Restriction Map of KIN28/YDL108W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

KIN28/YDL108W on chromosome IV from coordinates 267698 to 268699.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.5014

TspDTI |TatI ||Csp6I |||RsaI ||||Hpy166II \\\\\ ATGAAAGTGAATATGGAGTACACAAAGGGTATGTGGGGGTTATATATTGTCGTCTTTCTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTCACTTATACCTCATGTGTTTCCCATACACCCCCAATATATAACAGCAGAAAGAA / /// | ||TatI | |Hpy166II | |Csp6I | RsaI TspDTI M K V N M E Y T K G M W G L Y I V V F L * K * I W S T Q R V C G G Y I L S S F F E S E Y G V H K G Y V G V I Y C R L S F ----:----|----:----|----:----|----:----|----:----|----:----| X F T F I S Y V F P I H P N Y I T T K R X S L S Y P T C L P Y T P T I Y Q R R E H F H I H L V C L T H P P * I N D D K K AclI MaeII | SetI | TaiI | Hin4I | Hin4I | |BtgZI TfiI | || MseI HinfI MnlI | || VspI | AjuI |Hin4I MseI BaeI | || TspDTI | BaeI |Hin4I \ \ \ \\ \ \ \ \\ TTAACATTCAATAATGATACTAACGTTGATTAATGATGATTCATCGCAGAAAAGAAAGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTAAGTTATTACTATGATTGCAACTAATTACTACTAAGTAGCGTCTTTTCTTTCAA / // / / // / / / / MseI || | | || BaeI HinfI | MnlI BaeI || | | || AjuI TfiI Hin4I || | | |VspI Hin4I || | | |MseI || | | BtgZI || | TspDTI || MaeII || AclI |TaiI |SetI Hin4I Hin4I L T F N N D T N V D * * * F I A E K K V * H S I M I L T L I N D D S S Q K R K L N I Q * * Y * R * L M M I H R R K E S W ----:----|----:----|----:----|----:----|----:----|----:----| K V N L L S V L T S * H H N M A S F F T K L M * Y H Y * R Q N I I I * R L F S L * C E I I I S V N I L S S E D C F L F N Csp6I |RsaI || HphI || AjuI HindII || | AciI Hpy166II Hpy166II BsrI \\ \ \ \ \ \ GGTGAGGGTACTTATGCGGTTGTTTACTTGGGTTGTCAACACTCTACTGGAAGAAAGATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTCCCATGAATACGCCAACAAATGAACCCAACAGTTGTGAGATGACCTTCTTTCTAA /// / / / / / ||| HphI AciI Hpy166II Hpy166II BsrI ||Csp6I HindII |RsaI AjuI G E G T Y A V V Y L G C Q H S T G R K I V R V L M R L F T W V V N T L L E E R L * G Y L C G C L L G L S T L Y W K K D C ----:----|----:----|----:----|----:----|----:----|----:----| P S P V * A T T * K P Q * C E V P L F I Q H P Y K H P Q K S P N D V S * Q F F S T L T S I R N N V Q T T L V R S S S L N MboI | DpnI | |BstKTI | || BseGI | || | Hpy188I | || | |ApoI | || | |TspEI TspGWI MboII | || | || BccI | AluI | MseI | || | || |MseI | CviJI | |FokI | || | || ||AhaIII* | | SetI \ \\ \ \\ \ \\ \\\ \ \ \ GCTATTAAGGAGATCAAAACATCCGAATTTAAAGATGGTTTAGATATGTCAGCTATCCGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAATTCCTCTAGTTTTGTAGGCTTAAATTTCTACCAAATCTATACAGTCGATAGGCA / / / // / / / /// / / / MboII | | || | BseGI | ||MseI | | CviJI | | || MboI | |AhaIII* | | AluI | | |DpnI | TspEI | SetI | | BstKTI | ApoI TspGWI | FokI | BccI MseI Hpy188I A I K E I K T S E F K D G L D M S A I R L L R R S K H P N L K M V * I C Q L S V Y * G D Q N I R I * R W F R Y V S Y P * ----:----|----:----|----:----|----:----|----:----|----:----| A I L S I L V D S N L S P K S I D A I R Q * * P S * F M R I * L H N L Y T L * G S N L L D F C G F K F I T * I H * S D T MnlI | TseI | CviRI* | |BisI | ||BlsI | |||BseGI | |||| Hpy188I MseI | |||| | MaeII | Csp6I | |||| | |BbvI | |RsaI | |||| | |SfaNI | || FokI | |||| | || SetI | || SetI | |||| | || TaiI MslI \ \\ \ \ \\\\ \ \\ \ \ GAAGTTAAGTACCTCCAAGAAATGCAGCATCCGAACGTCATAGAACTAATAGACATATTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAATTCATGGAGGTTCTTTACGTCGTAGGCTTGCAGTATCTTGATTATCTGTATAAA / // / / //// / / / / / | |Csp6I | | |||| | | | SfaNI MslI | RsaI | | |||| | | | BbvI | SetI | | |||| | | MaeII MseI | | |||| | TaiI | | |||| | SetI | | |||| Hpy188I | | |||TseI | | ||BisI | | |BseGI | | |BlsI | | CviRI* | MnlI FokI E V K Y L Q E M Q H P N V I E L I D I F K L S T S K K C S I R T S * N * * T Y L S * V P P R N A A S E R H R T N R H I Y ----:----|----:----|----:----|----:----|----:----|----:----| S T L Y R W S I C C G F T M S S I S M N H L * T G G L F A A D S R * L V L L C I F N L V E L F H L M R V D Y F * Y V Y K MnlI MboI | DpnI | |XbaI | |BstKTI | ||MaeI TspEI | ||GsuI | MseI | ||Eco57MI | |SwaI | ||Hpy178III* CviJI | |AhaIII* Hpy178III* | ||| SetI \ \ \\ \ \ \\\ \ ATGGCTTATGATAATTTAAATCTCGTTCTGGAGTTCCTACCAACTGATCTAGAGGTGGTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGAATACTATTAAATTTAGAGCAAGACCTCAAGGATGGTTGACTAGATCTCCACCAT / /// / / // / // CviJI ||MseI Hpy178III* | || | |XbaI |AhaIII* | || | |SetI |SwaI | || | Hpy178III* TspEI | || | MaeI | || MboI | |Eco57MI | |GsuI | |DpnI | BstKTI MnlI M A Y D N L N L V L E F L P T D L E V V W L M I I * I S F W S S Y Q L I * R W * G L * * F K S R S G V P T N * S R G G N ----:----|----:----|----:----|----:----|----:----|----:----| I A * S L K F R T R S N R G V S R S T T * P K H Y N L D R E P T G V L Q D L P P H S I I I * I E N Q L E * W S I * L H Y MseI SfaNI | FatI | |CviAII | || NlaIII | || | BseGI | || | | MnlI Tsp4CI* | || | | | EcoP15I | Hpy166II | || | | | |FokI \ \ \ \\ \ \ \ \\ ATAAAAGACAAATCAATACTGTTTACACCAGCAGATATTAAGGCATGGATGCTTATGACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTCTGTTTAGTTATGACAAATGTGGTCGTCTATAATTCCGTACCTACGAATACTGA / / / // // / / | Hpy166II | || || | MnlI Tsp4CI* | || || BseGI | || |FatI | || CviAII | |NlaIII | SfaNI MseI I K D K S I L F T P A D I K A W M L M T * K T N Q Y C L H Q Q I L R H G C L * L K R Q I N T V Y T S R Y * G M D A Y D F ----:----|----:----|----:----|----:----|----:----|----:----| I F S L D I S N V G A S I L A H I S I V L L L C I L V T * V L L Y * P M S A * S Y F V F * Y Q K C W C I N L C P H K H S CviRI* | MboI | XhoII | | DpnI TspDTI | | |BstKTI | ApoI | | || Hpy188I BsrDI | TspEI | | || | BinI* TspEI \ \ \ \ \ \\ \ \ \ TTGAGGGGCGTGTATCATTGCCACAGAAATTTCATTTTGCACAGGGATCTGAAACCAAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCCCCGCACATAGTAACGGTGTCTTTAAAGTAAAACGTGTCCCTAGACTTTGGTTTG / / / / / / // / / | FokI BsrDI TspDTI TspEI CviRI* || | BinI* EcoP15I ApoI || Hpy188I || XhoII || MboI |DpnI BstKTI L R G V Y H C H R N F I L H R D L K P N * G A C I I A T E I S F C T G I * N Q T E G R V S L P Q K F H F A Q G S E T K Q ----:----|----:----|----:----|----:----|----:----|----:----| K L P T Y * Q W L F K M K C L S R F G F K S P R T D N G C F N * K A C P D S V L Q P A H I M A V S I E N Q V P I Q F W V SetI | CfrI | | BalI | | CviJI HphI BccI | | HaeIII TaqII MaeI \ \ \ \ \ \ \ AATTTATTATTTTCACCTGATGGCCAGATAAAAGTAGCAGATTTCGGTCTAGCAAGGGCG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATAATAAAAGTGGACTACCGGTCTATTTTCATCGTCTAAAGCCAGATCGTTCCCGC / / / / / / TspEI SetI | CfrI TaqII MaeI HphI BccI HaeIII CviJI BalI N L L F S P D G Q I K V A D F G L A R A I Y Y F H L M A R * K * Q I S V * Q G R F I I F T * W P D K S S R F R S S K G D ----:----|----:----|----:----|----:----|----:----|----:----| L K N N E G S P W I F T A S K P R A L A C N I I K V Q H G S L L L L N R D L L P I * * K * R I A L Y F Y C I E T * C P R Cfr10I |MwoI |HpaII || AsuI* || |CviJI MaeIII || |HaeIII | MaeII || |BmgT120I | | SetI AjuI || ||NlaIV | | TaiI | Hin6I || ||| FatI | | |MaeIII | |GlaI || ||| |CviAII | | ||Hpy99I | ||HhaI || ||| || NlaIII | | |||BccI | |||HaeII \\ \\\ \\ \ \ \ \\\\ \ \\\\ ATACCGGCCCCACATGAGATACTGACAAGTAACGTCGTAACAAGATGGTATAGAGCGCCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGCCGGGGTGTACTCTATGACTGTTCATTGCAGCATTGTTCTACCATATCTCGCGGT / //// / // //// / / / //// MwoI |||| | |FatI |||| | MaeIII AjuI |||Hin6I |||| | CviAII |||| BccI ||GlaI |||| NlaIII |||MaeII |HhaI |||AsuI* ||MaeIII HaeII ||BmgT120I |Hpy99I ||NlaIV TaiI |Cfr10I SetI |HaeIII |CviJI HpaII I P A P H E I L T S N V V T R W Y R A P Y R P H M R Y * Q V T S * Q D G I E R Q T G P T * D T D K * R R N K M V * S A R ----:----|----:----|----:----|----:----|----:----|----:----| I G A G C S I S V L L T T V L H Y L A G S V P G V H S V S L Y R R L L I T Y L A Y R G W M L Y Q C T V D Y C S P I S R W AluI Hin4I CviJI Hin4I TspEI | SetI AjuI | CviJI EcoRV \ \ \ \ \ \ \ GAATTGTTGTTTGGAGCTAAACATTACACATCGGCTATTGATATCTGGTCAGTAGGCGTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAACAACAAACCTCGATTTGTAATGTGTAGCCGATAACTATAGACCAGTCATCCGCAA / / / / / / / / TspEI | | AjuI Hin4I CviJI EcoRV Hin4I | CviJI Hin4I Hin4I | AluI SetI E L L F G A K H Y T S A I D I W S V G V N C C L E L N I T H R L L I S G Q * A L I V V W S * T L H I G Y * Y L V S R R Y ----:----|----:----|----:----|----:----|----:----|----:----| S N N N P A L C * V D A I S I Q D T P T L I T T Q L * V N C M P * Q Y R T L L R F Q Q K S S F M V C R S N I D P * Y A N Hin4I Hin4I | AciI | FnuDII* | | TspEI | | | FalI | | | FalI BssKI TaqI | | | |MseI EcoRII BsaBI | | | |VspI |BdaI |MboI | | | || BciVI |BdaI ||AloI | | | || | DdeI ||ScrFI FalI |||DpnI | | | || | Bpu10I SetI ||BseBI FalI ||||BstKTI \ \ \ \\ \ \ \ \\\ \ \\\\\ ATATTCGCGGAATTAATGCTAAGGATACCTTATTTACCAGGACAGAATGATGTCGATCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAGCGCCTTAATTACGATTCCTATGGAATAAATGGTCCTGTCTTACTACAGCTAGTT / / /// / / / / / / / // / | AciI ||BciVI | SetI | | EcoRII | | || MboI | |VspI Bpu10I | | BssKI | | |DpnI | |MseI DdeI | BseBI | | BstKTI | TspEI | ScrFI | | TaqI FnuDII* | FalI | BsaBI FalI | FalI AloI FalI BdaI BdaI I F A E L M L R I P Y L P G Q N D V D Q Y S R N * C * G Y L I Y Q D R M M S I K I R G I N A K D T L F T R T E * C R S N ----:----|----:----|----:----|----:----|----:----|----:----| I N A S N I S L I G * K G P C F S T S * * I R P I L A L S V K N V L V S H H R D Y E R F * H * P Y R I * W S L I I D I L MaeIII | AclI | MaeII | |BdaI | |BdaI | || SetI | || TaiI | || | AsuI* | || | DraII | || | |BmgT120I AsuI* | || | ||CviJI |CviJI | || | ||HaeIII |HaeIII | || | ||| DdeI SfeI* |BmgT120I | || | ||| SauI* AloI |SetI BslFI || MboII \ \\ \ \\\ \ \ \\ \ \\ \ ATGGAAGTAACGTTCAGGGCCTTAGGGACACCTACAGATAGAGATTGGCCCGAAGTTTCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCATTGCAAGTCCCGGAATCCCTGTGGATGTCTATCTCTAACCGGGCTTCAAAGA / // // / / / / / /// | |MaeII || | | SetI SfeI* | ||AsuI* | |AclI || | SauI* | |BmgT120I | MaeIII || | DdeI | |MboII BdaI || AloI | HaeIII BdaI |DraII | CviJI TaiI |AsuI* BslFI SetI BmgT120I HaeIII CviJI M E V T F R A L G T P T D R D W P E V S W K * R S G P * G H L Q I E I G P K F L G S N V Q G L R D T Y R * R L A R S F F ----:----|----:----|----:----|----:----|----:----|----:----| I S T V N L A K P V G V S L S Q G S T E F P L L T * P R L S V * L Y L N A R L K H F Y R E P G * P C R C I S I P G F N R Hpy178III* | MnlI | Hin4II* MaeII | | TspEI | SetI MaeIII | | | TspDTI | TaiI | EciI AciI | | | | BbvI \ \ \ \ \ \ \ \ \ \ TCCTTTATGACGTATAACAAGTTACAAATATATCCGCCCCCTTCAAGAGATGAATTGAGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAATACTGCATATTGTTCAATGTTTATATAGGCGGGGGAAGTTCTCTACTTAACTCC / / / / / / / // | MaeII | MaeIII AciI | | |TspEI TaiI EciI | | TspDTI SetI | Hin4II* | MnlI Hpy178III* S F M T Y N K L Q I Y P P P S R D E L R P L * R I T S Y K Y I R P L Q E M N * G L Y D V * Q V T N I S A P F K R * I E E ----:----|----:----|----:----|----:----|----:----|----:----| E K I V Y L L N C I Y G G G E L S S N L K R * S T Y C T V F I D A G K L L H I S G K H R I V L * L Y I R G R * S I F Q P XmnI |TspDTI || SetI || |BsrDI || || TseI || || |BisI || || ||BlsI || || |||NheI || || ||||MaeI || || |||||Cac8I BsmI || || |||||| BmtI DdeI | CspCI \\ \\ \\\\\\ \ \ \ \ AAAAGGTTCATTGCTGCTAGCGAATACGCCTTAGATTTTATGTGTGGAATGCTAACGATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCCAAGTAACGACGATCGCTTATGCGGAATCTAAAATACACACCTTACGATTGCTAC // / /// /// / / / || BsrDI ||| ||NheI DdeI | CspCI |XmnI ||| |MaeI BsmI |BbvI ||| Cac8I TspDTI ||TseI SetI ||BmtI |BisI BlsI K R F I A A S E Y A L D F M C G M L T M K G S L L L A N T P * I L C V E C * R * K V H C C * R I R L R F Y V W N A N D E ----:----|----:----|----:----|----:----|----:----|----:----| F L N M A A L S Y A K S K I H P I S V I S F T * Q Q * R I R R L N * T H F A L S F P E N S S A F V G * I K H T S H * R H XcmI | TspDTI | | SetI | | |AsuI* | | |AvaII | | |Hpy166II | | ||BmgT120I | | ||| AciI CspCI MnlI | | ||| | NspBII* | TspRI TspEI \ \ \ \\\ \ \ \ \ \ AACCCACAAAAGAGGTGGACCGCTGTTCAGTGTTTAGAAAGTGATTATTTCAAAGAATTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGTGTTTTCTCCACCTGGCGACAAGTCACAAATCTTTCACTAATAAAGTTTCTTAAT / /// / // / / / / MnlI ||SetI | || | | CspCI TspEI || | || | TspRI || | || NspBII* || | || AciI || | |AvaII || | |AsuI* || | BmgT120I || Hpy166II |TspDTI XcmI N P Q K R W T A V Q C L E S D Y F K E L T H K R G G P L F S V * K V I I S K N Y P T K E V D R C S V F R K * L F Q R I T ----:----|----:----|----:----|----:----|----:----|----:----| F G C F L H V A T * H K S L S * K L S N S G V F S T S R Q E T N L F H N N * L I V W L L P P G S N L T * F T I I E F F * MaeII MaeIII |BsaAI Tsp45I |SnaBI DraIII |MaeIII |MboII || SetI |BbvII* || TaiI \\ \\ \ CCACCACCAAGTGACCCGTCTTCAATAAAAATACGTAACTGA 970 980 990 1000 ----:----|----:----|----:----|----:----|-- GGTGGTGGTTCACTGGGCAGAAGTTATTTTTATGCATTGACT / / / / // / | | Tsp45I | || MaeIII | | MaeIII | |MaeII | | BbvII* | SnaBI | MboII | BsaAI DraIII TaiI SetI P P P S D P S S I K I R N * H H Q V T R L Q * K Y V T X T T K * P V F N K N T * L X ----:----|----:----|----:----|----:----|-- G G G L S G D E I F I R L Q V V V L H G T K L L F V Y S W W W T V R R * Y F Y T V S # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AclI 2 Psp1406I AhaIII* 2 DraI AjuI 2 AloI 1 AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BciVI 1 BfuI BdaI 2 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 4 BmtI 1 BspOI Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BslFI 1 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 4 BtgZI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 2 CviJI 8 CviKI-1 CviRI* 2 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 4 MalI DraII 1 EcoO109I DraIII 1 AdeI EciI 1 Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 2 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 1 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 1 MaeI 3 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 6 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MnlI 6 MseI 8 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I RsaI 3 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 15 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SwaI 1 SmiI TaiI 6 TaqI 1 TaqII 1 TatI 1 TfiI 1 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AlfI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI Bce83I* BceAI BcgI BclI BetI* BfiI BglI BglII BmeT110I BplI BsaXI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BsmAI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI BtsI CauII* Cfr9I ClaI DinI DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI HgaI HgiAI* HgiCI* HgiJII* HindIII HpaI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SchI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI TauI TsoI TspMI TstI Tth111I XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769