Restriction Map of LYS21/YDL131W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

LYS21/YDL131W on chromosome IV from coordinates 227393 to 228715.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.17957

ApoI TspEI EcoRI | HphI | Hpy178III* | | MaeIII | | Tsp45I | | | BsaXI | | | Hin4I SpeI | | | | TfiI |MaeI | | | | HinfI || MaeIII Hpy188I | | | | | TaqI Hpy99I || | BsaXI \ \ \ \ \ \ \ \ \\ \ \ ATGTCTGAAAATAACGAATTCCAGAGTGTCACCGAATCGACGACTGCTCCAACCACTAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACTTTTATTGCTTAAGGTCTCACAGTGGCTTAGCTGCTGACGAGGTTGGTGATCA / / / / / / / / /// Hpy188I | | | | | | TaqI ||SpeI | | | | | Hpy99I |MaeI | | | | | HinfI Hin4I | | | | | TfiI BsaXI | | | | Tsp45I | | | | MaeIII | | | BsaXI | | Hin4I | Hpy178III* EcoRI TspEI ApoI HphI M S E N N E F Q S V T E S T T A P T T S C L K I T N S R V S P N R R L L Q P L V V * K * R I P E C H R I D D C S N H * * ----:----|----:----|----:----|----:----|----:----|----:----| X D S F L S N W L T V S D V V A G V V L X T Q F Y R I G S H * R I S S Q E L W * H R F I V F E L T D G F R R S S W G S T Hin4I | NdeI | | AsuI* | | |CviJI MseI | | |HaeIII | ApoI | | |BmgT120I | TspEI | | || MmeI | | Hin4I | | || | Hin4I | | Hin4I | | || | Hin4I AciI | | | BsrI \ \ \\ \ \ \ \ \ \ \ AACCCATATGGCCCAAATCCTGCGGATTATCTATCCAATGTTAAGAATTTCCAGTTGATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGTATACCGGGTTTAGGACGCCTAATAGATAGGTTACAATTCTTAAAGGTCAACTAA / / /// / / / | | ||AsuI* AciI Hin4I TspEI | | |BmgT120I Hin4I ApoI | | HaeIII MseI BsrI | | CviJI | | Hin4I | | Hin4I | | MmeI | NdeI MaeIII N P Y G P N P A D Y L S N V K N F Q L I T H M A Q I L R I I Y P M L R I S S * L P I W P K S C G L S I Q C * E F P V D * ----:----|----:----|----:----|----:----|----:----|----:----| L G Y P G F G A S * R D L T L F K W N I Y G M H G L D Q P N D I W H * S N G T S V W I A W I R R I I * G I N L I E L Q N Hpy166II HphI TfiI MnlI | AjuI | MboII HinfI |DdeI | TspEI | | BsmI TaqI AjuI \ \\ \ \ \ \ \ \ \ GATTCAACACTAAGAGAGGGTGAACAATTTGCCAACGCATTCTTCGATACTGAAAAAAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGTTGTGATTCTCTCCCACTTGTTAAACGGTTGCGTAAGAAGCTATGACTTTTTTTC / / / / / // / / / / | MnlI DdeI | | || | BsmI TaqI AjuI HinfI | | || MboII TfiI | | |HphI | | TspEI | Hpy166II AjuI D S T L R E G E Q F A N A F F D T E K K I Q H * E R V N N L P T H S S I L K K R F N T K R G * T I C Q R I L R Y * K K D ----:----|----:----|----:----|----:----|----:----|----:----| S E V S L S P S C N A L A N K S V S F F Q N L V L L P H V I Q W R M R R Y Q F F I * C * S L T F L K G V C E E I S F F L MseI |HpaI FokI |HindII CviJI | Hpy166II |Hpy166II |StyI | |BplI ||FokI TspEI MaeI |SecI* BseGI | |BplI TaqI ||| SetI \ \ \\ \ \ \\ \ \\\ \ ATTGAAATTGCTAGAGCCTTGGATGATTTCGGTGTGGACTACATCGAGTTAACCTCTCCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTAACGATCTCGGAACCTACTAAAGCCACACCTGATGTAGCTCAATTGGAGAGGG / / / / / / / / / // / | | | | BseGI | | FokI | || FokI | | | SecI* | Hpy166II | |MseI | | | StyI BplI | |SetI | | CviJI BplI | Hpy166II | MaeI | HindII TspEI | HpaI TaqI I E I A R A L D D F G V D Y I E L T S P L K L L E P W M I S V W T T S S * P L P * N C * S L G * F R C G L H R V N L S R ----:----|----:----|----:----|----:----|----:----|----:----| I S I A L A K S S K P T S * M S N V E G S Q F Q * L R P H N R H P S C R T L R E N F N S S G Q I I E T H V V D L * G R G MnlI Hpy166II |BseGI | SetI || BplI | |MseI || BplI Tsp4CI* | ||AhaIII* || Hpy188I | AluI | ||| BinI* || | SfaNI | CviJI | ||| |CviJI || | | Hpy178III* | | SetI | MaeI ||| |HaeIII \\ \ \ \ \ \ \ \ \ \\\ \\ GTAGCATCCGAACAATCAAGAAAGGACTGTGAAGCTATATGTAAACTAGGTTTAAAGGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CATCGTAGGCTTGTTAGTTCTTTCCTGACACTTCGATATACATTTGATCCAAATTTCCGG / / / / / / / / / // // / | | Hpy188I | | | | CviJI | |MaeI || HaeIII | BplI | | | | AluI | SetI || CviJI | BplI | | | SetI Hpy166II || BinI* BseGI | | Tsp4CI* |MseI MnlI | Hpy178III* AhaIII* SfaNI V A S E Q S R K D C E A I C K L G L K A * H P N N Q E R T V K L Y V N * V * R P S I R T I K K G L * S Y M * T R F K G Q ----:----|----:----|----:----|----:----|----:----|----:----| T A D S C D L F S Q S A I H L S P K F A R L M R V I L F P S H L * I Y V L N L P Y C G F L * S L V T F S Y T F * T * L G MaeIII Tsp45I | SfaNI HinfI MboI | | FatI | MwoI XhoII | | |CviAII | | BsmAI | DpnI | | || NlaIII | | | PleI PshAI | |BstKTI | | || |BceAI | | | |MlyI | BsrI \ \\ \ \ \\ \\ \ \ \ \\ \ \ AAGATCCTTACACACATTCGTTGTCACATGGACGATGCCAGAGTCGCCGTAGAGACTGGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGGAATGTGTGTAAGCAACAGTGTACCTGCTACGGTCTCAGCGGCATCTCTGACCA // / ///// / / / / / || XhoII ||||| BceAI | HinfI BsmAI PshAI || MboI ||||FatI MwoI PleI BsrI |DpnI |||CviAII MlyI BstKTI ||SfaNI |Tsp45I |MaeIII NlaIII K I L T H I R C H M D D A R V A V E T G R S L H T F V V T W T M P E S P * R L V D P Y T H S L S H G R C Q S R R R D W C ----:----|----:----|----:----|----:----|----:----|----:----| L I R V C M R Q * M S S A L T A T S V P W S G * V C E N D C P R H W L R R L S Q L D K C V N T T V H V I G S D G Y L S T SalI |TaqI |AccI HgiCI* ||HindII | NlaIV ||Hpy166II | | SetI SecI* ||| Hpy99I | | | ApoI DsaI* ||| Tsp4CI* | | | TspEI | Tsp4CI* ||| Tth111I | | | | MnlI | | BtgZI ||| | TaqI | | | | |MseI SspI | | BsiYI* \\\ \ \ \ \ \ \ \\ \ \ \ \ GTCGACGGTGTCGATGTTGTTATCGGCACCTCCAAATTTTTAAGACAATATTCCCACGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCTGCCACAGCTACAACAATAGCCGTGGAGGTTTAAAAATTCTGTTATAAGGGTGCCA ///// / / / / / / / // ||||| | TaqI | HgiCI* | MseI SspI |DsaI* ||||| Tth111I NlaIV TspEI |SecI* ||||Tsp4CI* SetI MnlI Tsp4CI* |||SalI ApoI BsiYI* ||AccI ||TaqI |Hpy166II |HindII Hpy99I V D G V D V V I G T S K F L R Q Y S H G S T V S M L L S A P P N F * D N I P T V R R C R C C Y R H L Q I F K T I F P R * ----:----|----:----|----:----|----:----|----:----|----:----| T S P T S T T I P V E L N K L C Y E W P H R R H R H Q * R C R W I K L V I N G R D V T D I N N D A G G F K * S L I G V T TspDTI ApoI | MwoI TspEI \ \ \ AAGGATATGAACTACATCGCCAAGAGTGCTGTTGAAGTCATTGAATTTGTCAAATCCAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTATACTTGATGTAGCGGTTCTCACGACAACTTCAGTAACTTAAACAGTTTAGGTTT / / / / / BtgZI | MwoI TspEI SetI TspDTI ApoI K D M N Y I A K S A V E V I E F V K S K R I * T T S P R V L L K S L N L S N P K G Y E L H R Q E C C * S H * I C Q I Q R ----:----|----:----|----:----|----:----|----:----|----:----| L S I F * M A L L A T S T M S N T L D L Y P Y S S C R W S H Q Q L * Q I Q * I W L I H V V D G L T S N F D N F K D F G F MboII Hpy188I | MboI | Hin4II* Hpy188I | | DpnI | Eco57I | | Eco57I | Eco57MI | | Eco57MI | | Hpy188I | | |BstKTI | | | TfiI | | || MboI | | | HinfI | | || | DpnI SetI | | | | MnlI | | || | |BstKTI \ \ \ \ \ \ \ \ \\ \ \\ GGTATTGAAATCAGATTTTCCTCTGAAGATTCCTTCAGAAGTGATCTCGTTGATCTTTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACTTTAGTCTAAAAGGAGACTTCTAAGGAAGTCTTCACTAGAGCAACTAGAAAAC / / / / / / //// / // / | | | | | | |||| MboI || MboI | | | | | | |||DpnI |DpnI | | | | | | ||BstKTI BstKTI | | | | | | |Eco57MI | | | | | | |Eco57I | | | | | | Hin4II* | | | | | Hpy188I | | | | | MboII | | | | HinfI | | | | TfiI | | | MnlI | | Hpy188I | Eco57MI | Eco57I Hpy188I G I E I R F S S E D S F R S D L V D L L V L K S D F P L K I P S E V I S L I F * Y * N Q I F L * R F L Q K * S R * S F E ----:----|----:----|----:----|----:----|----:----|----:----| P I S I L N E E S S E K L L S R T S R K L Y Q F * I K R Q L N R * F H D R Q D K T N F D S K G R F I G E S T I E N I K Q Tsp4CI* | HindII | Hpy166II | | MboI | | | DpnI HinfI PleI PsiI | | | |BstKTI |MmeI |MlyI Tsp4CI* \ \ \ \ \\ \\ \\ \ AACATTTATAAAACCGTTGACAAGATCGGTGTAAATAGAGTCGGTATTGCCGACACAGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAAATATTTTGGCAACTGTTCTAGCCACATTTATCTCAGCCATAACGGCTGTGTCAA / / / // / / / / / PsiI | | || MboI | HinfI PleI Tsp4CI* | | |DpnI MmeI MlyI | | BstKTI | Hpy166II | HindII Tsp4CI* N I Y K T V D K I G V N R V G I A D T V T F I K P L T R S V * I E S V L P T Q L H L * N R * Q D R C K * S R Y C R H S W ----:----|----:----|----:----|----:----|----:----|----:----| F M * L V T S L I P T F L T P I A S V T S C K Y F R Q C S R H L Y L R Y Q R C L V N I F G N V L D T Y I S D T N G V C N MboI BclI | DpnI | |BstKTI MboII | || Hpy188I |FatI | || | Ksp632I* ||CviAII BseGI FokI | || | |TspDTI |||BsmAI \ \ \ \\ \ \\ \\\\ GGATGTGCCAACCCAAGACAAGTATATGAACTGATCAGAACTTTGAAGAGTGTTGTCTCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCTACACGGTTGGGTTCTGTTCATATACTTGACTAGTCTTGAAACTTCTCACAACAGAGT / / // / / / / / BseGI FokI || | | Ksp632I* | NlaIII || | TspDTI MboII || Hpy188I || BclI || MboI |DpnI BstKTI G C A N P R Q V Y E L I R T L K S V V S D V P T Q D K Y M N * S E L * R V L S H M C Q P K T S I * T D Q N F E E C C L M ----:----|----:----|----:----|----:----|----:----|----:----| P H A L G L C T Y S S I L V K F L T T E Q I H W G L V L I H V S * F K S S H Q R S T G V W S L Y I F Q D S S Q L T N D * MaeIII AgeI Tsp45I BetI* |NlaIII Cfr10I BsrDI BtsI || TaqI BsmI |HpaII | CviRI* | MwoI \\ \ \ \\ \ \ \ \ TGTGACATCGAATGCCATTTCCACAATGATACCGGTTGTGCCATTGCAAACGCCTACACT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTGTAGCTTACGGTAAAGGTGTTACTATGGCCAACACGGTAACGTTTGCGGATGTGA // / / / / // / / // / || | | | BsmI || BsrDI CviRI* |MwoI Hin4II* || | | TaqI |Cfr10I TspRI || | Tsp45I |BetI* BtsI || | MaeIII |AgeI || BsmAI HpaII |FatI CviAII C D I E C H F H N D T G C A I A N A Y T V T S N A I S T M I P V V P L Q T P T L * H R M P F P Q * Y R L C H C K R L H C ----:----|----:----|----:----|----:----|----:----|----:----| H S M S H W K W L S V P Q A M A F A * V M H C R I G N G C H Y R N H W Q L R R C T V D F A M E V I I G T T G N C V G V S AcyI MaeII |ZraI || SetI || TaiI || AatII || | TatI || | |Csp6I || | |Hpy166II || | ||RsaI BdaI || | |||TspRI BdaI || | |||| BsrI SetI || | |||| | BdaI Hin4II* |HgiCI* || | |||| | BdaI | TspRI || NlaIV || | |||| | | BfiI BseRI \ \ \\ \ \\ \ \\\\ \ \ \ \ GCTTTGGAAGGTGGTGCCAGATTGATTGACGTCAGTGTACTGGGTATTGGTGAAAGAAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACCTTCCACCACGGTCTAACTAACTGCAGTCACATGACCCATAACCACTTTCTTTG / / / / / // //// / / / / / | BdaI | HgiCI* | |MaeII |||| | | BfiI | Tsp4CI* | BdaI NlaIV | |AcyI |||| | BdaI | HphI SetI | TspRI |||| | BdaI BseRI | ZraI |||| BsrI AatII |||TatI TaiI ||Csp6I SetI |RsaI Hpy166II A L E G G A R L I D V S V L G I G E R N L W K V V P D * L T S V Y W V L V K E T F G R W C Q I D * R Q C T G Y W * K K R ----:----|----:----|----:----|----:----|----:----|----:----| A K S P P A L N I S T L T S P I P S L F Q K P L H H W I S Q R * H V P Y Q H F F S Q F T T G S Q N V D T Y Q T N T F S V MaeI | BsiYI* | | SetI | | | MnlI | | | |CviJI | | | || FatI | | | || SduI AciI | | | || HgiJII* BisI HphI | | | || |CviAII |BlsI Tsp4CI* | | | || || NlaIII ||TauI Tth111I \ \ \ \ \\ \\ \ \\\ \ GGTATCACTCCTCTAGGTGGGCTCATGGCAAGAATGATTGTTGCCGCACCAGACTATGTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGTGAGGAGATCCACCCGAGTACCGTTCTTACTAACAACGGCGTGGTCTGATACAG /// / / / // //// / // ||| | | | |FatI |||AciI | |Hpy188I ||| | | | CviAII ||BisI | BsgI ||| | | NlaIII |BlsI Tth111I ||| | CviJI TauI ||| HgiJII* ||| MnlI ||| SduI ||MaeI |SetI BsiYI* G I T P L G G L M A R M I V A A P D Y V V S L L * V G S W Q E * L L P H Q T M S Y H S S R W A H G K N D C C R T R L C Q ----:----|----:----|----:----|----:----|----:----|----:----| P I V G R P P S M A L I I T A A G S * T R Y * E E L H A * P L F S Q Q R V L S H T D S R * T P E H C S H N N G C W V I D TseI AluI CviJI |BisI ||BlsI BsgI ||SetI MboI |||CviRI* BssKI BglII |||| MboI SexAI XhoII |||| BsmAI EcoRII Hpy188I |||| | DpnI |SfaNI |BbvI |||| | |BstKTI ||ScrFI ||DpnI |||| | || Hpy188I ||BseBI |||BstKTI |||| | || | TaqI |||SetI \\\\ \\\\ \ \\ \ \ \\\\ AGATCTAAATACAAGCTGCACAAGATCAGAGACATCGAAAACCTGGTCGCTGATGCTGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGATTTATGTTCGACGTGTTCTAGTCTCTGTAGCTTTTGGACCAGCGACTACGACAC // // / //// // / / / / / || |BbvI | |||| || Hpy188I | | | EcoRII || XhoII | |||| || BsmAI | | | SexAI || BglII | |||| || MboI | | | BssKI || MboI | |||| |DpnI | | | SfaNI |DpnI | |||| BstKTI | | BseBI BstKTI | |||CviRI* | | ScrFI | |||TseI | SetI | ||BisI TaqI | |BlsI | CviJI | AluI SetI R S K Y K L H K I R D I E N L V A D A V D L N T S C T R S E T S K T W S L M L W I * I Q A A Q D Q R H R K P G R * C C G ----:----|----:----|----:----|----:----|----:----|----:----| L D L Y L S C L I L S M S F R T A S A T * I * I C A A C S * L C R F G P R Q H Q S R F V L Q V L D S V D F V Q D S I S H BssKI MseI BsiYI* |HpaI |HpaII BsmI |HindII ||ScrFI CviRI* |Hpy166II HphI ||CauII* | BspMI \\ \ \\\ \ \ GAAGTTAACATTCCATTCAACAACCCTATCACCGGGTTCTGTGCATTCACACATAAAGCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAATTGTAAGGTAAGTTGTTGGGATAGTGGCCCAAGACACGTAAGTGTGTATTTCGT // / / / / / / / / |MseI HphI | | | | CviRI* BspMI SetI Hpy166II | | | BsmI HindII | | BssKI HpaI | CauII* | HpaII | ScrFI BsiYI* E V N I P F N N P I T G F C A F T H K A K L T F H S T T L S P G S V H S H I K Q S * H S I Q Q P Y H R V L C I H T * S R ----:----|----:----|----:----|----:----|----:----|----:----| S T L M G N L L G I V P N Q A N V C L A P L * C E M * C G * * R T R H M * V Y L F N V N W E V V R D G P E T C E C M F C SetI | FatI | |CviAII | || NlaIII | || |StyI | || |SecI* | || ||BsiYI* | || |||TsoI | || |||BciVI | || |||| CviJI | || |||| HaeIII AsuI* | || |||| | XcmI AvaII | || |||| | | BglI |BmgT120I | || |||| | | MwoI BccI ||NlaIV | || |||| | | | CviJI |SetI ||| Hpy178III* \ \\ \\\\ \ \ \ \ \\ \\\ \ GGTATCCATGCCAAGGCCATTTTGGCTAACCCATCTACCTACGAAATCTTGGACCCTCAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGGTACGGTTCCGGTAAAACCGATTGGGTAGATGGATGCTTTAGAACCTGGGAGTG / //// /// / / / / // / | |||| ||| MwoI CviJI | BccI |AvaII Hpy178III* | |||| ||| BglI SetI |AsuI* | |||| ||XcmI BmgT120I | |||| |HaeIII NlaIV | |||| |CviJI | |||| SecI* | |||| StyI | |||BciVI | ||TsoI | |FatI | BsiYI* | CviAII NlaIII G I H A K A I L A N P S T Y E I L D P H V S M P R P F W L T H L P T K S W T L T Y P C Q G H F G * P I Y L R N L G P S R ----:----|----:----|----:----|----:----|----:----|----:----| P I W A L A M K A L G D V * S I K S G * L Y G H W P W K P * G M * R R F R P G E T D M G L G N Q S V W R G V F D Q V R V MboII MnlI |TspDTI CviRI* | Ksp632I* || MmeI BsrI | BsmI \ \ \\ \ \ \ \ GATTTCGGTATGAAGAGATATATCCACTTCGCCAACAGACTAACTGGTTGGAATGCAATC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGCCATACTTCTCTATATAGGTGAAGCGGTTGTCTGATTGACCAACCTTACGTTAG / / / / / / MnlI Ksp632I* | MmeI BsrI CviRI* TspDTI BsmI MboII D F G M K R Y I H F A N R L T G W N A I I S V * R D I S T S P T D * L V G M Q S F R Y E E I Y P L R Q Q T N W L E C N Q ----:----|----:----|----:----|----:----|----:----|----:----| S K P I F L Y I W K A L L S V P Q F A I R N R Y S S I Y G S R W C V L Q N S H L I E T H L S I D V E G V S * S T P I C D Hpy178III* | HinfI | | SalI | | |TaqI | | |AccI | | ||HindII | | ||Hpy166II MboI FokI | | ||| MfeI Hin4I BclI TspGWI | | ||| PleI Hin4I | DpnI | MaeIII | | ||| TspEI | ApoI | |BseGI | | Hin4I | | ||| |MlyI | TspEI | |BstKTI | | Hin4I \ \ \\\ \\ \ \ \ \\ \ \ \ AAATCAAGAGTCGACCAATTGAACTTGAATTTGACGGATGATCAAATCAAGGAAGTTACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTTCTCAGCTGGTTAACTTGAACTTAAACTGCCTACTAGTTTAGTTCCTTCAATGA / //// / // / // / / / / / | |||| | |TspEI TspEI || | | | FokI MaeIII | |||| | |MfeI ApoI || | | Hin4I | |||| | Hin4I || | | Hin4I | |||| | Hin4I || | TspGWI | |||| PleI || BclI | |||| MlyI || MboI | |||SalI |DpnI | ||AccI BstKTI | ||TaqI BseGI | |Hpy166II | |HindII | HinfI Hpy178III* K S R V D Q L N L N L T D D Q I K E V T N Q E S T N * T * I * R M I K S R K L L I K S R P I E L E F D G * S N Q G S Y C ----:----|----:----|----:----|----:----|----:----|----:----| L D L T S W N F K F K V S S * I L S T V * I L L R G I S S S N S P H D F * P L * F * S D V L Q V Q I Q R I I L D L F N S AluI MlyI BseYI PleI CviJI Hpy188I | AccI TaqII | SetI | AciI Hin4I | |Hpy166II DdeI |MseI | | GsaI | HphI | SspI | ||HinfI \ \\ \ \ \ \ \ \ \ \ \\\ GCTAAGATTAAGAAGCTGGGTGATGTCAGACCGCTAAATATTGATGATGTAGACTCCATT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTCTAATTCTTCGACCCACTACAGTCTGGCGATTTATAACTACTACATCTGAGGTAA / / / / / / / // / // // / | | | | BseYI | | |AciI SspI || || HinfI | | | CviJI | | Hin4I || |AccI | | | AluI | HphI || Hpy166II | | | GsaI Hpy188I |PleI | | SetI MlyI | MseI TaqII DdeI A K I K K L G D V R P L N I D D V D S I L R L R S W V M S D R * I L M M * T P L * D * E A G * C Q T A K Y * * C R L H Y ----:----|----:----|----:----|----:----|----:----|----:----| A L I L F S P S T L G S F I S S T S E M Q * S * S A P H H * V A L Y Q H H L S W S L N L L Q T I D S R * I N I I Y V G N Hin4I | FatI | |CviAII | || CviRI* MseI | || NlaIII SduI |AhaIII* Csp6I | || | TspEI HgiAI* || BsrI |RsaI \ \\ \ \ \ \\ \ \\ ATCAAGGACTTCCATGCAGAATTGAGCACCCCACTTTTAAAACCAGTAAATAAGGGTACA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCCTGAAGGTACGTCTTAACTCGTGGGGTGAAAATTTTGGTCATTTATTCCCATGT / / // // // / // Hin4I | |CviRI* |HgiAI* || BsrI |Csp6I | |FatI |SduI |MseI RsaI | CviAII TspEI AhaIII* NlaIII I K D F H A E L S T P L L K P V N K G T S R T S M Q N * A P H F * N Q * I R V Q Q G L P C R I E H P T F K T S K * G Y R ----:----|----:----|----:----|----:----|----:----|----:----| I L S K W A S N L V G S K F G T F L P V * * P S G H L I S C G V K L V L L Y P Y D L V E M C F Q A G W K * F W Y I L T C FatI MaeIII |CviAII Tsp45I TaqI || NspI BstEII ClaI || NlaIII HphI | SetI \ \\ \ \ \ \ GATGACGACAATATCGATATTTCCAATGGGCATGTTTCTAAAAAGGCAAAGGTCACCAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCTGTTATAGCTATAAAGGTTACCCGTACAAAGATTTTTCCGTTTCCAGTGGTTT / / // / / / ClaI | |FatI HphI SetI BstEII TaqI | CviAII Tsp45I NlaIII MaeIII NspI D D D N I D I S N G H V S K K A K V T K M T T I S I F P M G M F L K R Q R S P N * R Q Y R Y F Q W A C F * K G K G H Q I ----:----|----:----|----:----|----:----|----:----|----:----| S S S L I S I E L P C T E L F A F T V L L H R C Y R Y K W H A H K * F P L P * W I V V I D I N G I P M N R F L C L D G F TAG --- ATC * X X --- Y I L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AluI 3 AluBI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BccI 1 BceAI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BplI 2 BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseRI 1 BseYI 1 BsgI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 4 BsaMI,Mva1269I,PctI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 BtgZI 1 BtsI 1 CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 6 CviJI 9 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 6 FokI 4 GsaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 6 Hin4II* 2 HpyAV HindII 5 HincII HinfI 7 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 9 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 6 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MlyI 4 SchI MmeI 3 MnlI 6 MseI 7 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PleI 4 PpsI PshAI 1 BstPAI,BoxI PsiI 1 AanI RsaI 2 AfaI SalI 2 ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 14 SexAI 1 MabI SfaNI 3 LweI SpeI 1 BcuI,AhlI SspI 2 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 9 TaqII 1 TatI 1 TauI 1 TfiI 3 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI Tth111I 2 PflFI,PsyI,AspI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BmeT110I BmtI Bpu10I BsaAI BsaBI BseMII BsePI BseSI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstXI BstZ17I BtrI Cac8I Cfr9I CfrI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsuI HaeII HgaI HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769