCGTCCATCCATTTCCTTCAATGAATCTCAAAGAGGTGAGGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGGTGGTGGTGGCCACGCAGGTAGGTAAAGGAAGTTACTTAGAGTTTCTCCACTCCTA / // // / / /// / // Hin4II* || || BseGI BccI ||| | |TspDTI || |Cfr10I ||| | SetI || |SgrAI ||| MnlI || |BetI* ||HinfI || |AgeI ||TfiI || HpaII |MnlI |FokI Hin4II* HgaI V P P P P V R P S I S F N E S Q R G E D S H H H R C V H P F P S M N L K E V R M P T T T G A S I H F L Q * I S K R * G * ----:----|----:----|----:----|----:----|----:----|----:----| T G G G G T R G D M E K L S D * L P S S Q G V V V P A D M W K R * H I E F L H P D W W W R H T W G N G E I F R L S T L I MseI |AhaIII* SetI || AluI BseGI FokI || CviJI |MseI |MseI || | SetI AlfI |HphI ||AhaIII* || | | SspI AlfI MaeI \\ \\\ \\ \ \ \ \ \ GATTTAACCTTTAAACTTGCTGATATTTTAAAAGCTAATATTAGTTTGGAAACACTAGAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTGGAAATTTGAACGACTATAAAATTTTCGATTATAATCAAACCTTTGTGATCTC / / / /// // / / / / / | | MseI ||FokI || | | SspI AlfI MaeI | | SetI |MseI || | CviJI AlfI | HphI AhaIII* || | AluI BseGI || SetI |MseI AhaIII* D L T F K L A D I L K A N I S L E T L E I * P L N L L I F * K L I L V W K H * S F N L * T C * Y F K S * Y * F G N T R A ----:----|----:----|----:----|----:----|----:----|----:----| S K V K L S A S I K F A L I L K S V S S H N L R * V Q Q Y K L L * Y * N P F V L I * G K F K S I N * F S I N T Q F C * L MslI | Tsp4CI* | | SduI | | HgiAI* MboII | | | FatI | TspDTI | | | |CviAII | | TspEI | | | || NlaIII | | | FatI | | | || |AlfI | | | |CviAII | | | || |AlfI | | | || NlaIII \ \ \ \\ \\ \ \ \ \\ \ CATAACGGTGCTCCACATCATGCTATTGAAGAAGCAGAGAGTTTATTACAATTTCATGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTGCCACGAGGTGTAGTACGATAACTTCTTCGTCTCTCAAATAATGTTAAAGTACAA // / / // / / // // || HgiAI* | |FatI | TspDTI || |FatI || SduI | CviAII MboII || CviAII |Tsp4CI* | AlfI |NlaIII MslI | AlfI TspEI NlaIII H N G A P H H A I E E A E S L L Q F H V I T V L H I M L L K K Q R V Y Y N F M L * R C S T S C Y * R S R E F I T I S C C ----:----|----:----|----:----|----:----|----:----|----:----| C L P A G C * A I S S A S L K N C N * T A Y R H E V D H * Q L L L S N I V I E H M V T S W M M S N F F C L T * * L K M N AluI CviJI |BceAI ||SetI ||| BslFI ||| | SapI ||| | Ksp632I* ||| | | HpaII ||| | | |CfrI ||| | | |XmaIII* HindII ||| | | || CviJI MslI Hpy166II ||| | | || HaeIII | BstXI | MboII ||| | | || |McrI* \ \ \ \ \\\ \ \ \\ \\ GCCACTTATATGGATAATGATATTGCTGGTCAACCACAAGCTCTTCAAAAGTCCGGCCGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGAATATACCTATTACTATAACGACCAGTTGGTGTTCGAGAAGTTTTCAGGCCGGCA / / / / / / / / / // / | MslI | | | | | | | || XmaIII* BstXI | | | | | | | || CfrI | | | | | | | |HaeIII | | | | | | | |CviJI | | | | | | | HpaII | | | | | | | McrI* | | | | | | Ksp632I* | | | | | | SapI | | | | | BslFI | | | | BceAI | | | CviJI | | | AluI | | SetI | MboII Hpy166II HindII A T Y M D N D I A G Q P Q A L Q K S G R P L I W I M I L L V N H K L F K S P A V H L Y G * * Y C W S T T S S S K V R P S ----:----|----:----|----:----|----:----|----:----|----:----| A V * I S L S I A P * G C A R * F D P R Q W K Y P Y H Y Q Q D V V L E E F T R G G S I H I I I N S T L W L S K L L G A T Hpy188I SduI | SetI HgiAI* | TspEI MseI Hin4II* MnlI MnlI | | MseI \ \ \ \ \ \ \ CCCGTTAAATCTATTCGTGCTCGTTTGAAGGGTAAAGAGGGTCGTATCAGAGGTAATTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCAATTTAGATAAGCACGAGCAAACTTCCCATTTCTCCCAGCATAGTCTCCATTAAAT / / / / / / / / / MseI | Hin4II* MnlI MnlI | SetI | MseI HgiAI* Hpy188I TspEI SduI P V K S I R A R L K G K E G R I R G N L P L N L F V L V * R V K R V V S E V I * R * I Y S C S F E G * R G S Y Q R * F N ----:----|----:----|----:----|----:----|----:----|----:----| G T L D I R A R K F P L S P R I L P L K D R * I * E H E N S P Y L P D Y * L Y N G N F R N T S T Q L T F L T T D S T I * Tsp4CI* | BinI* | | MboI | | | DpnI | | | |BstKTI | | | || TspEI | | | || | HphI | | | || | | TspEI | | | || | | |AjuI \ \ \ \\ \ \ \\ ATGGGTAAGCGTGTGGATTTTTCGGCAAGAACTGTTATTTCTGGTGATCCTAATTTGGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATTCGCACACCTAAAAAGCCGTTCTTGACAATAAAGACCACTAGGATTAAACCTT / / // / // Tsp4CI* | || MboI |TspEI | |DpnI HphI | BstKTI AjuI BinI* M G K R V D F S A R T V I S G D P N L E W V S V W I F R Q E L L F L V I L I W N G * A C G F F G K N C Y F W * S * F G I ----:----|----:----|----:----|----:----|----:----|----:----| I P L R T S K E A L V T I E P S G L K S L P Y A H P N K P L F Q * K Q H D * N P H T L T H I K R C S S N N R T I R I Q F BsiYI* | MaeIII Tth111I AjuI MseI | Tsp45I \ \ \ \ \ TTAGACCAAGTCGGTGTTCCAAAATCTATTGCCAAGACTTTAACATACCCAGAAGTGGTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTGGTTCAGCCACAAGGTTTTAGATAACGGTTCTGAAATTGTATGGGTCTTCACCAG / / / / / TspEI Tth111I AjuI MseI BsiYI* L D Q V G V P K S I A K T L T Y P E V V * T K S V F Q N L L P R L * H T Q K W S R P S R C S K I Y C Q D F N I P R S G H ----:----|----:----|----:----|----:----|----:----|----:----| N S W T P T G F D I A L V K V Y G S T T I L G L R H E L I * Q W S K L M G L L P * V L D T N W F R N G L S * C V W F H D SduI HgiAI* |BssKI |SecI* AlfI || OliI MboI AlfI || MslI | DpnI AsuI* || HpaII | |BstKTI AvaII || ScrFI | || Hpy188I HgaI |BmgT120I || CauII* \ \\ \ \ \\ \\ \ ACACCATATAACATAGATCGTCTGACGCAACTTGTTAGGAATGGACCAAATGAGCACCCC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGTATATTGTATCTAGCAGACTGCGTTGAACAATCCTTACCTGGTTTACTCGTGGGG / // / / / / // / // Tsp45I || | Hpy188I | | |AvaII HgiAI* |CauII* MaeIII || MboI | | |AsuI* SduI |ScrFI |DpnI | | BmgT120I MslI BstKTI | AlfI OliI | AlfI HgaI T P Y N I D R L T Q L V R N G P N E H P H H I T * I V * R N L L G M D Q M S T P T I * H R S S D A T C * E W T K * A P R ----:----|----:----|----:----|----:----|----:----|----:----| V G Y L M S R R V C S T L F P G F S C G * V M Y C L D D S A V Q * S H V L H A G C W I V Y I T Q R L K N P I S W I L V G MaeII | SetI | TaiI | | AlfI | | AlfI | | | Hpy178III* | | | | BsmAI AarI HgiCI* | | | | Eco31I BspMI | NlaIV | | | | | AciI Tsp4CI* MseI Tsp4CI* \ \ \ \ \ \ \ \ \ \ \ GGTGCCAAATACGTCATTCGTGATAGCGGAGACCGTATAGATTTAAGATACAGTAAAAGG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGGTTTATGCAGTAAGCACTATCGCCTCTGGCATATCTAAATTCTATGTCATTTTCC /// / / / / / // / / / / ||| | | | AlfI | |AciI Tsp4CI* MseI | BspMI ||| | | | AlfI | Eco31I | AarI ||| | | MaeII | BsmAI Tsp4CI* ||| | TaiI Hpy178III* ||| | SetI ||| HgiCI* ||NlaIV |BssKI SecI* HpaII G A K Y V I R D S G D R I D L R Y S K R V P N T S F V I A E T V * I * D T V K G C Q I R H S * * R R P Y R F K I Q * K G ----:----|----:----|----:----|----:----|----:----|----:----| P A L Y T M R S L P S R I S K L Y L L L R H W I R * E H Y R L G Y L N L I C Y F T G F V D N T I A S V T Y I * S V T F P TspEI BinI* |TaqII MaeII | MboI || HphI | SetI | | DpnI SetI || | Tsp4CI* | TaiI | | |BstKTI \ \\ \ \ \ \ \ \ \\ GCAGGTGATATTCAATTACAGTATGGGTGGAAAGTTGAACGTCATATTATGGACAATGAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCACTATAAGTTAATGTCATACCCACCTTTCAACTTGCAGTATAATACCTGTTACTA / / / / / / / / // SetI | | | Tsp4CI* | MaeII | |DpnI | | TspEI TaiI | |BsrI | HphI SetI | BstKTI TaqII BinI* A G D I Q L Q Y G W K V E R H I M D N D Q V I F N Y S M G G K L N V I L W T M I R * Y S I T V W V E S * T S Y Y G Q * S ----:----|----:----|----:----|----:----|----:----|----:----| A P S I * N C Y P H F T S R * I I S L S P L H Y E I V T H T S L Q V D Y * P C H C T I N L * L I P P F N F T M N H V I I CviRI* | Hin4II* | | BccI | | | FatI | | | |CviAII | | | || NlaIII Tsp4CI* | | | || | AsuI* | HindII | | | || | |CviJI | Hpy166II | | | || | |HaeIII | | TstI | | | || | |BmgT120I BsrI | | | SetI | | | || | || TstI \ \ \ \ \ \ \ \ \\ \ \\ \ CCAGTTTTATTCAACCGTCAACCTTCGTTGCACAAAATGTCCATGATGGCCCACAGAGTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAAATAAGTTGGCAGTTGGAAGCAACGTGTTTTACAGGTACTACCGGGTGTCTCAT / / / // // // // /// MboI | | |SetI |Hin4II* || || ||AsuI* | | Hpy166II CviRI* || || |BmgT120I | | HindII || || HaeIII | TstI || || CviJI Tsp4CI* || || TstI || |FatI || CviAII |NlaIII BccI P V L F N R Q P S L H K M S M M A H R V Q F Y S T V N L R C T K C P * W P T E * S F I Q P S T F V A Q N V H D G P Q S K ----:----|----:----|----:----|----:----|----:----|----:----| G T K N L R * G E N C L I D M I A W L T D L K I * G D V K T A C F T W S P G C L W N * E V T L R R Q V F H G H H G V S Y TspGWI | ApoI | TspEI MaeIII \ \ \ AAAGTTATTCCATATTCTACATTTAGATTGAATTTGTCCGTTACATCTCCATACAATGCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAATAAGGTATAAGATGTAAATCTAACTTAAACAGGCAATGTAGAGGTATGTTACGG / / / TspGWI TspEI MaeIII ApoI K V I P Y S T F R L N L S V T S P Y N A K L F H I L H L D * I C P L H L H T M P S Y S I F Y I * I E F V R Y I S I Q C R ----:----|----:----|----:----|----:----|----:----|----:----| F T I G Y E V N L N F K D T V D G Y L A L L * E M N * M * I S N T R * M E M C H F N N W I R C K S Q I Q G N C R W V I G MaeIII MaeII Tsp45I | SetI Hpy99I | TaiI DdeI Tsp4CI* | BseMII |Hpy188I | MboII | |BspCNI || MnlI | | TfiI | ||TspDTI || | BspCNI | | HinfI | |||DdeI || | |BseMII TaqI | | |HphI | ||||MnlI || | || AciI \ \ \ \\ \ \\\\\ \\ \ \\ \ GATTTCGACGGTGACGAAATGAATCTTCACGTTCCTCAGTCTGAGGAAACAAGGGCGGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGCTGCCACTGCTTTACTTAGAAGTGCAAGGAGTCAGACTCCTTTGTTCCCGCCTT / / / / / / / /// / / / // // / | | | | | | | ||| | | | || |BseMII AciI | | | | | | | ||| | | | || BspCNI | | | | | | | ||| | | | |DdeI | | | | | | | ||| | | | MnlI | | | | | | | ||| | | Hpy188I | | | | | | | ||| | DdeI | | | | | | | ||| MnlI | | | | | | | ||TspDTI | | | | | | | |BspCNI | | | | | | | |MaeII | | | | | | | BseMII | | | | | | TaiI | | | | | | SetI | | | | | HinfI | | | | | TfiI | | | | HphI | | | Tsp45I | | | MaeIII | | | MboII | | Tsp4CI* | TaqI Hpy99I D F D G D E M N L H V P Q S E E T R A E I S T V T K * I F T F L S L R K Q G R N F R R * R N E S S R S S V * G N K G G T ----:----|----:----|----:----|----:----|----:----|----:----| S K S P S S I F R * T G * D S S V L A S R N R R H R F S D E R E E T Q P F L P P I E V T V F H I K V N R L R L F C P R F CviRI* | HphI TspEI | TspEI | EciI | | MnlI SetI \ \ \ \ \ \ CTTTCTCAATTATGTGCTGTTCCTCTGCAAATTGTTTCACCACAATCTAACAAACCTTGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGAGTTAATACACGACAAGGAGACGTTTAACAAAGTGGTGTTAGATTGTTTGGAACA / / // / / / / | TspEI || | TspEI SetI BsiYI* EciI || MnlI |HphI CviRI* L S Q L C A V P L Q I V S P Q S N K P C F L N Y V L F L C K L F H H N L T N L V F S I M C C S S A N C F T T I * Q T L Y ----:----|----:----|----:----|----:----|----:----|----:----| S E * N H A T G R C I T E G C D L L G Q V K E I I H Q E E A F Q K V V I * C V K K R L * T S N R Q L N N * W L R V F R T BsiYI* Hpy178III* Hpy166II MseI \ \ \ \ ATGGGTATTGTTCAAGATACTTTGTGTGGTATTCGTAAACTGACATTAAGAGATACATTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATAACAAGTTCTATGAAACACACCATAAGCATTTGACTGTAATTCTCTATGTAAA / / / Hpy178III* Hpy166II MseI M G I V Q D T L C G I R K L T L R D T F W V L F K I L C V V F V N * H * E I H L G Y C S R Y F V W Y S * T D I K R Y I Y ----:----|----:----|----:----|----:----|----:----|----:----| I P I T * S V K H P I R L S V N L S V N Y P Y Q E L Y K T H Y E Y V S M L L Y M H T N N L I S Q T T N T F Q C * S I C K MboI BclI NlaIV | DpnI | Hpy178III* | |BstKTI | | BccI BseGI \ \\ \ \ \ \ ATAGAACTTGATCAAGTTTTGAATATGCTTTATTGGGTTCCAGATTGGGATGGTGTTATT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTTGAACTAGTTCAAAACTTATACGAAATAACCCAAGGTCTAACCCTACCACAATAA // / / / / / || BclI | | BccI BseGI || MboI | Hpy178III* |DpnI NlaIV BstKTI I E L D Q V L N M L Y W V P D W D G V I * N L I K F * I C F I G F Q I G M V L F R T * S S F E Y A L L G S R L G W C Y S ----:----|----:----|----:----|----:----|----:----|----:----| I S S S * T K F I S * Q T G S Q S P T I * L V Q D L K S Y A K N P E L N P H H * Y F K I L N Q I H K I P N W I P I T N N FokI AsuI* |Hpy188I AvaII || SetI |BmgT120I || |CviRI* ||BetI* || ||TspEI |||HpaII || ||| AarI CviJI |||| Hpy166II || ||| BspMI | MmeI SetI |||| | TsoI \\ \\\ \ \ \ \ \\\\ \ \ CCGACACCTGCAATTATCAAGCCCAAACCTTTGTGGTCCGGTAAACAAATCTTGTCTGTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTGTGGACGTTAATAGTTCGGGTTTGGAAACACCAGGCCATTTGTTTAGAACAGACAC / / / / / / / / // // / / | FokI | | | | | SetI || || | TsoI | SetI | | | | MmeI || || Hpy166II Hpy188I | | | CviJI || |BetI* | | BspMI || HpaII | | AarI |AvaII | TspEI |AsuI* CviRI* BmgT120I P T P A I I K P K P L W S G K Q I L S V R H L Q L S S P N L C G P V N K S C L W D T C N Y Q A Q T F V V R * T N L V C G ----:----|----:----|----:----|----:----|----:----|----:----| G V G A I I L G L G K H D P L C I K D T E S V Q L * * A W V K T T R Y V F R T Q R C R C N D L G F R Q P G T F L D Q R H AclI MaeII | AlfI | AlfI | MnlI TspDTI | SetI SduI CviJI | Tsp4CI* | TaiI BseSI \ \ \ \ \ \ GCTATCCCAAACGGTATTCATTTACAACGTTTTGATGAGGGCACTACTCTGCTTTCTCCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAGGGTTTGCCATAAGTAAATGTTGCAAAACTACTCCCGTGATGAGACGAAAGAGGT / / / / // / | TspDTI Tsp4CI* | |MaeII BseSI CviJI | |AclI SduI | |MnlI | AlfI | AlfI TaiI SetI A I P N G I H L Q R F D E G T T L L S P L S Q T V F I Y N V L M R A L L C F L Q Y P K R Y S F T T F * * G H Y S A F S K ----:----|----:----|----:----|----:----|----:----|----:----| A I G F P I * K C R K S S P V V R S E G P * G L R Y E N V V N Q H P C * E A K E S D W V T N M * L T K I L A S S Q K R W AlfI AlfI Tsp4CI* \ \ AAGGATAATGGTATGCTTATTATTGACGGTCAAATCATTTTTGGTGTAGTAGAGAAAAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTATTACCATACGAATAATAACTGCCAGTTTAGTAAAAACCACATCATCTCTTTTTT / / AlfI Tsp4CI* AlfI K D N G M L I I D G Q I I F G V V E K K R I M V C L L L T V K S F L V * * R K K G * W Y A Y Y * R S N H F W C S R E K N ----:----|----:----|----:----|----:----|----:----|----:----| F S L P I S I I S P * I M K P T T S F F L P Y H Y A * * Q R D F * K Q H L L S F L I I T H K N N V T L D N K T Y Y L F F TspDTI | MnlI AsuI* | | MseI AvaII | | |TspEI DraII | | || FatI PpuMI | | || |CviAII |NlaIV | | || || NlaIII |BmgT120I Tsp4CI* | | || || | MaeIII || SmlI | NlaIV | | || || | | Bce83I* || |SetI \ \ \ \ \\ \\ \ \ \ \\ \\ ACCGTTGGTTCCTCCAATGGTGGTTTAATTCATGTTGTTACGAGAGAAAAGGGACCTCAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAACCAAGGAGGTTACCACCAAATTAAGTACAACAATGCTCTCTTTTCCCTGGAGTT / / / / / / // / / /// / | NlaIV | MnlI | | |FatI | MaeIII ||| SmlI Tsp4CI* TspDTI | | | Bce83I* ||PpuMI | | CviAII ||DraII | NlaIII ||AvaII | TspEI ||AsuI* MseI |BmgT120I NlaIV SetI T V G S S N G G L I H V V T R E K G P Q P L V P P M V V * F M L L R E K R D L K R W F L Q W W F N S C C Y E R K G T S S ----:----|----:----|----:----|----:----|----:----|----:----| V T P E E L P P K I * T T V L S F P G * F R Q N R W H H N L E H Q * S L F P V E G N T G G I T T * N M N N R S F L S R L TsoI | MseI | |HpaI MnlI | |HindII BslFI | |Hpy166II | DdeI MaeIII | || MaeIII \ \ \ \ \\ \ GTTTGTGCTAAGTTGTTTGGTAACATACAGAAAGTTGTTAACTTTTGGTTACTACATAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACACGATTCAACAAACCATTGTATGTCTTTCAACAATTGAAAACCAATGATGTATTA / / / / / // / MnlI | DdeI MaeIII TsoI |MseI MaeIII BslFI Hpy166II HindII HpaI V C A K L F G N I Q K V V N F W L L H N F V L S C L V T Y R K L L T F G Y Y I M L C * V V W * H T E S C * L L V T T * W ----:----|----:----|----:----|----:----|----:----|----:----| T Q A L N N P L M C F T T L K Q N S C L L K H * T T Q Y C V S L Q * S K T V V Y N T S L Q K T V Y L F N N V K P * * M I AsuI* |CviJI BsrDI |HaeIII BceAI | AciI |BmgT120I | TspEI SetI | HphI || MnlI | | BsmAI \ \ \ \\ \ \ \ \ GGGTTTTCAACAGGTATTGGTGATACCATTGCGGACGGCCCAACAATGAGGGAAATTACA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAAAAGTTGTCCATAACCACTATGGTAACGCCTGCCGGGTTGTTACTCCCTTTAATGT / / / / /// / / / SetI BsrDI | AciI ||AsuI* | | BsmAI HphI ||MnlI | TspEI |BmgT120I BceAI HaeIII CviJI G F S T G I G D T I A D G P T M R E I T G F Q Q V L V I P L R T A Q Q * G K L Q V F N R Y W * Y H C G R P N N E G N Y R ----:----|----:----|----:----|----:----|----:----|----:----| P N E V P I P S V M A S P G V I L S I V H T K L L Y Q H Y W Q P R G L L S P F * P K * C T N T I G N R V A W C H P F N C FokI | CviJI MfeI | |BssKI TspEI | |SecI* |MnlI | |EcoRII || CviRI* MaeIII | || ScrFI || | CviJI | BseGI | || BseBI \\ \ \ \ \ \ \\ \ GAGACAATTGCAGAGGCTAAAAAGAAAGTTTTGGATGTTACGAAAGAAGCCCAGGCAAAC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGTTAACGTCTCCGATTTTTCTTTCAAAACCTACAATGCTTTCTTCGGGTCCGTTTG / // / / / // /// | || CviJI | MaeIII || ||EcoRII | |CviRI* BseGI || ||BssKI | TspEI || |SecI* | MfeI || BseBI MnlI || ScrFI |FokI CviJI E T I A E A K K K V L D V T K E A Q A N R Q L Q R L K R K F W M L R K K P R Q T D N C R G * K E S F G C Y E R S P G K L ----:----|----:----|----:----|----:----|----:----|----:----| S V I A S A L F F T K S T V F S A W A F L S L Q L P * F S L K P H * S L L G P L L C N C L S F L F N Q I N R F F G L C V FatI |CviAII || MlyI || PleI AclI || |TspGWI MaeII || |NlaIII HinfI PleI | SetI || || HinfI | MnlI |MlyI | TaiI \\ \\ \ \ \ \\ \ \ TTATTGACTGCTAAACATGGTATGACTCTCCGTGAGTCTTTTGAGGATAACGTTGTTCGG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTGACGATTTGTACCATACTGAGAGGCACTCAGAAAACTCCTATTGCAACAAGCC / /// / / / / / / | ||FatI HinfI | HinfI PleI | MaeII | ||PleI MnlI MlyI | AclI | |CviAII TaiI | |MlyI SetI | TspGWI NlaIII L L T A K H G M T L R E S F E D N V V R Y * L L N M V * L S V S L L R I T L F G I D C * T W Y D S P * V F * G * R C S V ----:----|----:----|----:----|----:----|----:----|----:----| K N V A L C P I V R R S D K S S L T T R S I S Q * V H Y S E G H T K Q P Y R Q E * Q S S F M T H S E T L R K L I V N N P AluI CviJI Eco57I NlaIV BspMI TspDTI SetI | SetI TspEI Eco57MI \ \ \ \ \ \ \ \ TTCCTAAATGAAGCAAGAGATAAGGCAGGTCGTTTAGCTGAAGTCAATTTGAAAGATTTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGATTTACTTCGTTCTCTATTCCGTCCAGCAAATCGACTTCAGTTAAACTTTCTAAAC / // / / / / / NlaIV || SetI | CviJI TspEI Eco57MI |TspDTI | AluI Eco57I BspMI SetI F L N E A R D K A G R L A E V N L K D L S * M K Q E I R Q V V * L K S I * K I * P K * S K R * G R S F S * S Q F E R F E ----:----|----:----|----:----|----:----|----:----|----:----| N R F S A L S L A P R K A S T L K F S K T G L H L L L Y P L D N L Q L * N S L N E * I F C S I L C T T * S F D I Q F I Q TspDTI |SetI Hin6I |NlaIV FnuDII* || StyI MseI |GlaI TsoI BspMI || SecI* VspI ||HhaI \ \ \\ \ \ \\\ AACAATGTGAAACAAATGGTTATGGCAGGTTCCAAGGGTTCATTTATTAATATCGCGCAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTACACTTTGTTTACCAATACCGTCCAAGGTTCCCAAGTAAATAATTATAGCGCGTT / / // / / / /// TsoI BspMI || NlaIV SecI* VspI ||Hin6I |TspDTI StyI MseI |GlaI SetI FnuDII* HhaI N N V K Q M V M A G S K G S F I N I A Q T M * N K W L W Q V P R V H L L I S R K Q C E T N G Y G R F Q G F I Y * Y R A N ----:----|----:----|----:----|----:----|----:----|----:----| F L T F C I T I A P E L P E N I L I A C S C H S V F P * P L N W P N M * * Y R A V I H F L H N H C T G L T * K N I D R L SetI |Hpy166II AluI || MaeII CviJI || | SetI | SetI Hin4II* || | TaiI MboI \ \ \ \\ \ \ \ ATGTCAGCTTGTGTAGGACAGCAATCTGTTGAAGGTAAACGTATTGCTTTTGGGTTCGTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTCGAACACATCCTGTCGTTAGACAACTTCCATTTGCATAACGAAAACCCAAGCAA / / / / // / | CviJI Hin4II* SetI || MaeII | AluI |TaiI SetI |SetI Hpy166II M S A C V G Q Q S V E G K R I A F G F V C Q L V * D S N L L K V N V L L L G S L V S L C R T A I C * R * T Y C F W V R * ----:----|----:----|----:----|----:----|----:----|----:----| I D A Q T P C C D T S P L R I A K P N T F T L K H L V A I Q Q L Y V Y Q K Q T R H * S T Y S L L R N F T F T N S K P E N DpnI |BstKTI PleI || Csp6I SetI Hin4I || |RsaI | Hin4I |MlyI || || SetI | | MnlI HinfI || SetI \\ \\ \ \ \ \ \ \\ \ GATCGTACCTTACCTCATTTCTCTAAAGATGATTACTCCCCAGAGTCTAAAGGTTTTGTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCATGGAATGGAGTAAAGAGATTTCTACTAATGAGGGGTCTCAGATTTCCAAAACAA // / // / / / / / / || | || | Hin4I MnlI | | PleI || | || SetI | | MlyI || | |Csp6I | SetI || | RsaI Hin4I || | SetI HinfI || MboI |DpnI BstKTI D R T L P H F S K D D Y S P E S K G F V I V P Y L I S L K M I T P Q S L K V L L S Y L T S F L * R * L L P R V * R F C * ----:----|----:----|----:----|----:----|----:----|----:----| S R V K G * K E L S S * E G S D L P K T Q D Y R V E N R * L H N S G L T * L N Q I T G * R M E R F I I V G W L R F T K N TaqII | FatI | |CviAII | || CviRI* | || NlaIII | || | PflMI | || | BsiYI* | || | |XcmI ApoI | || | || BsrDI MnlI SetI TspEI | || | || | Hin4II* \ \ \ \ \\ \ \\ \ \ GAGAACTCATATTTGAGAGGTTTGACCCCACAAGAATTTTTTTTCCATGCAATGGGTGGT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTGAGTATAAACTCTCCAAACTGGGGTGTTCTTAAAAAAAAGGTACGTTACCCACCA / / / / / // / / / MnlI SetI | | | || | | Hin4II* | | | || | BsrDI | | | || XcmI | | | |CviRI* | | | |FatI | | | BsiYI* | | | CviAII | | | PflMI | | NlaIII | TaqII TspEI ApoI E N S Y L R G L T P Q E F F F H A M G G R T H I * E V * P H K N F F S M Q W V V E L I F E R F D P T R I F F P C N G W S ----:----|----:----|----:----|----:----|----:----|----:----| S F E Y K L P K V G C S N K K W A I P P Q S S M N S L N S G V L I K K G H L P H L V * I Q S T Q G W L F K K E M C H T T Hpy178III* MaeII | BceAI | SetI | |BaeI TaqI BaeI | TaiI | ||SetI ClaI AciI CviJI | SetI | | Hpy99I \ \\\ \ \ \ \ \ \ \ \ CGTGAAGGTCTTATCGATACCGCCGTCAAAACAGCCGAAACAGGTTATATTCAACGTCGT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GCACTTCCAGAATAGCTATGGCGGCAGTTTTGTCGGCTTTGTCCAATATAAGTTGCAGCA / / / / / / / / // / | | BceAI ClaI AciI | BaeI SetI || MaeII | SetI TaqI CviJI |Hpy99I Hpy178III* TaiI BaeI SetI R E G L I D T A V K T A E T G Y I Q R R V K V L S I P P S K Q P K Q V I F N V V * R S Y R Y R R Q N S R N R L Y S T S F ----:----|----:----|----:----|----:----|----:----|----:----| R S P R I S V A T L V A S V P * I * R R D H L D * R Y R R * F L R F L N Y E V D T F T K D I G G D F C G F C T I N L T T AluI CviJI | XbaI | SetI | |MaeI | |Hpy178III* | || TspDTI | || | EcoRV | || | | FatI | || | | |CviAII | || | | || NlaIII | || | | || |MboII \ \\ \ \ \\ \\ TTAGTGAAAGCTCTAGAAGATATCATGGTTCATTACGATAACACCACAAGAAACTCATTG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AATCACTTTCGAGATCTTCTATAGTACCAAGTAATGCTATTGTGGTGTTCTTTGAGTAAC / / /// / / // | | ||| | | |MboII | | ||| | | |FatI | | ||| | | CviAII | | ||| | NlaIII | | ||| EcoRV | | ||TspDTI | | |XbaI | | Hpy178III* | | MaeI | CviJI | AluI SetI L V K A L E D I M V H Y D N T T R N S L * * K L * K I S W F I T I T P Q E T H W S E S S R R Y H G S L R * H H K K L I G ----:----|----:----|----:----|----:----|----:----|----:----| K T F A R S S I M T * * S L V V L F E N N L S L E L L Y * P E N R Y C W L F S M * H F S * F I D H N M V I V G C S V * Q HphI | MboII | | TseI | | |BisI | | ||BlsI | | ||BseGI MaeIII | | |||Hin6I | AclI | | ||||GlaI | MaeII | | ||||MstI* | | SetI BbvI | | |||||HhaI | | TaiI BccI SfaNI | | |||||| FokI \ \ \ \ \ \ \ \\\\\\ \ GGTAACGTTATTCAGTTTATTTATGGTGAAGATGGTATGGATGCTGCGCATATTGAAAAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGCAATAAGTCAAATAAATACCACTTCTACCATACCTACGACGCGTATAACTTTTC / // / / / / ////// / | |MaeII BccI | | | |||||Hin6I FokI | |AclI | | | ||||MstI* | MaeIII | | | ||||GlaI TaiI | | | |||TseI SetI | | | |||HhaI | | | ||BisI | | | |BlsI | | | BseGI | | MboII | HphI SfaNI BbvI G N V I Q F I Y G E D G M D A A H I E K V T L F S L F M V K M V W M L R I L K S * R Y S V Y L W * R W Y G C C A Y * K A ----:----|----:----|----:----|----:----|----:----|----:----| P L T I * N I * P S S P I S A A C I S F P Y R * E T * K H H L H Y P H Q A Y Q F T V N N L K N I T F I T H I S R M N F L SfaNI | CviJI | |NlaIV | || Hpy188I | || | TseI | || | CviRI* | || | |BisI | || | ||BlsI | || | |||AluI | || | |||CviJI MaeI | || | |||| SetI BbvI \ \ \\ \ \\\\ \ \ CAATCGCTAGATACTATTGGTGGCTCCGATGCAGCTTTTGAAAAGAGATACAGAGTTGAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGCGATCTATGATAACCACCGAGGCTACGTCGAAAACTTTTCTCTATGTCTCAACTA / /// / //// / MaeI ||| | |||CviJI BbvI ||| | |||TseI ||| | |||AluI ||| | ||BisI ||| | |BlsI ||| | |SetI ||| | CviRI* ||| Hpy188I ||NlaIV |CviJI SfaNI Q S L D T I G G S D A A F E K R Y R V D N R * I L L V A P M Q L L K R D T E L I I A R Y Y W W L R C S F * K E I Q S * F ----:----|----:----|----:----|----:----|----:----|----:----| C D S S V I P P E S A A K S F L Y L T S A I A L Y * Q H S R H L K Q F S I C L Q L R * I S N T A G I C S K F L S V S N I MnlI |TfiI |HinfI ||BseMII |||BspCNI ||||BetI* ||||BspMII* |||||HpaII |||||Hpy178III* |||||| MboI |||||| XhoII |||||| | DpnI BinI* |||||| | |BstKTI | MboI |||||| | ||DdeI | | DpnI |||||| | |||Hpy188I | | |BstKTI |||||| | |||| BinI* \ \ \\ \\\\\\ \ \\\\ \ TTATTGAATACAGACCATACCCTTGATCCCTCACTATTGGAATCCGGATCTGAGATACTT 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTATGTCTGGTATGGGAACTAGGGAGTGATAACCTTAGGCCTAGACTCTATGAA / // / /// / /// / / / | || MboI ||| | ||| | | BinI* | |DpnI ||| | ||| | DdeI | BstKTI ||| | ||| Hpy188I BinI* ||| | ||| XhoII ||| | ||| MboI ||| | ||DpnI ||| | |BspMII* ||| | |BstKTI ||| | |BetI* ||| | Hpy178III* ||| | HpaII ||| HinfI ||| TfiI ||BspCNI |BseMII MnlI L L N T D H T L D P S L L E S G S E I L Y * I Q T I P L I P H Y W N P D L R Y L I E Y R P Y P * S L T I G I R I * D T W ----:----|----:----|----:----|----:----|----:----|----:----| K N F V S W V R S G E S N S D P D S I S N I S Y L G Y G Q D R V I P I R I Q S V * Q I C V M G K I G * * Q F G S R L Y K PfoI BssKI FokI EcoRII | TspEI MboI | ScrFI | MboII | DpnI | BseBI BseGI | |TspDTI | |BstKTI \ \ \ \ \\ \ \\ GGCGATTTGAAACTTCAAGTTCTCCTGGATGAAGAATACAAACAATTAGTGAAAGATCGT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTAAACTTTGAAGTTCAAGAGGACCTACTTCTTATGTTTGTTAATCACTTTCTAGCA / / / / / / // / | | BseGI | | TspEI || MboI | EcoRII | FokI |DpnI | BssKI TspDTI BstKTI | PfoI MboII BseBI ScrFI G D L K L Q V L L D E E Y K Q L V K D R A I * N F K F S W M K N T N N * * K I V R F E T S S S P G * R I Q T I S E R S * ----:----|----:----|----:----|----:----|----:----|----:----| P S K F S * T R R S S S Y L C N T F S R Q R N S V E L E G P H L I C V I L S L D A I Q F K L N E Q I F F V F L * H F I T CfrI HphI | BalI ApoI | CviJI TspEI | HaeIII HindII |MnlI BccI | |BsrI BsrI Hpy166II \\ \ \ \\ \ \ AAATTTTTGAGGGAAGTTTTTGTTGATGGTGAAGCAAACTGGCCATTACCAGTCAACATA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAAAACTCCCTTCAAAAACAACTACCACTTCGTTTGACCGGTAATGGTCAGTTGTAT / / / / // / / / | TspEI BccI | || | BsrI Hpy166II | ApoI | || CfrI HindII MnlI | |HaeIII | |CviJI | |BalI | BsrI HphI K F L R E V F V D G E A N W P L P V N I N F * G K F L L M V K Q T G H Y Q S T * I F E G S F C * W * S K L A I T S Q H K ----:----|----:----|----:----|----:----|----:----|----:----| L N K L S T K T S P S A F Q G N G T L M Y I K S P L K Q Q H H L L S A M V L * C F K Q P F N K N I T F C V P W * W D V Y MaeII MboI | SetI | DpnI Hpy188I | TaiI | |BstKTI | BccI \ \ \ \\ \ \ AGACGTATTATTCAAAATGCTCAACAAACTTTCCACATAGATCATACGAAACCATCTGAT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGCATAATAAGTTTTACGAGTTGTTTGAAAGGTGTATCTAGTATGCTTTGGTAGACTA / / // / / | MaeII || MboI Hpy188I TaiI |DpnI SetI BstKTI R R I I Q N A Q Q T F H I D H T K P S D D V L F K M L N K L S T * I I R N H L I T Y Y S K C S T N F P H R S Y E T I * F ----:----|----:----|----:----|----:----|----:----|----:----| L R I I * F A * C V K W M S * V F G D S L V Y * E F H E V F K G C L D Y S V M Q S T N N L I S L L S E V Y I M R F W R I MseI CviRI* \ \ TTAACAATCAAAGACATCGTTCTTGGTGTAAAGGATTTGCAAGAAAACTTATTAGTGTTG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTTAGTTTCTGTAGCAAGAACCACATTTCCTAAACGTTCTTTTGAATAATCACAAC / / / | MseI CviRI* BccI L T I K D I V L G V K D L Q E N L L V L * Q S K T S F L V * R I C K K T Y * C C N N Q R H R S W C K G F A R K L I S V A ----:----|----:----|----:----|----:----|----:----|----:----| K V I L S M T R P T F S K C S F K N T N N L L * L C R E Q H L P N A L F S I L T * C D F V D N K T Y L I Q L F V * * H Q TspDTI EcoP15I |SfaNI || BseYI CviRI* TspEI || | GsaI | MaeIII \ \\ \ \ \ \ CGTGGTAAGAATGAAATTATACAAAATGCCCAGCGAGATGCAGTTACATTGTTCTGCTGT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCATTCTTACTTTAATATGTTTTACGGGTCGCTCTACGTCAATGTAACAAGACGACA / / // / / / / TspEI | || | BseYI CviRI* MaeIII | || SfaNI | |GsaI | EcoP15I TspDTI R G K N E I I Q N A Q R D A V T L F C C V V R M K L Y K M P S E M Q L H C S A V W * E * N Y T K C P A R C S Y I V L L F ----:----|----:----|----:----|----:----|----:----|----:----| R P L F S I I C F A W R S A T V N N Q Q A H Y S H F * V F H G A L H L * M T R S T T L I F N Y L I G L S I C N C Q E A T CfrI | BalI | CviJI | HaeIII | | AflIII | | | MaeII MaeII | | | |BsaAI TatI | SetI | | | || SetI |Csp6I | TaiI | | | || TaiI ||RsaI \ \ \ \ \ \\ \ \\\ TTATTACGTTCCCGTTTGGCCACACGTAGAGTTCTACAAGAGTACAGACTAACAAAACAG 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATGCAAGGGCAAACCGGTGTGCATCTCAAGATGTTCTCATGTCTGATTGTTTTGTC / / / / / // /// / | MaeII | | | |AflIII ||TatI BsmI TaiI | | | |MaeII |Csp6I SetI | | | BsaAI RsaI | | TaiI | | SetI | CfrI HaeIII CviJI BalI L L R S R L A T R R V L Q E Y R L T K Q Y Y V P V W P H V E F Y K S T D * Q N R I T F P F G H T * S S T R V Q T N K T G ----:----|----:----|----:----|----:----|----:----|----:----| K N R E R K A V R L T R C S Y L S V F C N I V N G N P W V Y L E V L T C V L L V * * T G T Q G C T S N * L L V S * C F L HphI | MnlI | | BsaXI | | |Hpy166II | | ||TstI | | ||| BssKI | | ||| SecI* | | ||| EcoRII MnlI | | ||| | OliI | TstI | | ||| | MslI BsmI | BsaXI TspGWI | | ||| | ScrFI | TaqI MseI | | TaqI | TspEI | | ||| | BseBI \ \ \ \ \ \ \ \ \ \ \\\ \ \ GCATTCGATTGGGTATTAAGTAATATCGAGGCACAATTCCTCCGTTCTGTTGTTCACCCT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAGCTAACCCATAATTCATTATAGCTCCGTGTTAAGGAGGCAAGACAACAAGTGGGA / / / // / / / / / // TaqI | BsaXI |TspGWI TspEI | | | | |BseBI | MnlI TaqI | | | | |ScrFI MseI | | | | MslI TstI | | | | OliI | | | Hpy166II | | BsaXI | | TstI | MnlI HphI A F D W V L S N I E A Q F L R S V V H P H S I G Y * V I S R H N S S V L L F T L I R L G I K * Y R G T I P P F C C S P W ----:----|----:----|----:----|----:----|----:----|----:----| A N S Q T N L L I S A C N R R E T T * G P M R N P I L Y Y R P V I G G N Q Q E G C E I P Y * T I D L C L E E T R N N V R MaeI | TseI Hpy166II | |BisI | CviJI | ||BlsI BbvI | | HphI HphI | |||CviJI BstXI | | | MslI \ \ \\\\ \ \ \ \ \ GGTGAAATGGTTGGTGTTCTAGCAGCCCAATCCATTGGTGAACCAGCCACACAAATGACC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTTACCAACCACAAGATCGTCGGGTTAGGTAACCACTTGGTCGGTGTGTTTACTGG // / / /// / / / / / / |EcoRII HphI | ||| BstXI | | | | MslI |BssKI | ||CviJI | | | HphI SecI* | ||TseI | | CviJI | |BisI | Hpy166II | BlsI BbvI MaeI G E M V G V L A A Q S I G E P A T Q M T V K W L V F * Q P N P L V N Q P H K * P * N G W C S S S P I H W * T S H T N D P ----:----|----:----|----:----|----:----|----:----|----:----| P S I T P T R A A W D M P S G A V C I V Q H F P Q H E L L G I W Q H V L W V F S T F H N T N * C G L G N T F W G C L H G Hin4II* BslFI MseI SetI |BstXI MwoI | MaeIII \ \ \\ \ \ \ CTTAACACCTTCCATTTTGCTGGTGTTGCTTCCAAAAAAGTTACTTCTGGTGTCCCCCGT 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| GAATTGTGGAAGGTAAAACGACCACAACGAAGGTTTTTTCAATGAAGACCACAGGGGGCA / / / / / / / / | SetI | | MwoI | MaeIII BsiYI* MseI | Hin4II* BslFI BstXI L N T F H F A G V A S K K V T S G V P R L T P S I L L V L L P K K L L L V S P V * H L P F C W C C F Q K S Y F W C P P F ----:----|----:----|----:----|----:----|----:----|----:----| R L V K W K A P T A E L F T V E P T G R G * C R G N Q Q H Q K W F L * K Q H G G K V G E M K S T N S G F F N S R T D G T TspDTI | Hin4II* | |Tsp4CI* MseI | || AccI |AhaIII* CfrI | || |BssNAI ||BsiYI* | BalI FatI | || |Hpy166II ||| ApoI | CviJI |CviAII | || || DdeI ||| TspEI | HaeIII || NlaIII | || || | BbvI \\\ \ \ \ \\ \ \ \\ \\ \ \ TTAAAGGAAATTTTGAATGTGGCCAAAAACATGAAAACCCCTTCCTTGACTGTATACTTA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCCTTTAAAACTTACACCGGTTTTTGTACTTTTGGGGAAGGAACTGACATATGAAT // / / / / // / // // / |MseI TspEI | CfrI | |FatI | || |AccI DdeI AhaIII* ApoI HaeIII | CviAII | || Hpy166II CviJI NlaIII | || BssNAI BalI | |Tsp4CI* | Hin4II* TspDTI L K E I L N V A K N M K T P S L T V Y L * R K F * M W P K T * K P L P * L Y T * K G N F E C G Q K H E N P F L D C I L R ----:----|----:----|----:----|----:----|----:----|----:----| K F S I K F T A L F M F V G E K V T Y K N L P F K S H P W F C S F G K R S Q I S * L F N Q I H G F V H F G R G Q S Y V * BssKI CviJI EcoRII | ScrFI Hin4I | BseBI Hin4I | | FatI | MboI | | |CviAII | BclI | | || TseI | | DpnI | | || NlaIII | | |BstKTI | | || |BisI | | || MboI | | || ||BlsI | | || BglII | | || ||| MboI | | || XhoII | | || ||| | DpnI | | || Hpy188I | | || ||| | |BstKTI | | || | DpnI | | || ||| | ||Hpy178III* | | || | |BstKTI TaqI \ \ \\ \\\ \ \\\ \ \ \\ \ \\ \ GAGCCTGGTCATGCTGCCGATCAAGAACAAGCGAAGTTGATCAGATCTGCTATCGAGCAT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGACCAGTACGACGGCTAGTTCTTGTTCGCTTCAACTAGTCTAGACGATAGCTCGTA // / // ///// // / / / // / // / / || | || ||||| || | | Hin4I || | || XhoII TaqI || | || ||||| || | | Hin4I || | || BglII || | || ||||| || | Hpy178III* || | || MboI || | || ||||| || MboI || | |DpnI || | || ||||| |DpnI || | BstKTI || | || ||||| BstKTI || Hpy188I || | || ||||TseI || BclI || | || |||BisI || MboI || | || ||BlsI |DpnI || | || |FatI BstKTI || | || CviAII || | |NlaIII || | EcoRII || | BssKI || BseBI || ScrFI |BbvI CviJI E P G H A A D Q E Q A K L I R S A I E H S L V M L P I K N K R S * S D L L S S I A W S C C R S R T S E V D Q I C Y R A Y ----:----|----:----|----:----|----:----|----:----|----:----| S G P * A A S * S C A F N I L D A I S C L A Q D H Q R D L V L S T S * I Q * R A L R T M S G I L F L R L Q D S R S D L M Hpy188I | ApoI | TspEI | | BinI* | | | MboI | | | |BinI* | | | ||DpnI | | | |||BstKTI | | | ||||Hpy178III* MseI | | | |||||BsaBI Hin4I | | | ||||||MboI Hin4I | | | ||||||| DpnI |AhaIII* | | | ||||||| |TstI || Eco57I | | | ||||||| |BstKTI || Eco57MI | | | ||||||| || MaeII || | MaeIII | | | ||||||| || | SetI || | Tsp45I | | | ||||||| || | TaiI \\ \ \ \ \ \ \\\\\\\ \\ \ \ ACCACTTTAAAGAGTGTCACTATTGCTTCAGAAATTTACTATGATCCTGATCCACGTTCC 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGAAATTTCTCACAGTGATAACGAAGTCTTTAAATGATACTAGGACTAGGTGCAAGG / // / / / / // ///// // / Hin4I |Eco57MI Tsp45I | | | || ||||| || MaeII Hin4I |Eco57I MaeIII | | | || ||||| |TaiI |MseI | | | || ||||| |SetI AhaIII* | | | || ||||| MboI | | | || ||||DpnI | | | || |||BstKTI | | | || ||Hpy178III* | | | || |BsaBI | | | || MboI | | | || TstI | | | |BinI* | | | |DpnI | | | BstKTI | | BinI* | TspEI | ApoI Hpy188I T T L K S V T I A S E I Y Y D P D P R S P L * R V S L L L Q K F T M I L I H V P H F K E C H Y C F R N L L * S * S T F H ----:----|----:----|----:----|----:----|----:----|----:----| V V K F L T V I A E S I * * S G S G R E Y W K L S H * * Q K L F K S H D Q D V N G S * L T D S N S * F N V I I R I W T G TstI TspEI | MboII Ksp632I* | TspDTI |MnlI Tsp4CI* | | MboII || MmeI | Hpy178III* | | |TspDTI || | BseGI \ \ \ \ \\ \\ \ \ ACAGTTATTCCAGAAGATGAAGAAATTATCCAACTTCATTTCTCATTATTGGATGAAGAG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAATAAGGTCTTCTACTTCTTTAATAGGTTGAAGTAAAGAGTAATAACCTACTTCTC / / / // / / / // / Tsp4CI* | TstI || | TspDTI | || BseGI Hpy178III* || | MboII | |Ksp632I* || TspEI | MmeI |MboII MnlI TspDTI T V I P E D E E I I Q L H F S L L D E E Q L F Q K M K K L S N F I S H Y W M K R S Y S R R * R N Y P T S F L I I G * R G ----:----|----:----|----:----|----:----|----:----|----:----| V T I G S S S S I I W S * K E N N S S S W L * E L L H L F * G V E N R M I P H L C N N W F I F F N D L K M E * * Q I F L MaeII Hin4I Hin4I | SetI | TaiI | |Hpy178III* | || MboI | || | DpnI | || | BsrI CviJI | || | |BstKTI | FokI | || | || TseI | | Hin4I | || | || CviRI* | | Hin4I StyI | || | || |BisI | | MboII HphI SecI* | || | || |BinI* | | |TspDTI | TsoI | SetI | || | || ||BlsI \ \ \\ \ \ \ \ \ \\ \ \\ \\\ GCTGAACAATCTTTTGACCAACAATCACCTTGGTTATTACGTCTGGAACTGGATCGTGCA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTGTTAGAAAACTGGTTGTTAGTGGAACCAATAATGCAGACCTTGACCTAGCACGT // / / / / / / / / / / /// / /// || | FokI | TsoI SetI | | | | | ||| | ||BinI* || TspDTI HphI | | | | | ||| | ||BisI || MboII | | | | | ||| | |BlsI |Hin4I | | | | | ||| | CviRI* |Hin4I | | | | | ||| MboI CviJI | | | | | ||DpnI | | | | | |BstKTI | | | | | BsrI | | | | Hpy178III* | | | MaeII | | TaiI | | SetI | Hin4I | Hin4I SecI* StyI A E Q S F D Q Q S P W L L R L E L D R A L N N L L T N N H L G Y Y V W N W I V Q * T I F * P T I T L V I T S G T G S C S ----:----|----:----|----:----|----:----|----:----|----:----| A S C D K S W C D G Q N N R R S S S R A P Q V I K Q G V I V K T I V D P V P D H S F L R K V L L * R P * * T Q F Q I T C BsgI TfiI BsrDI | MseI HinfI | BbvI | TspDTI SetI | HphI \ \ \ \ \ \ \ GCAATGAATGATAAAGACTTAACAATGGGTCAGGTTGGTGAAAGAATCAAGCAAACATTC 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTACTTACTATTTCTGAATTGTTACCCAGTCCAACCACTTTCTTAGTTCGTTTGTAAG / / // / / / // TseI BsrDI || | MseI SetI |HphI || TspDTI HinfI |BsgI TfiI BbvI A M N D K D L T M G Q V G E R I K Q T F Q * M I K T * Q W V R L V K E S S K H S N E * * R L N N G S G W * K N Q A N I Q ----:----|----:----|----:----|----:----|----:----|----:----| A I F S L S K V I P * T P S L I L C V N L L S H Y L S L L P D P Q H F F * A F M C H I I F V * C H T L N T F S D L L C E BbvII* | FokI | | MboII | | | TspGWI | | | | MboI | | | | BclI | | | | Eco57I | | | | Eco57MI | | | | | DpnI | | | | | |BseGI Hpy188I | | | | | |BstKTI \ \ \ \ \ \ \\ AAAAATGATTTGTTTGTTATCTGGTCTGAAGACAACGATGAGAAGTTGATCATCCGTTGT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACTAAACAAACAATAGACCAGACTTCTGTTGCTACTCTTCAACTAGTAGGCAACA / / / / // / Hpy188I | | | || BclI | | | || MboI | | | |DpnI | | | BstKTI | | | BseGI | | Eco57MI | | Eco57I | TspGWI | FokI BbvII* MboII K N D L F V I W S E D N D E K L I I R C K M I C L L S G L K T T M R S * S S V V K * F V C Y L V * R Q R * E V D H P L S ----:----|----:----|----:----|----:----|----:----|----:----| L F S K N T I Q D S S L S S F N I M R Q * F H N T Q * R T Q L C R H S T S * G N F I I Q K N D P R F V V I L L Q D D T T SfaNI MboI | MaeIII | DpnI | Tsp45I | |BstKTI | | BseMII | || NdeI | | |BspCNI | || | MboII | | ||MaeI | || | |Eco57I | | ||| BsmAI | || | |Eco57MI | | ||| | DdeI | || | || MboII \ \ \\\ \ \ \ \\ \ \\ \ CGTGTTGTTCGTCCAAAGTCACTAGATGCTGAGACTGAAGCAGAAGAAGATCATATGTTG 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAACAAGCAGGTTTCAGTGATCTACGACTCTGACTTCGTCTTCTTCTAGTATACAAC // / / / / // / // / || | MaeI | DdeI || | || MboII || Tsp45I BsmAI || | |NdeI || MaeIII || | Eco57MI |BspCNI || | Eco57I |SfaNI || | MboII BseMII || MboI |DpnI BstKTI R V V R P K S L D A E T E A E E D H M L V L F V Q S H * M L R L K Q K K I I C * C C S S K V T R C * D * S R R R S Y V E ----:----|----:----|----:----|----:----|----:----|----:----| R T T R G F D S S A S V S A S S S * I N D H Q E D L T V L H Q S Q L L L L D Y T T N N T W L * * I S L S F C F F I M H Q MaeII |BsaAI || SetI TspEI MboII SspI || TaiI TaqI \ \ \ \\ \ \ AAGAAAATTGAGAACACAATGTTAGAGAATATTACATTACGTGGTGTAGAGAACATCGAG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTAACTCTTGTGTTACAATCTCTTATAATGTAATGCACCACATCTCTTGTAGCTC / / / / // / | MboII SspI | |MaeII TaqI TspEI | BsaAI TaiI SetI K K I E N T M L E N I T L R G V E N I E R K L R T Q C * R I L H Y V V * R T S S E N * E H N V R E Y Y I T W C R E H R A ----:----|----:----|----:----|----:----|----:----|----:----| F F I S F V I N S F I V N R P T S F M S S S F Q S C L T L S Y * M V H H L S C R L F N L V C H * L I N C * T T Y L V D L MaeII | MmeI FatI | MseI BspHI Tsp4CI* | SetI |CviAII | TspDTI | TaiI |Hpy178III* | | Csp6I | | HphI || NlaIII | | |RsaI BsrI | | | TaqII \\ \ \ \ \\ \ \ \ \ \ CGTGTTGTCATGATGAAATATGACCGTAAAGTACCAAGTCCAACTGGTGAATACGTTAAG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAACAGTACTACTTTATACTGGCATTTCATGGTTCAGGTTGACCACTTATGCAATTC / // / / // / / // // | |BspHI | | |Csp6I BsrI | || |TaqII | |FatI | | RsaI | || |MseI | Hpy178III* | TspDTI | || HphI | CviAII Tsp4CI* | |MaeII NlaIII | MmeI TaiI SetI R V V M M K Y D R K V P S P T G E Y V K V L S * * N M T V K Y Q V Q L V N T L R C C H D E I * P * S T K S N W * I R * G ----:----|----:----|----:----|----:----|----:----|----:----| R T T M I F Y S R L T G L G V P S Y T L A H Q * S S I H G Y L V L D L Q H I R * T N D H H F I V T F Y W T W S T F V N L Tsp4CI* MseI | BssKI NlaIV |HpaI | EcoRII | MmeI |HindII | | ScrFI | | SetI BccI |Hpy166II Hpy188I | | BseBI \ \ \ \ \\ \ \ \ \ GAACCTGAATGGGTGTTGGAAACAGATGGTGTTAACTTATCTGAAGTTATGACTGTTCCT 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGACTTACCCACAACCTTTGTCTACCACAATTGAATAGACTTCAATACTGACAAGGA / / // / / / NlaIV BccI |MseI Hpy188I | Eco57MI MmeI Hpy166II | Eco57I SetI HindII | BseBI HpaI | ScrFI Tsp4CI* E P E W V L E T D G V N L S E V M T V P N L N G C W K Q M V L T Y L K L * L F L T * M G V G N R W C * L I * S Y D C S W ----:----|----:----|----:----|----:----|----:----|----:----| S G S H T N S V S P T L K D S T I V T G P V Q I P T P F L H H * S I Q L * S Q E F R F P H Q F C I T N V * R F N H S N R Eco57I Eco57MI TfiI | TaqI HinfI TspDTI Hin4II* MaeI SetI \ \ \ \ \ \ \ GGTATCGACCCAACCAGAATCTATACCAACTCCTTCATTGATATAATGGAAGTTCTAGGT 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGCTGGGTTGGTCTTAGATATGGTTGAGGAAGTAACTATATTACCTTCAAGATCCA / / / / / // | TaqI | TspDTI Hin4II* |MaeI EcoRII HinfI SetI BssKI TfiI G I D P T R I Y T N S F I D I M E V L G V S T Q P E S I P T P S L I * W K F * V Y R P N Q N L Y Q L L H * Y N G S S R Y ----:----|----:----|----:----|----:----|----:----|----:----| P I S G V L I * V L E K M S I I S T R P Q Y R G L W F R Y W S R * Q Y L P L E L T D V W G S D I G V G E N I Y H F N * T AluI CviJI | SetI | | MwoI | | | TseI | | | CviRI* | | | |BisI | | | ||BlsI BsgI | | | |||CviJI BbvI |Hpy166II BccI Hpy188I \ \ \ \\\\ \ \\ \ \ ATTGAAGCTGGTCGTGCAGCCTTGTATAAAGAAGTTTACAATGTTATTGCTTCTGATGGT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTCGACCAGCACGTCGGAACATATTTCTTCAAATGTTACAATAACGAAGACTACCA / / / //// // / / / | | MwoI |||CviJI || Hpy166II | Hpy188I | CviJI |||TseI |BsgI BccI | AluI ||BisI BbvI SetI |BlsI CviRI* I E A G R A A L Y K E V Y N V I A S D G L K L V V Q P C I K K F T M L L L L M V * S W S C S L V * R S L Q C Y C F * W F ----:----|----:----|----:----|----:----|----:----|----:----| I S A P R A A K Y L S T * L T I A E S P Y Q L Q D H L R T Y L L K C H * Q K Q H N F S T T C G Q I F F N V I N N S R I T MseI |HpaI |HindII |Hpy166II || Tsp4CI* || | NdeI || | |BsiYI* StyI SetI || | || CviJI TaqI SecI* | CviJI \\ \ \\ \ \ \ \ \ TCGTATGTTAACTACCGTCATATGGCTTTGTTAGTCGATGTTATGACAACCCAAGGTGGC 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| AGCATACAATTGATGGCAGTATACCGAAACAATCAGCTACAATACTGTTGGGTTCCACCG // / / / / / / / / |MseI | | | CviJI TaqI | | CviJI | | | NdeI | SecI* | | BsiYI* | StyI | Tsp4CI* SetI Hpy166II HindII HpaI S Y V N Y R H M A L L V D V M T T Q G G R M L T T V I W L C * S M L * Q P K V A V C * L P S Y G F V S R C Y D N P R W L ----:----|----:----|----:----|----:----|----:----|----:----| E Y T L * R * I A K N T S T I V V W P P N T H * S G D Y P K T L R H * S L G L H R I N V V T M H S Q * D I N H C G L T A HgiCI* | SetI FatI MboI | NlaIV |CviAII | DpnI | | MseI MseI MaeIII || NlaIII | |BstKTI | | |TspDTI \ \ \\ \ \ \\ \ \ \\ TTAACTTCTGTTACTCGTCATGGTTTCAACAGATCAAATACAGGTGCCTTAATGAGATGT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGAAGACAATGAGCAGTACCAAAGTTGTCTAGTTTATGTCCACGGAATTACTCTACA / / / // // / / / // / MseI | | |FatI || MboI | | || MseI | | CviAII |DpnI | | |TspDTI | NlaIII BstKTI | | HgiCI* MaeIII | NlaIV SetI L T S V T R H G F N R S N T G A L M R C * L L L L V M V S T D Q I Q V P * * D V N F C Y S S W F Q Q I K Y R C L N E M F ----:----|----:----|----:----|----:----|----:----|----:----| K V E T V R * P K L L D F V P A K I L H S L K Q * E D H N * C I L Y L H R L S I * S R N S T M T E V S * I C T G * H S T Tsp4CI* | TaqI | | MboII AluI | | |ApoI Eco57I CviJI CviJI | | |TspEI Eco57MI | SetI | TspEI \ \ \\ \ \ \ \ \ TCATTTGAAGAAACTGTCGAAATTTTGTTTGAAGCTGGTGCTTCAGCCGAATTAGATGAT 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAACTTCTTTGACAGCTTTAAAACAAACTTCGACCACGAAGTCGGCTTAATCTACTA / // / / / / / | |TaqI Eco57MI | CviJI CviJI TspEI | MboII Eco57I | AluI Tsp4CI* TspEI SetI ApoI S F E E T V E I L F E A G A S A E L D D H L K K L S K F C L K L V L Q P N * M I I * R N C R N F V * S W C F S R I R * L ----:----|----:----|----:----|----:----|----:----|----:----| E N S S V T S I K N S A P A E A S N S S N M Q L F Q R F K T Q L Q H K L R I L H * K F F S D F N Q K F S T S * G F * I I Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV |||AgeI |||BetI* |||Cfr10I ||||KpnI CviJI ||||HpaII Hpy188I |NlaIV ||||| CviRI* \ \\ \\\\\ \ TGTCGTGGTGTTTCGGAAAATGTCATTCTTGGTCAAATGGCTCCAATCGGTACCGGTGCA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGCACCACAAAGCCTTTTACAGTAAGAACCAGTTTACCGAGGTTAGCCATGGCCACGT / // / /// // / Hpy188I |NlaIV | ||| || CviRI* CviJI | ||| |Cfr10I | ||| |BetI* | ||| |AgeI | ||| HpaII | ||HgiCI* | ||Acc65I | |Csp6I | NlaIV | RsaI KpnI C R G V S E N V I L G Q M A P I G T G A V V V F R K M S F L V K W L Q S V P V H S W C F G K C H S W S N G S N R Y R C I ----:----|----:----|----:----|----:----|----:----|----:----| Q R P T E S F T M R P * I A G I P V P A N D H H K P F H * E Q D F P E L R Y R H T T T N R F I D N K T L H S W D T G T C PleI |MlyI ||BsrI Hin4I ||TspRI Hin4I ||| BseRI | MboI ||| | FatI | |MnlI ||| | |Hin4I | ||DpnI ||| | |Hin4I | |||TaqI HinfI ||| | |CviAII | |||ClaI |MaeIII ||| | || NspI BseMII | |||BstKTI |Tsp45I ||| | || NlaIII |BspCNI DdeI \ \\\\ \\ \\\ \ \\ \ \\ \ TTTGATGTGATGATCGATGAGGAGTCACTGGTAAAATACATGCCAGAACAAAAAATAACT 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTACACTACTAGCTACTCCTCAGTGACCATTTTATGTACGGTCTTGTTTTTTATTGA / /// // / / / /// / / // // Hin4I ||| |ClaI | | | ||| | | |FatI |BspCNI Hin4I ||| |TaqI | | | ||| | | CviAII BseMII ||| MboI | | | ||| | NlaIII ||DpnI | | | ||| | NspI |BstKTI | | | ||| Hin4I MnlI | | | ||| Hin4I | | | ||BseRI | | | |PleI | | | |MlyI | | | BsrI | | Tsp45I | | MaeIII | HinfI TspRI F D V M I D E E S L V K Y M P E Q K I T L M * * S M R S H W * N T C Q N K K * L * C D D R * G V T G K I H A R T K N N * ----:----|----:----|----:----|----:----|----:----|----:----| N S T I I S S S D S T F Y M G S C F I V M Q H S S R H P T V P L I C A L V F F L K I H H D I L L * Q Y F V H W F L F Y S BccI AcyI |BbvII* TspGWI ||HgaI |MaeIII MaeIII ||| MboII |Tsp45I Tsp4CI* \\\ \ \\ \ GAGATTGAAGACGGACAAGATGGTGGCGTCACACCATACAGTAACGAAAGTGGTTTGGTC 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAACTTCTGCCTGTTCTACCACCGCAGTGTGGTATGTCATTGCTTTCACCAAACCAG / / / / / / / / / DdeI | | | | | Tsp45I | MaeIII | | | | | MaeIII Tsp4CI* | | | | AcyI | | | TspGWI | | HgaI | BbvII* | MboII BccI E I E D G Q D G G V T P Y S N E S G L V R L K T D K M V A S H H T V T K V V W S D * R R T R W W R H T I Q * R K W F G Q ----:----|----:----|----:----|----:----|----:----|----:----| S I S S P C S P P T V G Y L L S L P K T Q S Q L R V L H H R * V M C Y R F H N P L N F V S L I T A D C W V T V F T T Q D CviRI* | MboI | BglII | XhoII | | DpnI | | |BstKTI | | ||Hpy178III* | | ||| MaeII AluI | | ||| | MseI CviJI TfiI | | ||| | SetI | HphI HinfI | | ||| | TaiI | SetI SetI |MnlI \ \ \\\ \ \ \ \ \ \\ AATGCAGATCTTGACGTTAAAGATGAGCTAATGTTTTCACCTCTGGTTGATTCGGGTTCA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTCTAGAACTGCAATTTCTACTCGATTACAAAAGTGGAGACCAACTAAGCCCAAGT / // / // / / / // / / / | || | || | MseI | |HphI SetI | HinfI | || | || MaeII | CviJI | TfiI | || | |TaiI | AluI MnlI | || | |SetI SetI | || | Hpy178III* | || XhoII | || BglII | || MboI | |DpnI | BstKTI CviRI* N A D L D V K D E L M F S P L V D S G S M Q I L T L K M S * C F H L W L I R V Q C R S * R * R * A N V F T S G * F G F K ----:----|----:----|----:----|----:----|----:----|----:----| L A S R S T L S S S I N E G R T S E P E * H L D Q R * L H A L T K V E P Q N P N I C I K V N F I L * H K * R Q N I R T * SplI* |Csp6I ||RsaI MnlI ||| Tsp4CI* CviJI | HgaI ||| |GsuI | MaeII | CviJI ||| |Eco57MI | |BtrI \ \ \\\ \\ \ \\ AATGACGCTATGGCTGGAGGATTTACAGCGTACGGTGGTGCTGATTATGGTGAAGCCACG 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGCGATACCGACCTCCTAAATGTCGCATGCCACCACGACTAATACCACTTCGGTGC / / / /// / / // | | HgaI ||Eco57MI | | |MaeII | CviJI ||Tsp4CI* | | |HphI MnlI ||SplI* | | BtrI ||GsuI | TaiI |Csp6I | SetI RsaI CviJI N D A M A G G F T A Y G G A D Y G E A T M T L W L E D L Q R T V V L I M V K P R * R Y G W R I Y S V R W C * L W * S H V ----:----|----:----|----:----|----:----|----:----|----:----| F S A I A P P N V A Y P P A S * P S A V L H R * P Q L I * L T R H H Q N H H L W I V S H S S S K C R V T T S I I T F G R SetI |HphI ||Hin4I ||Hin4I ||| PfoI ||| BssKI ||| | HpaII BsmAI ||| | ScrFI |PleI SetI ||| | CauII* ||MlyI TaiI ||| | | BseRI |||BssKI HphI ||| | | |BsiYI* |||EcoRII | BsmAI ||| | | || HphI |||| ScrFI | Esp3I ||| | | || HinfI |||| BseBI \ \ \\\ \ \ \\ \ \\\\ \ TCTCCATTTGGTGCTTATGGTGAAGCACCTACATCTCCCGGATTTGGAGTCTCCTCACCA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGTAAACCACGAATACCACTTCGTGGATGTAGAGGGCCTAAACCTCAGAGGAGTGGT / // / /// / / / /// Esp3I || HphI ||| | HinfI | ||BseBI BsmAI |Hin4I ||| HphI | ||ScrFI |Hin4I ||BssKI | |Hin4I SetI ||PfoI | |Hin4I |BsiYI* | BsmAI |HpaII PleI |BseRI MlyI CauII* ScrFI S P F G A Y G E A P T S P G F G V S S P L H L V L M V K H L H L P D L E S P H Q S I W C L W * S T Y I S R I W S L L T R ----:----|----:----|----:----|----:----|----:----|----:----| D G N P A * P S A G V D G P N P T E E G T E M Q H K H H L V * M E R I Q L R R V R W K T S I T F C R C R G S K S D G * W MmeI | SetI | | HphI | | |BsaXI CviJI | | || MnlI |MnlI | | || Csp6I ||Hin4I GsuI | | || |RsaI ||Hin4I BsaXI Eco57MI | | || || HphI \\\ \ \ \ \ \\ \\ \ GGCTTTTCTCCAACTTCCCCAACATACTCTCCTACCTCTCCAGCGTACTCACCAACATCA 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAAAAGAGGTTGAAGGGGTTGTATGAGAGGATGGAGAGGTCGCATGAGTGGTTGTAGT / / / // // / // / EcoRII BsaXI Eco57MI |SetI || | || HphI BssKI GsuI MmeI || | |Csp6I CviJI || | RsaI MnlI || MnlI |HphI BsaXI G F S P T S P T Y S P T S P A Y S P T S A F L Q L P Q H T L L P L Q R T H Q H H L F S N F P N I L S Y L S S V L T N I T ----:----|----:----|----:----|----:----|----:----|----:----| P K E G V E G V Y E G V E G A Y E G V D L S K E L K G L M S E * R E L T S V L M A K R W S G W C V R R G R W R V * W C * HphI HphI | Csp6I | Csp6I Csp6I | |RsaI | |RsaI |RsaI | || BccI | || BccI || BccI | || | HphI | || | HphI || | HphI | || | | SetI \ \\ \ \ \\ \ \ \ \\ \ \ \ CCATCGTACTCACCAACATCACCATCGTACTCGCCAACATCACCATCGTACTCACCTACA 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGCATGAGTGGTTGTAGTGGTAGCATGAGCGGTTGTAGTGGTAGCATGAGTGGATGT / // / // / / // // HphI || BccI || BccI HphI || |SetI || HphI || HphI || BccI |Csp6I |Csp6I || HphI RsaI RsaI |Csp6I RsaI P S Y S P T S P S Y S P T S P S Y S P T H R T H Q H H H R T R Q H H H R T H L H I V L T N I T I V L A N I T I V L T Y I ----:----|----:----|----:----|----:----|----:----|----:----| G D Y E G V D G D Y E G V D G D Y E G V V M T S V L M V M T S A L M V M T S V * W R V * W C * W R V R W C * W R V * R C MaeII MaeII |MaeIII |MaeIII |Tsp45I |Tsp45I BccI || SetI BccI || SetI HphI | HphI || TaiI | HphI || TaiI BccI \ \ \ \\ \ \ \ \\ \ \ TCACCATCGTATTCACCAACGTCACCATCATATTCGCCAACGTCACCATCATATTCGCCA 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGTAGCATAAGTGGTTGCAGTGGTAGTATAAGCGGTTGCAGTGGTAGTATAAGCGGT / / / / / / / / / / / HphI BccI | | Tsp45I BccI | | Tsp45I BccI MwoI HphI | | MaeIII HphI | | MaeIII TaiI | MaeII | MaeII SetI TaiI TaiI SetI SetI S P S Y S P T S P S Y S P T S P S Y S P H H R I H Q R H H H I R Q R H H H I R Q T I V F T N V T I I F A N V T I I F A N ----:----|----:----|----:----|----:----|----:----|----:----| D G D Y E G V D G D Y E G V D G D Y E G M V M T N V L T V M M N A L T V M M N A * W R I * W R * W * I R W R * W * I R W MmeI MaeII MaeII MaeII | MwoI |MaeIII | MwoI | |SetI |Tsp45I | |SetI | |TaiI BccI || SetI AjuI | |TaiI | || Hpy99I | HphI || TaiI | BccI | || Hpy99I Hin4II* \ \\ \ \ \ \\ \ \ \ \ \\ \ \ ACGTCGCCATCGTATTCTCCAACGTCACCATCGTATTCGCCAACGTCGCCTTCCTACTCT 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGCGGTAGCATAAGAGGTTGCAGTGGTAGCATAAGCGGTTGCAGCGGAAGGATGAGA / / / / / / / /// / / / | MaeII BccI | | Tsp45I | ||| MaeII | AjuI Hpy99I HphI | | MaeIII | ||Hpy99I Hin4II* | | AjuI | |MwoI | MaeII | |TaiI TaiI | |SetI SetI | MmeI BccI T S P S Y S P T S P S Y S P T S P S Y S R R H R I L Q R H H R I R Q R R L P T L V A I V F S N V T I V F A N V A F L L S ----:----|----:----|----:----|----:----|----:----|----:----| V D G D Y E G V D G D Y E G V D G E * E L T A M T N E L T V M T N A L T A K R S R R W R I R W R * W R I R W R R R G V R MaeII |BtrI |AjuI || SetI || TaiI || | Hpy99I || | | AluI || | | CviJI || | | |SfeI* || | | ||SetI || | | ||| CviJI || | | ||| | MaeII || | | ||| | | SetI || | | ||| | | TaiI || | | ||| | | | BsmAI || | | ||| | | | Esp3I Hin4II* BccI \\ \ \ \\\ \ \ \ \ \ \ CCCACGTCGCCAAGCTACAGCCCTACGTCTCCTTCTTATTCTCCTACATCTCCATCATAC 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGCAGCGGTTCGATGTCGGGATGCAGAGGAAGAATAAGAGGATGTAGAGGTAGTATG //// / / // / / / / |||MaeII | | || | MaeII | Hin4II* ||BtrI | | || TaiI Esp3I |Hpy99I | | || SetI BsmAI TaiI | | |CviJI SetI | | SfeI* | CviJI | AluI SetI P T S P S Y S P T S P S Y S P T S P S Y P R R Q A T A L R L L L I L L H L H H T H V A K L Q P Y V S F L F S Y I S I I L ----:----|----:----|----:----|----:----|----:----|----:----| G V D G L * L G V D G E * E G V D G D Y E W T A L S C G * T E K K N E * M E M M G R R W A V A R R R R R I R R C R W * V MaeIII |GsuI |Eco57MI HphI || CviJI CviJI || | MaeII MaeII | MaeII || | | SetI |MaeIII | |MaeIII || | | TaiI |Tsp45I | |Tsp45I || | | | BsmAI || SetI | || SetI || | | | Esp3I HphI || TaiI MaeIII | || TaiI || | | | | CviJI \ \\ \ \ \ \\ \ \\ \ \ \ \ \ TCTCCTACGTCACCAAGTTACAGCCCAACGTCACCAAGTTACAGCCCAACGTCTCCAGCC 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGATGCAGTGGTTCAATGTCGGGTTGCAGTGGTTCAATGTCGGGTTGCAGAGGTCGG / / / / /// / / / / / / / / / / BccI | | Tsp45I ||| | | | | | | | MaeII | Esp3I HphI | | MaeIII ||| | | | | | | TaiI | BsmAI | MaeII ||| | | | | | | SetI CviJI TaiI ||| | | | | | CviJI SetI ||| | | | | MaeIII ||| | | | Eco57MI ||| | | | GsuI ||| | | Tsp45I ||| | | MaeIII ||| | MaeII ||| TaiI ||| SetI ||CviJI |HphI MaeIII S P T S P S Y S P T S P S Y S P T S P A L L R H Q V T A Q R H Q V T A Q R L Q P S Y V T K L Q P N V T K L Q P N V S S L ----:----|----:----|----:----|----:----|----:----|----:----| E G V D G L * L G V D G L * L G V D G A S E * T V L N C G L T V L N C G L T E L R R R * W T V A W R * W T V A W R R W G FokI | HphI HphI BtgZI TspDTI | Hin4II* BseGI \ \ \ \ \ \ TATTCCCCAACATCACCAAGTTATAGTCCTACATCGCCTTCATACTCTCCAACATCACCA 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGGGGTTGTAGTGGTTCAATATCAGGATGTAGCGGAAGTATGAGAGGTTGTAGTGGT / / / / / / / HphI BtgZI TspDTI | FokI | AjuI Hin4II* BseGI HphI Y S P T S P S Y S P T S P S Y S P T S P I P Q H H Q V I V L H R L H T L Q H H H F P N I T K L * S Y I A F I L S N I T I ----:----|----:----|----:----|----:----|----:----|----:----| * E G V D G L * L G V D G E Y E G V D G R N G L M V L N Y D * M A K M S E L M V I G W C * W T I T R C R R * V R W C * W MnlI AjuI Hin4II* SfeI* | BccI | AjuI | HphI | | HphI MmeI SetI | | SetI | CviJI \ \ \ \ \ \ \ \ \ \ TCCTATTCCCCAACATCACCTTCTTACTCTCCCACCTCTCCAAACTATAGCCCTACTTCA 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| AGGATAAGGGGTTGTAGTGGAAGAATGAGAGGGTGGAGAGGTTTGATATCGGGATGAAGT / / / / / / / // / | MmeI SetI | | SetI MnlI |CviJI SetI BccI | AjuI SfeI* HphI Hin4II* HphI S Y S P T S P S Y S P T S P N Y S P T S P I P Q H H L L T L P P L Q T I A L L H L F P N I T F L L S H L S K L * P Y F T ----:----|----:----|----:----|----:----|----:----|----:----| D * E G V D G E * E G V E G F * L G V E M R N G L M V K K S E W R E L S Y G * K G I G W C * R R V R G G R W V I A R S * BssKI EcoRII | ScrFI | BseBI | | CviJI | | |SfeI* | | || CviJI | | || |BssKI | | || |SecI* | | || |EcoRII | | || || ScrFI | | || || BseBI | | || || | MboI | | || || | XhoII SetI | | || || | | DpnI | GsuI | | || || | | |BstKTI | Eco57MI | | || || | | || BinI* | | Hin4II* | | || || | | || |CviRI* \ \ \ \ \ \\ \\ \ \ \\ \\ CCTTCTTACTCCCCAACATCTCCAGGCTACAGCCCAGGATCTCCTGCATATTCTCCAAAG 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGAATGAGGGGTTGTAGAGGTCCGATGTCGGGTCCTAGAGGACGTATAAGAGGTTTC / / / / // //// / / | Hin4II* | | || |||| | CviRI* Eco57MI | | || |||| | BinI* GsuI | | || |||| XhoII | | || |||| MboI | | || |||DpnI | | || ||EcoRII | | || ||BstKTI | | || ||BssKI | | || |SecI* | | || BseBI | | || ScrFI | | |CviJI | | SfeI* | EcoRII | BssKI | CviJI BseBI ScrFI P S Y S P T S P G Y S P G S P A Y S P K L L T P Q H L Q A T A Q D L L H I L Q S F L L P N I S R L Q P R I S C I F S K A ----:----|----:----|----:----|----:----|----:----|----:----| G E * E G V D G P * L G P D G A Y E G F V K K S G L M E L S C G L I E Q M N E L R R V G W C R W A V A W S R R C I R W L ApoI TspEI | TspDTI | Hpy178III* | | TspDTI \ \ \ CAAGACGAACAAAAGCATAATGAAAATGAAAATTCCAGATGA 5170 5180 5190 5200 ----:----|----:----|----:----|----:----|-- GTTCTGCTTGTTTTCGTATTACTTTTACTTTTAAGGTCTACT // / / || | TspDTI || Hpy178III* |TspEI |ApoI TspDTI Q D E Q K H N E N E N S R * K T N K S I M K M K I P D X R R T K A * * K * K F Q M X ----:----|----:----|----:----|----:----|-- C S S C F C L S F S F E L H A L R V F A Y H F H F N W I L V F L L M I F I F I G S S # Enzymes that cut Frequency Isoschizomers AarI 2 Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AclI 3 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AjuI 3 AlfI 6 AluI 13 AluBI ApoI 7 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 1 BalI 4 MlsI,MluNI,MscI,Msp20I BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 20 Bce83I* 1 BpuEI BceAI 3 BclI 3 FbaI,Ksp22I BdaI 2 BetI* 4 BsaWI BglII 2 BinI* 9 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 6 BplI 2 BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 2 BseBI 9 Bst2UI,BstNI,BstOI,MvaI BseGI 15 BstF5I,BtsCI BseMII 7 BseRI 2 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 2 BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 9 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 7 BspHI 1 CciI,PagI,RcaI BspMI 4 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 3 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 11 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 23 BstXI 3 BtgZI 1 BtrI 2 BmgBI,AjiI CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 5 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 11 CviQI,RsaNI CspCI 1 CviAII 14 CviJI 48 CviKI-1 CviRI* 15 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 23 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 9 AcuI Eco57MI 13 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 9 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 3 BsmBI FatI 14 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 15 GlaI 2 GsaI 1 GsuI 4 BpmI HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 15 HpyAV Hin6I 2 HinP1I,HspAI HindII 6 HincII HinfI 11 HpaI 3 KspAI HpaII 7 HapII,BsiSI,MspI HphI 36 AsuHPI Hpy166II 13 Hpy8I Hpy178III* 17 Hpy188III Hpy188I 15 Hpy99I 5 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 27 HpyCH4IV MaeIII 24 MboI 23 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 5 SchI MmeI 8 MnlI 30 MseI 28 Tru1I,Tru9I MslI 5 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 4 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 14 Hin1II,Hsp92II,FaeI NlaIV 11 BspLI,BmiI,PspN4I NspI 2 BstNSI,XceI OliI 2 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 2 PleI 5 PpsI PpuMI 1 Psp5II,PspPPI RsaI 11 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 11 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 79 SfaNI 5 LweI SfeI* 3 BstSFI,SfcI,BfmI SgrAI 1 SmlI 1 SmoI SpeI 1 BcuI,AhlI SplI* 1 Pfl23II,PspLI,BsiWI SspI 3 StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 27 TaqI 10 TaqII 4 TatI 1 TfiI 6 PfeI TseI 7 ApeKI TsoI 4 Tsp45I 12 NmuCI Tsp4CI* 22 HpyCH4III,TaaI,Bst4CI TspDTI 27 TspEI 33 TasI,Tsp509I,Sse9I TspGWI 7 TspRI 3 TscAI TstI 3 Tth111I 1 PflFI,PsyI,AspI VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AflII AloI AlwNI ApaI ApaLI AscI AsuII AvaI BamHI BarI BbvCI BcgI BciVI BfiI BglI BmeT110I BmtI Bpu10I BsePI BsiI* Bsp120I Bsp1407I BspLU11I* BspOI BsrBI BstAPI BstEII BtsI Cac8I Cfr9I DinI DraIII DrdI Eam1105I Ecl136II Eco47III EcoICRI EcoRI EcoT22I EgeI EheI EspI* FalI FauI FseI FspAI HaeII HgiJII* HindIII KasI MauBI MluI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* PacI PasI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrDI SmaI SnaBI SphI SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI XhoI XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769