Restriction Map of DUN1/YDL101C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

DUN1/YDL101C on chromosome IV from coordinates 281848 to 280307.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 MaeIII |MlyI |PleI SduI ||MboII HgiAI* ||TspDTI | OliI ||| HphI Hpy166II | MslI ||| HinfI Ksp632I* \ \ \ \\\ \ \ ATGAGTTTGTCCACGAAAAGAGAGCACTCTGGTGATGTAACTGACTCTTCATTCAAAAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAAACAGGTGCTTTTCTCTCGTGAGACCACTACATTGACTGAGAAGTAAGTTTTCT / / / /// // / / Hpy166II HgiAI* MslI ||| || HinfI Ksp632I* SduI OliI ||| |HphI ||| MaeIII ||PleI |MboII |MlyI TspDTI M S L S T K R E H S G D V T D S S F K R * V C P R K E S T L V M * L T L H S K D E F V H E K R A L W * C N * L F I Q K T ----:----|----:----|----:----|----:----|----:----|----:----| X L K D V F L S C E P S T V S E E N L L X S N T W S F L A S Q H H L Q S K M * F H T Q G R F S L V R T I Y S V R * E F S CviJI |BseYI || AluI BspCNI || GsaI |BseMII || CviJI || AsuI* || |DdeI || |BmgT120I BccI || ||SetI || ||CviJI |Hpy166II || ||| Hpy188I || ||HaeIII || MseI \\ \\\ \ \\ \\\ \\ \ CAGCAACGAAGTAATAAGCCCAGCTCAGAATACACTTGTCTGGGCCATCTGGTGAACTTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTTGCTTCATTATTCGGGTCGAGTCTTATGTGAACAGACCCGGTAGACCACTTGAAT // / / // // // / / || | | |DdeI |BseMII |AsuI* | MseI || | | Hpy188I BspCNI BmgT120I Hpy166II || | BseYI HaeIII BccI || | CviJI CviJI || | AluI || SetI |GsaI CviJI Q Q R S N K P S S E Y T C L G H L V N L S N E V I S P A Q N T L V W A I W * T * A T K * * A Q L R I H L S G P S G E L N ----:----|----:----|----:----|----:----|----:----|----:----| C C R L L L G L E S Y V Q R P W R T F K V A V F Y Y A W S L I C K D P G D P S S L L S T I L G A * F V S T Q A M Q H V * HphI AclI BssKI MaeII | HpaII |MaeIII | ScrFI || SetI | CauII* || TaiI \ \ \\ \ ATACCCGGAAAGGAGCAAAAAGTGGAAATAACAAATAGAAACGTTACTACAATCGGTAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGGCCTTTCCTCGTTTTTCACCTTTATTGTTTATCTTTGCAATGATGTTAGCCATCT / /// / / / | ||BssKI | | MaeIII | |HpaII | MaeII | CauII* | AclI | ScrFI TaiI HphI SetI I P G K E Q K V E I T N R N V T T I G R Y P E R S K K W K * Q I E T L L Q S V E T R K G A K S G N N K * K R Y Y N R * K ----:----|----:----|----:----|----:----|----:----|----:----| I G P F S C F T S I V F L F T V V I P L L V R F P A F L P F L L Y F R * * L R Y Y G S L L L F H F Y C I S V N S C D T S Hpy178III* |TaqI || BseMII || |BspCNI || || FatI MaeII || || |TspDTI | Hpy99I || || |CviAII | |SetI || || || NlaIII SetI | |TaiI CviJI || || || |DdeI \ \ \\ \ \\ \\ \\ \\ AGTAGGTCGTGCGACGTTATATTGAGTGAGCCTGACATCTCGACTTTCCATGCTGAGTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCCAGCACGCTGCAATATAACTCACTCGGACTGTAGAGCTGAAAGGTACGACTCAAA / / / / / /// // // / SetI | | MaeII CviJI ||| || || DdeI | TaiI ||| || |FatI | SetI ||| || CviAII Hpy99I ||| |NlaIII ||| TspDTI ||BspCNI |BseMII |TaqI Hpy178III* S R S C D V I L S E P D I S T F H A E F V G R A T L Y * V S L T S R L S M L S F * V V R R Y I E * A * H L D F P C * V S ----:----|----:----|----:----|----:----|----:----|----:----| L L D H S T I N L S G S M E V K W A S N F Y T T R R * I S H A Q C R S K G H Q T T P R A V N Y Q T L R V D R S E M S L K BseGI | TspEI ApoI MseI TaqI CviRI* | | FokI TspEI VspI ClaI \ \ \ \ \ \ \ CATCTACTGCAAATGGATGTGGATAATTTCCAAAGAAATTTGATTAATGTTATCGATAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGATGACGTTTACCTACACCTATTAAAGGTTTCTTTAAACTAATTACAATAGCTATTC / / / / / / / CviRI* BseGI | FokI TspEI VspI ClaI TspEI ApoI MseI TaqI H L L Q M D V D N F Q R N L I N V I D K I Y C K W M W I I S K E I * L M L S I R S T A N G C G * F P K K F D * C Y R * E ----:----|----:----|----:----|----:----|----:----|----:----| * R S C I S T S L K W L F K I L T I S L E D V A F P H P Y N G F F N S * H * R Y M * Q L H I H I I E L S I Q N I N D I L HphI | BseGI | |MboII MseI | || SmlI VspI | || AflII | TspGWI BarI FokI | || |MseI \ \ \ \ \ \\ \\ AGCAGAAACGGAACTTTTATTAATGGTAATCGTTTGGTGAAGAAAGACTACATCCTTAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCTTTGCCTTGAAAATAATTACCATTAGCAAACCACTTCTTTCTGATGTAGGAATTC // / / // / // || BarI FokI || MboII |AflII |VspI |BseGI |SmlI |MseI HphI BarI TspGWI MseI S R N G T F I N G N R L V K K D Y I L K A E T E L L L M V I V W * R K T T S L R Q K R N F Y * W * S F G E E R L H P * E ----:----|----:----|----:----|----:----|----:----|----:----| L L F P V K I L P L R K T F F S * M R L S C F R F K * * H Y D N P S S L S C G * A S V S S K N I T I T Q H L F V V D K L MboII TspDTI BarI TspEI |Csp6I |MaeIII | DrdI MwoI ||RsaI |Tsp45I | | HphI BstAPI ||| MboII \\ \ \ \ \ \\\ \ AATGGTGACAGAATTGTCTTTGGCAAAAGTTGCTCCTTTTTGTTCAAGTACGCATCTTCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCACTGTCTTAACAGAAACCGTTTTCAACGAGGAAAAACAAGTTCATGCGTAGAAGT / / / / // // / | | TspEI BstAPI || || MboII | | HphI MwoI || |Csp6I | DrdI || RsaI Tsp45I |MboII MaeIII TspDTI N G D R I V F G K S C S F L F K Y A S S M V T E L S L A K V A P F C S S T H L H W * Q N C L W Q K L L L F V Q V R I F I ----:----|----:----|----:----|----:----|----:----|----:----| F P S L I T K P L L Q E K K N L Y A D E S H H C F Q R Q C F N S R K T * T R M K I T V S N D K A F T A G K Q E L V C R * TspDTI SfaNI TaqI SetI |Hpy188I \ \ \ \\ TCTTCTACTGACATCGAAAATGACGATGAAAAGGTAAGTTCAGAAAGTCGTTCATATAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGATGACTGTAGCTTTTACTGCTACTTTTCCATTCAAGTCTTTCAGCAAGTATATTC / / / / / SfaNI TaqI SetI | Hpy188I TspDTI S S T D I E N D D E K V S S E S R S Y K L L L T S K M T M K R * V Q K V V H I R F Y * H R K * R * K G K F R K S F I * E ----:----|----:----|----:----|----:----|----:----|----:----| D E V S M S F S S S F T L E S L R E Y L M K * Q C R F H R H F P L N L F D N M Y R R S V D F I V I F L Y T * F T T * I L Hpy99I | Hpy99I | | AlfI | | AlfI CviJI | | | Hpy178III* | AlfI | | | | AciI | AlfI \ \ \ \ \ \ \ AACGACGACGAAGTTTTCAAGAAACCGCAAATAAGTGCTACAAGTAGCCAAAATGCTACA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGCTGCTTCAAAAGTTCTTTGGCGTTTATTCACGATGTTCATCGGTTTTACGATGT / / / / / // / | Hpy99I AlfI | AciI |AlfI TsoI Hpy99I AlfI Hpy178III* |AlfI CviJI N D D E V F K K P Q I S A T S S Q N A T T T T K F S R N R K * V L Q V A K M L Q R R R S F Q E T A N K C Y K * P K C Y N ----:----|----:----|----:----|----:----|----:----|----:----| F S S S T K L F G C I L A V L L W F A V S R R R L K * S V A F L H * L Y G F H * V V V F N E L F R L Y T S C T A L I S C AciI BisI |BlsI StuI ||TauI CviJI TsoI |||TspEI HaeIII SspI \ \\\\ \ \ ACGAGTGCCGCAATTAGAAAACTGAATAAGACAAGGCCTGTGTCGTTCTTTGATAAATAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCACGGCGTTAATCTTTTGACTTATTCTGTTCCGGACACAGCAAGAAACTATTTATA //// / / / |||AciI TspEI HaeIII SspI ||BisI CviJI |BlsI StuI TauI T S A A I R K L N K T R P V S F F D K Y R V P Q L E N * I R Q G L C R S L I N I E C R N * K T E * D K A C V V L * * I F ----:----|----:----|----:----|----:----|----:----|----:----| V L A A I L F S F L V L G T D N K S L Y L S H R L * F V S Y S L A Q T T R Q Y I R T G C N S F Q I L C P R H R E K I F I BssKI SecI* EcoRII | ScrFI SetI SetI SduI | BseBI CviJI | TspEI |CviRI* BseSI | | BsgI | HphI \ \ \\ \ \ \ \ \ \ TTATTAGGTAAAGAATTAGGTGCAGGGCACTACGCCCTGGTGAAAGAAGCCAAAAACAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATCCATTTCTTAATCCACGTCCCGTGATGCGGGACCACTTTCTTCGGTTTTTGTTT / / / / /// // SetI | | BseSI ||EcoRII |HphI | | SduI ||BssKI CviJI | CviRI* |SecI* TspEI |BsgI SetI BseBI ScrFI L L G K E L G A G H Y A L V K E A K N K Y * V K N * V Q G T T P W * K K P K T K I R * R I R C R A L R P G E R S Q K Q K ----:----|----:----|----:----|----:----|----:----|----:----| K N P L S N P A P C * A R T F S A L F L N I L Y L I L H L A S R G P S L L W F C * * T F F * T C P V V G Q H F F G F V F AluI CviJI XmnI DdeI BspCNI BsrI | SetI |SspI EspI* |BseMII \ \ \ \\ \ \\ AAAACTGGTCAGCAAGTAGCTGTGAAAATATTCCACGCTCAGCAAAATGACGACCAAAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGACCAGTCGTTCATCGACACTTTTATAAGGTGCGAGTCGTTTTACTGCTGGTTTTT / / / // / // BsrI | CviJI |SspI EspI* |BseMII | AluI XmnI DdeI BspCNI SetI K T G Q Q V A V K I F H A Q Q N D D Q K K L V S K * L * K Y S T L S K M T T K K N W S A S S C E N I P R S A K * R P K K ----:----|----:----|----:----|----:----|----:----|----:----| F V P * C T A T F I N W A * C F S S W F F F Q D A L L Q S F I G R E A F H R G F F S T L L Y S H F Y E V S L L I V V L F TspEI BseGI | MnlI | MslI CviRI* | | FokI | |FokI | BseGI \ \ \ \ \\ \ \ AAGAATAAACAATTTAGGGAGGAAACTAACATCCTAATGAGAGTGCAACATCCAAACATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTATTTGTTAAATCCCTCCTTTGATTGTAGGATTACTCTCACGTTGTAGGTTTGTAA / / / / / / // | TspEI FokI BseGI MslI FokI |BseGI MnlI CviRI* K N K Q F R E E T N I L M R V Q H P N I R I N N L G R K L T S * * E C N I Q T L E * T I * G G N * H P N E S A T S K H C ----:----|----:----|----:----|----:----|----:----|----:----| F F L C N L S S V L M R I L T C C G F M F S Y V I * P P F * C G L S L A V D L C L I F L K P L F S V D * H S H L M W V N DdeI HindII | Hpy188I BspCNI Hpy166II | |TfiI |SspI | MaeI CviJI | |HinfI |BseMII \ \ \ \ \\ \\ GTCAACTTACTAGATAGTTTTGTAGAGCCAATCAGCAAATCTCAGATTCAAAAATATTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTGAATGATCTATCAAAACATCTCGGTTAGTCGTTTAGAGTCTAAGTTTTTATAAAC / / / // / // / Hpy166II MaeI CviJI || | || SspI HindII || | |BseMII || | BspCNI || HinfI || TfiI |DdeI Hpy188I V N L L D S F V E P I S K S Q I Q K Y L S T Y * I V L * S Q S A N L R F K N I W Q L T R * F C R A N Q Q I S D S K I F G ----:----|----:----|----:----|----:----|----:----|----:----| T L K S S L K T S G I L L D * I * F Y K Q * S V L Y N Q L A L * C I E S E F I N D V * * I T K Y L W D A F R L N L F I Q Hpy188I BsrI | FatI | MboI | AflIII | | BccI | BspLU11I* | | DpnI | |CviAII | | |TaqI | ||BsmAI Csp6I | | |BstKTI TfiI | ||| NspI |RsaI | | || Hpy99I HinfI | ||| NlaIII \\ \ \ \\ \ \ \ \\\ \ GTACTGGAAAAGATCGACGATGGCGAACTATTTGAAAGAATCGTCAGAAAAACATGTTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CATGACCTTTTCTAGCTGCTACCGCTTGATAAACTTTCTTAGCAGTCTTTTTGTACAAAC // / ///// / / / // / || BsrI ||||TaqI | | | || BsmAI |Csp6I |||MboI | | | |BspLU11I* RsaI ||Hpy99I | | | |AflIII ||BccI | | | |FatI |DpnI | | | CviAII BstKTI | | NlaIII | | NspI | Hpy188I HinfI TfiI V L E K I D D G E L F E R I V R K T C L Y W K R S T M A N Y L K E S S E K H V * T G K D R R W R T I * K N R Q K N M F E ----:----|----:----|----:----|----:----|----:----|----:----| T S S F I S S P S S N S L I T L F V H K P V P F S R R H R V I Q F F R * F F M N Y Q F L D V I A F * K F S D D S F C T Q AluI MaeIII AjuI FokI Tsp4CI* | TfiI CviJI | AjuI FatI | HinfI | SetI | |BetI* CviRI* | | BseGI | | TspDTI | ||HpaII |CviAII \ \ \ \ \ \ \ \\\ \\ AGACAGGATGAATCCAAAGCTCTATTCAAACAGTTACTTACCGGATTGAAGTATCTGCAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTCCTACTTAGGTTTCGAGATAAGTTTGTCAATGAATGGCCTAACTTCATAGACGTA / / / / / / / / / / // / / AjuI | | | | | FokI | | | |BetI* | CviAII | | | | TspDTI | | | HpaII CviRI* | | | CviJI | | MaeIII NlaIII | | | AluI | AjuI | | SetI Tsp4CI* | HinfI | TfiI BseGI R Q D E S K A L F K Q L L T G L K Y L H D R M N P K L Y S N S Y L P D * S I C M T G * I Q S S I Q T V T Y R I E V S A * ----:----|----:----|----:----|----:----|----:----|----:----| L C S S D L A R N L C N S V P N F Y R C S V P H I W L E I * V T V * R I S T D A S L I F G F S * E F L * K G S Q L I Q M NlaIII BsmAI CviJI MseI Hin6I \ \ \ \ \ GAGCAAAACATCATTCACAGAGACATCAAGCCAGAAAATATCTTATTAAATATAACAAGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTTTGTAGTAAGTGTCTCTGTAGTTCGGTCTTTTATAGAATAATTTATATTGTTCC / / / / / FatI BsmAI CviJI MseI HhaI E Q N I I H R D I K P E N I L L N I T R S K T S F T E T S S Q K I S Y * I * Q G A K H H S Q R H Q A R K Y L I K Y N K A ----:----|----:----|----:----|----:----|----:----|----:----| S C F M M * L S M L G S F I K N F I V L H A F C * E C L C * A L F Y R I L Y L L L L V D N V S V D L W F I D * * I Y C P AsuI* |CviJI |HaeIII |BmgT120I || FatI || NcoI || StyI || SecI* || DsaI* || |CviAII || || NlaIII || || | FalI || || | FalI || || | | BseGI || || | | | MmeI GlaI || || | | | | TspEI |HhaI || || | | | | | FokI |FnuDII* || || | | | | | | MboII || FalI || || | | | | | | |TspDTI || FalI || || | | | | | | || TspDTI \\ \ \\ \\ \ \ \ \ \ \ \\ \ CGCGAAAATCCAAGTCAAGTCCAACTTGGCCCATGGGATGAAGATGAAATTGATATTCAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCTTTTAGGTTCAGTTCAGGTTGAACCGGGTACCCTACTTCTACTTTAACTATAAGTT /// /// // / / / / / ||FalI ||| || | MmeI | | TspDTI ||FalI ||| || BseGI | FokI |FnuDII* ||| |DsaI* TspDTI |Hin6I ||| |SecI* MboII GlaI ||| |FalI TspEI ||| |FalI ||| |StyI ||| |NcoI ||| |FatI ||| CviAII ||NlaIII ||AsuI* |BmgT120I HaeIII CviJI R E N P S Q V Q L G P W D E D E I D I Q A K I Q V K S N L A H G M K M K L I F K R K S K S S P T W P M G * R * N * Y S S ----:----|----:----|----:----|----:----|----:----|----:----| R S F G L * T W S P G H S S S S I S I * A R F D L D L G V Q G M P H L H F Q Y E A F I W T L D L K A W P I F I F N I N L CviJI HaeIII ApoI CviRI* MseI AciI | MaeI TspEI |TspEI \ \ \ \ \ \\ GTTAAAATAGCGGATTTTGGCCTAGCAAAATTTACAGGAGAAATGCAATTCACAAACACA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTTTATCGCCTAAAACCGGATCGTTTTAAATGTCCTCTTTACGTTAAGTGTTTGTGT / / / / / / / MseI AciI | MaeI TspEI | TspEI HaeIII ApoI CviRI* CviJI V K I A D F G L A K F T G E M Q F T N T L K * R I L A * Q N L Q E K C N S Q T H * N S G F W P S K I Y R R N A I H K H T ----:----|----:----|----:----|----:----|----:----|----:----| T L I A S K P R A F N V P S I C N V F V L * F L P N Q G L L I * L L F A I * L C N F Y R I K A * C F K C S F H L E C V C Hin4II* | Hin6I DraIII | |GlaI FalI | Csp6I | ||HhaI BciVI FalI | |RsaI | |||HaeII | MnlI |BsaBI \ \\ \ \\\\ \ \ \\ CTTTGTGGTACGCCTTCTTATGTAGCGCCCGAAGTCCTCACAAAGAAAGGATACACATCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GAAACACCATGCGGAAGAATACATCGCGGGCTTCAGGAGTGTTTCTTTCCTATGTGTAGT / // / //// / / / / DraIII |Csp6I | |||Hin6I | | FalI BsaBI RsaI | ||GlaI | | FalI | |HhaI | MnlI | HaeII BciVI Hin4II* L C G T P S Y V A P E V L T K K G Y T S F V V R L L M * R P K S S Q R K D T H Q L W Y A F L C S A R S P H K E R I H I K ----:----|----:----|----:----|----:----|----:----|----:----| S Q P V G E * T A G S T R V F F P Y V D V K H Y A K K H L A R L G * L S L I C M K T T R R R I Y R G F D E C L F S V C * TstI MboI BsaXI BglII XhoII | DpnI FalI BsaXI | |BstKTI FalI | TstI \ \\ \ \ \ AAAGTAGATCTTTGGAGTGCTGGTGTCATATTATATGTCTGTTTATGTGGTTTTCCTCCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCATCTAGAAACCTCACGACCACAGTATAATATACAGACAAATACACCAAAAGGAGGT / / // / / / / | | || XhoII FalI BsaXI TspRI | | || BglII FalI TstI | | || MboI | | |DpnI | | BstKTI | BsaXI TstI K V D L W S A G V I L Y V C L C G F P P K * I F G V L V S Y Y M S V Y V V F L H S R S L E C W C H I I C L F M W F S S I ----:----|----:----|----:----|----:----|----:----|----:----| F T S R Q L A P T M N Y T Q K H P K G G L L L D K S H Q H * I I H R N I H N E E F Y I K P T S T D Y * I D T * T T K R W MnlI |MboI |BclI || DpnI || CspCI || |TspRI || |BstKTI || ||MfeI || ||TspEI || ||| TspDTI || ||| | AsuI* || ||| | |NlaIV Hin4II* AluI || ||| | |BmgT120I | MboI CviJI || ||| | ||CviJI | BglII |DdeI || ||| | ||HaeIII | XhoII ||SetI || ||| | ||| SetI | | DpnI ||| MwoI || ||| | ||| Hin4II* | | |BstKTI ||| | PsrI || ||| | ||| | PsrI | | || CspCI ||| | |TspGWI \\ \\\ \ \\\ \ \ \ \ \\ \ \\\ \ \\ TTCAGTGATCAATTGGGGCCACCTTCATTGAAGGAACAGATCTTACAAGCTAAGTATGCG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCACTAGTTAACCCCGGTGGAAGTAACTTCCTTGTCTAGAATGTTCGATTCATACGC / /// / / / ///// / / //// / / // / | ||| | | | ||||| Hin4II* Hin4II* |||| | | || TspGWI | ||| | | | ||||PsrI |||| | | |PsrI | ||| | | | |||SetI |||| | | |DdeI | ||| | | | ||AsuI* |||| | | MwoI | ||| | | | |BmgT120I |||| | CviJI | ||| | | | |HaeIII |||| | AluI | ||| | | | |CviJI |||| SetI | ||| | | | NlaIV |||XhoII | ||| | | TspEI |||BglII | ||| | | MfeI |||MboI | ||| | TspDTI ||CspCI | ||| BclI |DpnI | ||| MboI BstKTI | ||DpnI | |BstKTI | CspCI MnlI F S D Q L G P P S L K E Q I L Q A K Y A S V I N W G H L H * R N R S Y K L S M R Q * S I G A T F I E G T D L T S * V C V ----:----|----:----|----:----|----:----|----:----|----:----| N L S * N P G G E N F S C I K C A L Y A M * H D I P A V K M S P V S R V L * T H E T I L Q P W R * Q L F L D * L S L I R HinfI BfiI | DdeI |MlyI | | TatI |PleI | | |Csp6I MseI Csp6I ||TaqI | | ||RsaI BspCNI |RsaI BsrI ||ClaI | | ||ScaI |BseMII BstXI \\ \ \\\ \ \ \\\ \\ \ TTTTACTCTCCGTACTGGGATAAAATCGATGACTCAGTACTACATTTAATATCCAATCTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATGAGAGGCATGACCCTATTTTAGCTACTGAGTCATGATGTAAATTATAGGTTAGAA // / / // / / / /// // / / || BsrI | || ClaI | | ||| || MseI BstXI |Csp6I | || TaqI | | ||| |BseMII RsaI | |PleI | | ||| BspCNI | MlyI | | ||TatI BfiI | | |Csp6I | | ScaI | | RsaI | DdeI HinfI F Y S P Y W D K I D D S V L H L I S N L F T L R T G I K S M T Q Y Y I * Y P I F L L S V L G * N R * L S T T F N I Q S F ----:----|----:----|----:----|----:----|----:----|----:----| N * E G Y Q S L I S S E T S C K I D L R T K S E T S P Y F R H S L V V N L I W D K V R R V P I F D I V * Y * M * Y G I K TspDTI | HindIII AsuI* Csp6I | | AluI TspDTI AvaII |RsaI | | CviJI | StyI |BmgT120I Hpy178III* |SetI | | | SetI | SecI* \\ \ \\ \ \ \ \ \ \ TTGGTCCTAAATCCTGATGAAAGGTACAATATAGATGAAGCTTTGAACCACCCTTGGTTC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAGGATTTAGGACTACTTTCCATGTTATATCTACTTCGAAACTTGGTGGGAACCAAG // / / // / / / / / / |AvaII | | || TspDTI | | | TspDTI SecI* |AsuI* | | |Csp6I | | HindIII StyI BmgT120I | | RsaI | CviJI | SetI | AluI Hpy178III* SetI L V L N P D E R Y N I D E A L N H P W F W S * I L M K G T I * M K L * T T L G S G P K S * * K V Q Y R * S F E P P L V Q ----:----|----:----|----:----|----:----|----:----|----:----| K T R F G S S L Y L I S S A K F W G Q N K P G L D Q H F T C Y L H L K S G G K T Q D * I R I F P V I Y I F S Q V V R P E BsmAI Eco31I | TspEI | | TseI AluI | | CviRI* Hpy166II CviJI | | |BisI | TspEI TaqII | SetI | | ||BlsI | |BbvI \ \ \ \ \ \\\ \ \\ AATGACATACAGCAACAAAGCTCGGTCTCATTAGAATTGCAGCGTTTACAAATTACTGAC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTATGTCGTTGTTTCGAGCCAGAGTAATCTTAACGTCGCAAATGTTTAATGACTG / / / / ///// / // TaqII | CviJI | ||||| | |BbvI | AluI | ||||| | TspEI SetI | ||||| Hpy166II | ||||TseI | |||BisI | ||BlsI | |CviRI* | TspEI Eco31I BsmAI N D I Q Q Q S S V S L E L Q R L Q I T D M T Y S N K A R S H * N C S V Y K L L T * H T A T K L G L I R I A A F T N Y * Q ----:----|----:----|----:----|----:----|----:----|----:----| L S M C C C L E T E N S N C R K C I V S * H C V A V F S P R M L I A A N V F * Q I V Y L L L A R D * * F Q L T * L N S V DdeI | Hpy188I BspCNI | |TspEI |BseMII \ \\ \\ AATAAAATACCCAAAACATACTCAGAATTATCTTGCCTCTAA 1510 1520 1530 1540 ----:----|----:----|----:----|----:----|-- TTATTTTATGGGTTTTGTATGAGTCTTAATAGAACGGAGATT // / // |DdeI | |BseMII | | BspCNI | TspEI Hpy188I N K I P K T Y S E L S C L * I K Y P K H T Q N Y L A S X * N T Q N I L R I I L P L X ----:----|----:----|----:----|----:----|-- L L I G L V Y E S N D Q R * C Y F V W F M S L I I K G R I F Y G F C V * F * R A E L # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AclI 1 Psp1406I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AjuI 1 AlfI 2 AluI 6 AluBI ApoI 2 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 2 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 4 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 6 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 1 BsmAI 3 Alw26I,BstMAI BspCNI 6 BspLU11I* 1 PscI,PciI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 4 BstXI 1 CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 17 CviKI-1 CviRI* 6 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 4 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 2 GsaI 1 HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 5 HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 5 Hpy99I 4 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 4 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 1 MunI MlyI 2 SchI MmeI 1 MnlI 3 MseI 7 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI OliI 1 AleI PleI 2 PpsI PsrI 1 RsaI 6 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 14 SfaNI 1 LweI SmlI 1 SmoI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 5 TaqII 1 TatI 1 TauI 1 TfiI 3 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 1 VspI 2 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AgeI AhaIII* AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvII* Bce83I* BceAI BcgI BdaI BglI BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsePI BseRI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI BtsI Cac8I Cfr10I Cfr9I CfrI DinI DraII Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I FaqI FauI FseI FspAI GsuI HgaI HgiCI* HgiJII* Hin4I HpaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769